Probiotic characterization of Lactobacillus helveticus BGTRM7-58 from Khiki cheese: safety, antimicrobial activity, antioxidant capacity, and anti-biofilm effects against Staphylococcus aureus

Abstract

Traditional Iranian cheeses, especially “Khiki cheese,” represent valuable sources of indigenous lactic acid bacteria with potential probiotic properties. This study evaluated the probiotic attributes, safety profile, antimicrobial efficacy, antioxidant capacity, and anti-biofilm activity of Lactobacillus helveticus BGTRM7-58, a strain isolated from Khiki cheese. The strain demonstrated considerable anti-adhesion capability against Staphylococcus aureus. The cell-free supernatant (CFS) exhibited potent antimicrobial activity, displaying a minimum inhibitory concentration (MIC) of 15.625 mg/mL against S. aureus. Furthermore, the CFS inhibited biofilm formation by 87% at 4× MIC and disrupted pre-established mature biofilms by 89% at the same concentration. In vitro cytotoxicity assessment revealed dose-dependent antiproliferative effects against cancer cell lines. Quantitative real-time PCR analysis indicated significant downregulation of key staphylococcal virulence genes, most notably a 47% reduction in agr expression. The strain also exhibited substantial antioxidant activity, scavenging 68.67%, 71.75% of DPPH and ABTS radicals, respectively. Comprehensive safety evaluation confirmed the absence of hemolytic and DNase activities, no production of biogenic amines, and susceptibility to clinically relevant antibiotics. Taken together, these findings indicate that L. helveticus BGTRM7-58 fulfills the fundamental criteria for a safe and functional probiotic strain, highlighting its potential for application in functional food formulations and strategies aimed at controlling biofilm-associated infections.

Introduction

Dairy products, especially cheese, are excellent carriers for delivering probiotics, thanks to their unique matrix composition of fat, protein, and distinct structure. This composition provides a buffering capacity that shields bacterial cells from the stresses encountered in the gastrointestinal tract [1]. Traditional cheeses, like Iranian “Khiki cheese,” stand out as rich sources of various lactic acid bacteria (LAB) with promising probiotic attributes [2]. Made primarily in rural areas, these artisanal cheeses host unique microbial communities, many of which demonstrate remarkable functional properties such as resistance to acid and bile, the ability to adhere, and antimicrobial effects [3].

Choosing indigenous probiotic strains from traditional cheeses presents numerous benefits, including natural compatibility with the food matrix, adaptation to local environments, and the potential to enhance the economic and cultural significance of regional products [4]. Nonetheless, the identification of appropriate candidates necessitates a systematic screening process focused on safety, functionality, and technological viability. While multi-strain screenings are prevalent in probiotic research, this study adopts a targeted approach by characterizing a single promising strain, selected based on initial antimicrobial and tolerance assessments. This method allows for a deeper understanding of its specific mechanisms and potential applications. Previous research has demonstrated that LAB from traditional Iranian products exhibit valuable probiotic characteristics, such as the absence of harmful antibiotic resistance genes and the capacity to produce beneficial metabolites [5–12]. Similar observations have been made with traditional cheeses from various regions, highlighting the global significance of artisanal dairy microbiota as a source of potential probiotics [13, 14]. Recent reviews also stress the critical need for strain-specific evaluations to ensure safety and efficacy prior to industrial applications [15–18].

Beyond basic survival in the gastrointestinal tract, the contemporary evaluation of novel probiotic strains heavily prioritizes their advanced therapeutic functionalities, particularly their antagonistic effects against multidrug-resistant pathogens, antioxidant capacities, and anti-cancer potentials [19]. Among foodborne and nosocomial pathogens, Staphylococcus aureus represents a severe global health threat due to its robust ability to form impenetrable biofilms, secrete potent enterotoxins, and rapidly develop resistance to conventional antibiotics [20]. Consequently, exploring functional LAB as natural biocontrol agents has gained immense traction. Specific probiotic strains can competitively exclude S. aureus from epithelial adhesion sites, disrupt its mature biofilm matrices through the secretion of biosurfactants, and critically downregulate essential virulence genes (e.g., agr and hla) utilizing quorum-quenching mechanisms [21]. In addition to their anti-pathogenic prowess, indigenous LAB are increasingly recognized for their potent exogenous antioxidant properties. Strains capable of neutralizing reactive oxygen species (ROS)—often demonstrated via high 2,2-diphenyl-1-picrylhydrazyl (DPPH) and 2,2'-azinobis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) radical scavenging activities—play a pivotal role in alleviating cellular oxidative stress and preventing lipid peroxidation in both the food matrix and the host’s intestinal mucosa [22]. Such antioxidative defense mechanisms are mediated through the production of bioactive peptides, cell-surface exopolysaccharides, and intracellular antioxidant enzymes [23]. Furthermore, since chronic oxidative stress and persistent pathogenic infections are well-established precursors to cellular mutagenesis, the anti-cancer potential of probiotics has emerged as a groundbreaking area of research. Metabolites derived from functional LAB, including short-chain fatty acids (SCFAs) and specific bacteriocins, have been shown to exert targeted cytotoxic, anti-proliferative, and pro-apoptotic effects on various human carcinoma cell lines [24]. Therefore, to comprehensively validate the therapeutic efficacy of cheese-derived isolates, it is imperative to deeply investigate their specific capabilities in neutralizing S. aureus virulence, alleviating oxidative damage, and exhibiting protective anti-tumorigenic properties.

This study is designed to thoroughly assess the probiotic potential, safety profile, antimicrobial and antioxidant activities, and anti-biofilm effectiveness of Lactobacillus helveticus BGTRM7-58, which was isolated from Khiki cheese. A particular focus will be on its impact against S. aureus, a clinically significant pathogen renowned for its ability to form biofilms and exhibit virulence. The outcomes of this research are anticipated to advance the development of functional dairy products and offer a scientific foundation for employing indigenous strains in the management of biofilm-associated infections.

Materials and methods

Materials and microbial strains

All chemicals employed in this investigation were of analytical grade. Thiobarbituric acid (TBA), 2,2-diphenyl-1-picrylhydrazyl (DPPH), Folin-Ciocalteu reagent, rutin, and gallic acid were procured from Sigma-Aldrich Co. (USA). Peptone powder, plate count agar (PCA) medium, de Man, Rogosa and Sharpe (MRS) medium, sabouraud dextrose agar (SDA) medium, Mueller-Hinton agar (MHA) medium, methanol, aluminum chloride, sodium carbonate, and sulfuric acid (H₂SO₄) were obtained from Merck Co. (Germany).

The microbial strains utilized included the following bacteria: Escherichia coli, Shigella dysenteriae, Klebsiella aerogenes, Salmonella enterica serovar Typhimurium, Bacillus cereus, Streptococcus pyogenes, Staphylococcus aureus, and Listeria monocytogenes; and the following filamentous fungi: Rhizopus stolonifer, Aspergillus niger, and Botrytis cinerea. All strains were provided by the Food Microbiology Laboratory within the Department of Food Science and Technology, Faculty of Animal Science and Food Technology, Agricultural Sciences and Natural Resources University of Khuzestan.

Antimicrobial activity

Preparation of cell-free supernatant (CFS)

L. helveticus strain BGTRM7-58 was cultured anaerobically in MRS broth at 37 °C for 28 h. Bacterial cells were subsequently harvested via centrifugation at 5,000 × g for 20 min at 4 °C (Centrifuge Model Z206A, GMBH, Germany). The supernatant was collected and sterile-filtered using a 0.22 μm membrane filter. The resultant CFS was lyophilized (Beta 2–8 LSCplus, Germany) at -55 °C for 48 h. The lyophilized powder was stored at -20 °C until use.

For experimental assays, the CFS powder was reconstituted in sterile distilled water to a final concentration of 500 mg/mL and then neutralized [25].

Disc diffusion assay (DDA) and well diffusion agar (WDA)

To determine antimicrobial activity, a standardized suspension of target pathogens (E. coli, S. dysenteriae, K. aerogenes, S. enterica serovar Typhimurium, B. cereus, S. pyogenes, S. aureus, L. monocytogenes, R. stolonifer, A. niger, and B. cinerea.) was prepared at a concentration equivalent to 1.5 × 10⁸ colony-forming units per milliliter (CFU/mL). In the DDA and WDA methods, 100 µL of the aforementioned microbial suspension was initially inoculated onto the surface of MHA (bacteria) and SDA (fungi). In the WDA method, after inoculation, wells were created in the agar, and 60 µL of neutralized CFS (500 mg/mL) was added into these wells. Concurrently, in the DDA method, sterile disks were impregnated with CFS and placed on the surface of the culture medium. All plates were then incubated under appropriate conditions: at 37 °C for 48 h for bacterial assays and at 27 °C for 72 h for fungal assays. Following incubation, the diameter of the inhibition zone surrounding each well and disk was measured to determine antimicrobial activity [25].

Modified double layer method

The anti-bacterial activity of the isolate was assessed using a modified agar overlay method. Isolates were first cultured in MRS broth, then inoculated onto MRS agar (for the probiotic bacterial strain) and SDA agar (for fungal isolates) plates. These plates were incubated at 37 °C for 24 h (bacteria) or 27 °C for 72 h (fungi). Following this, a broth culture of the target pathogen was prepared and mixed into 10 mL of nutrient soft agar medium (0.8% agar). This mixture was then overlaid onto the pre-incubated MRS and SDA plates. Plates were again incubated at 37 °C for 24 h (bacteria) or 27 °C for 72 h (fungi). After incubation, zones of inhibition were measured to evaluate the isolate’s inhibitory effect against the pathogen [25]. Sterile distilled water served as the negative control.

Minimum inhibitory concentration (MIC), minimum bactericidal concentration (MBC), and minimum fungicidal concentrations (MFC)

The CFS from the strain were subjected to serial two-fold dilutions, ranging from 500 mg/mL to 0.977 mg/mL, in a 96-well microtiter plate. 10 µL of the pathogenic strains (1.5 × 10⁸ CFU/mL) were then introduced into each well containing the diluted CFS. The MIC was defined as the lowest concentration of CFS that completely inhibited visible growth of the pathogens. To determine the MBC and MFC, aliquots from non-turbid wells were subcultured onto MHA and SDA plates, respectively. Bacterial plates were incubated at 37 °C for 24 h, and fungal plates were incubated at 27 °C for 72 h. MBC and MFC were recorded as the lowest concentrations that inhibited bacterial and fungal growth, respectively [25, 26]. Sterile distilled water served as the negative control.

Deoxyribonuclease (DNase) test and hemolytic activity

In both assays, L. helveticus BGTRM7-58 was inoculated from an 18–24 h culture grown in MRS broth. To assess DNase activity, the strain was applied using the streak plate method with a sterile loop onto DNase agar medium (Merck, Germany). The plates were incubated aerobically at 37 °C for 48 h. After incubation, the plates were treated with 1 N HCl to reveal any potential DNase activity. A positive result was indicated by the presence of clear zones surrounding the colonies [27].

For the evaluation of hemolytic activity, the bacterial cultures were similarly streaked onto tryptic soy agar (TSA, Merck, Germany) enriched with 7% (v/v) sheep blood and incubated aerobically at 37 °C for 24–48 h. After incubation, the plates were examined for hemolytic patterns: a clear zone denoted β-hemolysis, a greenish zone indicated α-hemolysis, and the absence of color change represented γ-hemolysis. S. aureus ATCC 25,923, which exhibits β-hemolysis, and E. coli ATCC 25,922, representing α-hemolysis, were utilized as positive and negative controls, respectively [27].

Biogenic amine production

The biogenic amine production capacity of the strain—specifically for histamine, tyramine, putrescine, and cadaverine—was assessed by evaluating the metabolic conversion of their respective precursor amino acids. The assay was conducted using MRS agar supplemented with 0.06% bromocresol purple and 0.1% (w/v) of each precursor: L-histidine monohydrochloride, tyrosine disodium salt, L-ornithine monohydrochloride, and L-lysine monohydrochloride. Following incubation at 37 °C for 2–5 days, a positive result was indicated by a color shift of the medium to purple [28, 29].

Antibiotic susceptibility test

The antibiotic susceptibility of the strain was examined using the method reported by Zareie et al. [3]. This method is based on the guidelines provided by the Clinical and Laboratory Standards Institute (CLSI). A suspension of a fresh bacterial culture was prepared. Then, 100 µL of the suspension was uniformly plated onto the surface of MRS agar medium. After the surface dried, antibiotic discs including Imipenem, Ampicillin, Erythromycin, Ciprofloxacin, Nalidixic acid, Nitrofurantoin, and Chloramphenicol were placed on the medium. The plates were incubated at 37 °C for 24 h. Finally, the diameter of the growth inhibition zones around the discs was measured, and the results were reported as the mean value. The isolate was classified as resistant (≤ 15 mm), intermediate (15–21 mm), or sensitive (≥ 21 mm) based on the diameter of the inhibition zone.

Antioxidant activity

DPPH Free radical scavenging activity

The DPPH free radical scavenging activity was assessed using a method inspired by the protocol established by Chang et al. [30], with minor adjustments. Initially, 1 mL of the cellular suspension of the strain under investigation (adjusted to 10⁹CFU/mL), or methanol as a control, was combined with 2 mL of a 0.05 mM methanolic DPPH solution. After thorough mixing, the solution was allowed to rest in the dark at room temperature for 30 min. The absorbance of each sample was then measured at 517 nm following centrifugation at 8000 ×g for 10 min. The following equation was applied to measure the antioxidant activity.

Scavenging Activity % = ( ​​) ×100 Eq. (1)

ABTS Radical scavenging activity

The ABTS radical scavenging activity was assessed following the methodology outlined by Alizadeh-Behbahani et al. [31]. To prepare the ABTS solution, a mixture of 7 mM potassium persulfate and 14 mM ABTS was combined in a 0.1 M potassium phosphate buffer (pH 7.4) and incubated in the dark for 12 to 16 h at a temperature ranging from 20 to 25 °C. Once the reaction completed, the solution was diluted with the same buffer until its absorbance reached 0.7 ± 0.01 at 734 nm. Subsequently, 300 µL of the sample (cellular suspension) was combined with 600 µL of the ABTS solution and incubated for 30 min. The absorbance readings were taken at 734 nm, and the percentage of radical inhibition was calculated using Eq. 2.

Scavenging Activity % = ( ​​) ×100 Eq. (2)

Inhibition of linoleic acid peroxidation

The inhibitory effect of the strain on linoleic acid peroxidation was investigated using the TBA method, with slight modifications to reference protocols [32]. In brief, the reaction mixture was prepared containing 1 mL of linoleic acid emulsion, 0.5 mL of PBS buffer, 0.2 mL of 0.01% ferrous sulfate, 0.2 mL of 0.01% ascorbic acid, and 0.5 mL of the isolate culture (cellular suspension). The linoleic acid emulsion was prepared by mixing 1 mL of linoleic acid (Sigma, USA), 0.2 mL of Tween 20, and 19.7 mL of distilled water. The resulting emulsion was stored in the dark. The mixture was incubated for 12 h at 37 °C. Following incubation, 2 mL of 0.8% TBA solution, 0.2 mL of 4% trichloroacetic acid, and 0.2 mL of butylated hydroxytoluene were added to the reaction mixture. Samples were then heated at 100 °C for 30 min. After cooling, extraction was performed with 2 mL of chloroform, and the absorbance of the TBA-reactive substances was measured at 532 nm. Results were reported as the percentage inhibition of linoleic acid peroxidation relative to the control.

Total phenolic content

The total phenolic content (TPC) was measured using the Folin–Ciocalteu method. Briefly, 400 µL of each sample (cellular suspension) was transferred into separate vials, followed by the addition of 200 µL of Folin Ciocalteu reagent (1:10 dilution). After 4–5 min of incubation at room temperature, 600 µL of 10%(w/v) sodium carbonate solution was added. A control sample containing 1600 µL of distilled water was also prepared. All vials were kept in the dark for 1 h and then centrifuged at 5000×g for 5 min. The absorbance of the supernatant was read at 760 nm using a spectrophotometer. Gallic acid was used to establish the standard curve, and results were expressed as micrograms of Gallic Acid Equivalent (µg GAE) per mL of sample [33].

Total flavonoid content

The total flavonoid content (TFC) of the samples (cellular suspension) was evaluated using an aluminum chloride colorimetric assay. In this procedure, 100 µL of the sample was combined with 100 µL of a 2% AlCl₃ solution. The resulting mixture was allowed to incubate in the dark at room temperature for 30 min. Following the incubation period, the absorbance was measured at 415 nm. To ensure accuracy, a standard calibration curve was generated using quercetin. The findings were expressed as micrograms of Quercetin Equivalent (µg QE) per mL of sample [33].

Cytotoxicity on cancer cell lines

The cytotoxic effects of live L. helveticus BGTRM7-58 cells and their CFS on human cancer cell lines (HT-29, HeLa, and MCF-7) were evaluated using the MTT assay (3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide). To assess the effect of live cells, bacterial suspensions of L. helveticus BGTRM7-58 were adjusted in antibiotic-free Dulbecco’s Modified Eagle Medium (DMEM) to maintain bacterial viability. The final bacterial concentrations used in the assay were 10⁶, 10⁷, and 10⁸ CFU/mL. Concurrently, human cancer cell lines (HT-29, HeLa, and MCF-7) were cultured in 96-well plates at a density of 3 × 10³ cells per well and incubated for 24 h to facilitate cell adhesion. Subsequently, the culture medium was replaced with DMEM containing fresh FBS, and varying concentrations of CFS (ranging from 0.195 to 200 mg/mL) were added to each well. Similarly, for both live cell and CFS treatments, after 24 h of co-culture (or incubation with CFS), MTT solution (5 mg/mL, 30 µL) was added to each well and incubated for 3 to 4 h. The resulting formazan crystals were dissolved in dimethyl sulfoxide (DMSO), and the absorbance was measured at a wavelength of 570 nm using a microplate reader. Cell viability was calculated as the percentage of cancer cell survival relative to untreated controls [34].

Anti-adhesion properties

The anti-adhesion properties of the strain against S. aureus were evaluated using three distinct methods competition, inhibition, and displacement in accordance with the study by Hojjati et al. [35]. Caco-2 cells, sourced from the Iranian Biological Resource Center (C10094, Tehran, Iran), were cultured in 75 cm² flasks following established protocols. The cells were kept at 37 °C in a humidified environment containing 5% CO₂. Feeding was performed every other day using DMEM (Sigma-Aldrich, USA), enriched with 5% fetal bovine serum (Sigma-Aldrich, USA) and 1% penicillin-streptomycin (10,000 U/mL, Sigma-Aldrich, USA). Once the cells reached approximately 80% confluency, they were detached from the flasks through trypsinization with 1% trypsin-EDTA (Sigma-Aldrich, USA) and subsequently seeded into 6-well tissue plates (Sigma-Aldrich, USA) at a density of 25,000 cells/cm². Every two days, the wells were refreshed with complete medium. This procedure continued for 15 ± 1 days to establish a monolayer of differentiated and polarized cells.

In the competition assay, Caco-2 cells were simultaneously inoculated with suspensions of L. helveticus BGTRM7-58 and S. aureus (each at concentration of 2 × 10⁸ CFU/mL) at a 1:1 ratio and incubated for 1 h at 37 °C with 5% CO₂. After washing with PBS and detaching the bacteria with 0.05% Triton X-100, to enumerate the adhered S. aureus, the resulting suspension was spread plated onto selective mannitol salt agar (MSA). The plates were incubated at 37 °C for 48 h, and the colonies of S. aureus were counted. The relative adherence of S. aureus in the presence of L. helveticus BGTRM7-58 was calculated using Eq. 3.

3

In the inhibition assay, Caco-2 cells were first incubated with the studied strain for 1 h. After washing with PBS, the cells were then inoculated with S. aureus. The colony count of adhered bacteria was determined, and the percentage of adhesion inhibition was calculated using Eq. 4.

4

In the displacement assay, S. aureus was first added to the Caco-2 cells and incubated for 1 h; non-adherent bacteria were then removed. Subsequently, the studied strain was added to the wells and incubated again for 1 h. The reduction in the adhesion of S. aureus in the presence of L. helveticus BGTRM7-58 was reported as the percentage of displacement.

Evaluation of anti-biofilm activity

The effect of the CFS of the strain on the formation and disruption of the S. aureus biofilm was assessed using the Crystal Violet assay [36]. For the inhibition of initial biofilms (formation), the CFS was added to 96-well plates at concentrations ranging from 78% to 100% (v/v) along with a bacterial suspension equivalent to 10⁶ CFU/mL. After 24 h, the wells were washed, dried at ambient temperature, and stained with 1% Crystal Violet, and the absorbance was measured at 570 nm. For the evaluation of mature biofilm disruption, the preformed biofilms were treated with various concentrations of CFS. The plates were incubated for an additional 24 h at 37 °C. Subsequently, the plates were washed twice, and the remaining biofilms were quantified using the aforementioned method. Finally, the rate of biofilm formation was calculated using Eq. 5.

After 24 h, the wells were washed, dried at ambient temperature, and stained with 1% Crystal Violet, and the absorbance was measured at 570 nm. For the disruption of mature biofilms, biofilms were first allowed to form over 24 h and were then treated with varying concentrations of the CFS (78%–100% v/v). The plates were incubated for an additional 24 h at 37°C. Subsequently, the plates were washed twice, and the remaining biofilms were quantified using the aforementioned method. Finally, the rate of biofilm formation was calculated using Eq. 5.”

5

Gene expression analysis

Quantitative RT-PCR (qRT-PCR) technique was used to investigate the expression of genes associated with biofilm formation and virulence, following the method described by Rouhi et al. [34]. Initially, the indicator strain, S. aureus, was cultured in TSB medium for 24 h at 37 °C. Subsequently, the cell density was adjusted to approximately 10⁵ CFU/mL. The bacterial suspension was then incubated for an additional 24 h in the presence of the MIC of the CFS, while the control group received only culture medium. Total RNA extraction was performed using the TRIzol™ kit (Invitrogen, Thermo Fisher Scientific, USA). Next, cDNA synthesis was carried out via reverse transcription using the SensiFAST kit (Bioline, UK). Quantitative PCR (qPCR) reactions were executed using SYBR Green Master Mix on a PikoReal 96 apparatus (ScientificPierce, USA). The thermal cycling program included an initial denaturation at 95 °C for 5 min, followed by 45 cycles consisting of denaturation at 95 °C for 5 s, primer annealing at 60 °C for 30 s, and extension at 72 °C for 30 s. All reactions were performed in triplicates, and the relative gene expression was calculated using the 2^−ΔΔCt method with 16 S rRNA as the internal reference gene. (Table 1).

Table 1.

PCR Primers for S. aureus Virulence Gene Analysis

Gene	Primer (sequence of primers (5′–3′))
icaA	Forward CTGGCGCAGTCAATACTATTTCGGGTGTCT Reverse GACCTCCCAATGTTTCTGGAACCAACATCC
agr	Forward TGATAATCCTTATGAGGT GCTT Reverse CACTGTGACTCGTAACGAAAA
hla	Forward GGTTTAGCCTGGCCTTCAGC Reverse ACCAGTAACATTACCGTTGAATCCA
mecA	Forward ACTGCTATCCACCCTCAAAC Reverse CTGGTGAAGTTGTAATCTGG
spa	Forward TAAAGACGATCCTTCGGTGAGC Reverse CAGCAGTAGTGCCGTTTGCTT
16 S rRNA	Forward ACTGGGCGTAAAGAGYTCGT Reverse CGCATTTCACCGCTACAC

Morphological changes by scanning electron microscopy (SEM)

The effect of CFS on the cell wall structure of S. aureus was evaluated using scanning electron microscopy (SEM). To activate the bacteria, they were incubated in Muller-Hinton broth at 37 °C for 24 h. A MIC dilution of CFS was prepared and combined with the microbial suspension. This mixture was incubated at 37 °C for 18 h, followed by centrifugation at 6000 rpm for 5 min to remove the supernatant. The resulting pellet was washed with PBS and centrifuged again under the same conditions. The sample was fixed with a 2.5% glutaraldehyde solution and stored at 4 °C for 2 h. After fixation, the sample underwent three washes with sodium cacodylate buffer (0.1 M, pH 7.4), each lasting 15 min, and was dehydrated using a series of alcohol concentrations, with centrifugation following each wash for 15 min. Finally, the sample was gold-coated and examined using an SEM.

Statistical data analysis

All experiments were repeated three times and data were analyzed using one-way Analysis of Variance (ANOVA) with SPSS version 22. The Duncan’s Multiple Range Test was used to compare the means at a 95% confidence level (P < 0.05), and graphs were plotted using Excel 2016 software.

Results and discussion

The strain was isolated from Khiki cheese and characterized through 16 S rRNA sequencing, with the associated Accession Number: HE962115.1.

Antimicrobial activity

The CFS of Lactobacilli encompasses a complex mixture of secondary metabolites, primarily including organic acids (such as lactic and acetic acids), hydrogen peroxide, and bacteriocins [37]. These compounds restrict the growth of pathogenic bacteria and fungi through several mechanisms: reducing the environmental pH, creating oxidative stress, disrupting cell membranes, and inhibiting macromolecule synthesis [37]. In this study, the strain’s CFS was effective in inhibiting a broad spectrum of Gram-positive bacteria, Gram-negative bacteria, and pathogenic fungi. Figure 1 illustrates the antimicrobial activity of the strain using the DDA, WDA, and modified double layer method, while Fig. 2 shows the strain’s antimicrobial activity determined by the MIC and MBC/MFC methods.

Fig. 1.

Antimicrobial activity of L. helveticus BGTRM7-58 cell-free supernatant (CFS) against pathogenic strains, evaluated using disk diffusion, well diffusion, and modified double-layer methods. The antimicrobial effect was determined based on the diameter of inhibition zones. Data represent the mean ± standard deviation (SD) of three independent experiments (n = 3)

Fig. 2.

Minimum inhibitory concentration (MIC) and minimum bactericidal/fungicidal concentration (MBC/MFC) of L. helveticus BGTRM7‑58 cell‑free supernatant (CFS) against bacterial and fungal pathogens. Results are presented as mean values from three independent experiments (n = 3)

The present findings demonstrated that L. helveticus BGTRM7-58 exhibits a stronger inhibitory effect against Gram-positive bacteria such as S. aureus and L. monocytogenes (p < 0.05). This is typically attributed to the simpler structure of the Gram-positive cell wall, which enhances the penetration of metabolites and antibacterial compounds [38]. In contrast, the activity against Gram-negative bacteria was weaker, particularly against K. aerogenes, which is associated with the presence of an outer membrane containing lipopolysaccharide and the efflux pump capability of these bacteria [38]. S. aureus showed the highest degree of inhibition, characterized by larger inhibition zone diameters (13.5 mm) and low MIC (15.625 mg/mL) and MBC (62.50 mg/mL) values. This indicates the high efficacy of the strain’s secreted metabolites in restricting the growth of Gram-positive pathogens. Regarding fungal activity, the strain showed a moderate inhibitory effect, suggesting that the secreted metabolites can play a supplementary role in controlling fungal growth. The antifungal activity of Lactobacilli is often linked to the production of organic acids, the resulting pH reduction, and the secretion of specific peptidic compounds such as antifungal peptides [39].

Ibrahim et al. [40] demonstrated that the metabolites of L. plantarum and L. helveticus restrict the growth of S. Typhimurium and S. aureus through the production of bacteriocins and organic acids. In another study, L. helveticus strains isolated from local Behbahan cheese showed significant antibacterial activity against foodborne pathogens, including S. aureus [41]. Based on the current data and previous research, the strain L. helveticus BGTRM7-58, by producing antimicrobial metabolites, can not only play a protective role in the gastrointestinal tract but also has potential application in the food industry as a natural biopreservation agent for enhancing product safety and shelf life.

DNase test, absence of hemolytic activity, biogenic amine production, and antibiotic resistance

One of the most crucial criteria for selecting probiotic strains is the assessment of their safety through assays such as hemolytic activity, biogenic amine production, and DNase activity. The results of this study demonstrated that the strain lacks hemolytic activity and the ability to produce both DNase and biogenic amines. These findings underscore the non-pathogenic nature of the strain with respect to the degradation of blood cells, destruction of DNA, and the generation of toxic metabolites [42]. Evaluating hemolytic activity is an indispensable requirement in probiotic safety profiling, as hemolysis is a prominent virulence factor utilized by invasive pathogens to acquire essential iron and lyse host erythrocytes. The complete absence of hemolytic activity (γ-hemolysis) in the assessed strain guarantees that it does not possess exotoxins like hemolysins, which disrupt epithelial cell membranes and cause systemic toxicity. If a strain were to exhibit β-hemolysis, it could lead to opportunistic infections, bacteremia, or endocarditis under specific vulnerable conditions. Thus, confirming a non-hemolytic phenotype strictly validates the strain’s safety for human consumption and mucosal interactions [43, 44].

Similarly, the absence of DNase activity is another critical safety benchmark, as the production of extracellular deoxyribonucleases is frequently correlated with microbial pathogenicity. Pathological strains proactively utilize DNase to degrade host DNA and successfully evade immune system responses, such as trapping by neutrophil extracellular traps (NETs). Therefore, a negative DNase phenotype effectively confirms that the probiotic candidate cannot compromise the host’s genetic material or cellular integrity at the site of colonization. This characteristic significantly reduces the risk of opportunistic pathogenesis, fulfilling a fundamental prerequisite for corroborating the Qualified Presumption of Safety (QPS) status of the strain [45, 46]. A study on the safety profile of indigenous Iranian Lactobacillus strains also revealed that these isolates lacked both hemolytic activity and biogenic amine production, confirming their desirable safety profile [3].

Furthermore, the inability of the strain to produce biogenic amines (BAs) represents a highly favorable technological and metabolic trait. Biogenic amines, including histamine, tyramine, and putrescine, are formed through the undesirable microbial decarboxylation of amino acids during food fermentation. The subsequent accumulation of these toxic nitrogenous compounds in fermented matrices can trigger severe neurological and cardiovascular reactions in consumers, initiating symptoms like migraines, severe hypertension, and allergic-like shock. By entirely lacking the specific amino acid decarboxylase enzymes responsible for BA synthesis, the strain mitigates food poisoning risks, ensuring the rigorous biochemical safety of final commercialized functional products [47]. Furthermore, the long history of safe use of Lactobacilli in fermented foods has led to their general acceptance under the GRAS/QPS safety status [48]. The absence of hemolytic and DNase activity in the studied strain may also indicate the lack of virulence genes typically found in pathogenic strains. Since the accumulation of biogenic amines in fermented products can have adverse effects on consumer health, the total absence of biogenic amine production is of great significance [3, 49].

Based on the results obtained, the strain L. helveticus BGTRM7-58 demonstrated high sensitivity to Chloramphenicol and Erythromycin, while displaying greater relative resistance to Imipenem and Ampicillin (p < 0.05) (Fig. 3). In previous studies, Anisimova et al. [49] also reported that many Lactobacillus strains exhibit relative resistance to β-lactam antibiotics (such as Ampicillin). Alizadeh-Behbahani et al. [50] showed that some Lactobacillus strains are naturally resistant to Imipenem but highly sensitive to Chloramphenicol and Erythromycin. This pattern suggests that the intrinsic resistance of Lactobacilli can be attributed to their genetic structure and the presence of specific resistance genes, while higher sensitivity to certain antibiotics (like Chloramphenicol) points to limitations in the defense mechanisms of these bacteria. Exploring the antibiotic resistance profile of probiotic candidates is fundamental to preventing the insidious proliferation of antimicrobial resistance (AMR). The observed intrinsic resistance to certain beta-lactams is widely common among Lactobacilli; crucially, it is chromosomally encoded and non-transferable, rendering it a negligible risk for horizontal gene transfer to gut enteropathogens. Conversely, the high sensitivity to Chloramphenicol and Erythromycin confidently confirms the absence of transferable resistance elements, such as those carried on mobile genetic elements like plasmids or transposons. This distinctive susceptibility profile strongly validates the strain’s pharmacological biosafety within the dynamic human gastrointestinal microbiome [51, 52]. Such results are of particular importance when selecting safe probiotic strains without the risk of transferring antibiotic resistance genes [53, 54].

Fig. 3.

Effect of commonly used antibiotics on the growth of L. helveticus BGTRM7-58, determined by the disk diffusion method and expressed as inhibition zone diameter (mm). Data are presented as mean ± standard deviation (SD) from three independent experiments (n = 3)

Antioxidant properties

The high percentage of free radical scavenging demonstrated by the strain in the DPPH (68.67%) and ABTS (71.75%) assays indicates the strain’s potent capacity for neutralizing free radicals. Additionally, the strain exhibited a high ability to inhibit linoleic acid peroxidation (43.40%), a finding of particular importance in mitigating lipid oxidation. The quantified TPC of 49.69 µg/mL and TFC of 17.25 µg/mL confirm the presence of key bioactive compounds within the strain, which play a fundamental role in establishing its antioxidant properties. The robust radical scavenging and anti-lipid peroxidation capabilities observed in L. helveticus BGTRM7-58 are closely linked to the strain’s exceptional proteolytic activity and the production of specific extracellular metabolites. In the study by Skrzypczak et al. (2017), the fermentation of milk proteins by Polish strains of L. helveticus resulted in a significant increase in antioxidant activity, which is mainly attributed to the production of antioxidant bioactive peptides during the protein hydrolysis process [55]. Previous studies on L. helveticus have demonstrated that this species excels at hydrolyzing proteins to release low-molecular-weight bioactive peptides containing hydrophobic amino acids, which act as highly effective electron and hydrogen donors to stabilize free radicals. Furthermore, the substantial concentrations of total phenolic and flavonoid compounds identified in the cell-free extract strongly contribute to chelating metal ions and halting the chain reactions of linoleic acid peroxidation. These synergistic mechanisms—combining bioactive peptides, exopolysaccharides, and intrinsic phenolic compounds—fortify the strain’s ability to prevent oxidative stress-induced cellular damage, positioning it as a highly functional dietary antioxidant that can protect host mucosal tissues [56, 57]. Consistent with the results of this study, Namdari and Nejati [58] showed that L. helveticus strains generate considerable antioxidant capacity during the milk fermentation process. The study by Li et al. (2017) reported the effective capacity of exopolysaccharides (EPS) produced by the L. helveticus MB2-1 strain in neutralizing ROS and inhibiting free radicals [59]. Moreover, the enhanced antioxidant activity observed in yogurts fermented with L. helveticus during storage has been attributed to the increased bioactive compounds produced during the fermentation process [60].

Cytotoxic effect

Co-incubation of cancer cell lines with live L. helveticus BGTRM7-58 cells produced a notable, albeit moderate, decrease in cancer cell viability, demonstrated in a dose-dependent manner (Table 2). As the concentration of bacteria increased from 10⁶ to 10⁸ CFU/mL, there was a corresponding decline in cell viability across all cancer lines tested (p < 0.05). Among these, HT-29 cells displayed the highest sensitivity to the live bacterial treatment, followed by HeLa and MCF-7 cells. At the maximum concentration of 10⁸ CFU/mL, the viability of HT-29 cells fell to about 64%, while HeLa and MCF-7 cells maintained viability rates of approximately 73% and 79%, respectively. Conversely, at the lower bacterial concentration of 10⁶ CFU/mL, the impact on cell viability was minimal. These outcomes suggest that live L. helveticus cells possess a quantifiable antiproliferative effect on cancer cells, though this effect is less pronounced than that observed with the cell-free supernatant.

Table 2.

Cytotoxic effect of live Lactobacillus helveticus BGTRM7-58 cells on different cancer cell lines evaluated by MTT assay at different bacterial concentrations

Cell line	106 CFU/mL (Viability %)	107 CFU/mL (Viability %)	108 CFU/mL (Viability %)
HT-29	88.5 ± 2.1	76.4 ± 2.8	64.2 ± 3.1
HeLa	91.2 ± 1.9	82.6 ± 2.5	72.8 ± 2.6
MCF-7	93.7 ± 2.7	86.1 ± 1.3	78.5 ± 1.8

Data represent cancer cell viability (%) after co-incubation with live L. helveticus cells for 24 h, expressed as mean ± SD (n = 3)

These findings underscore the ability of live L. helveticus cells to diminish cancer cell viability in a concentration-dependent manner, thereby reinforcing the probiotic-associated anticancer potential of this strain. It should be noted that “cell viability” in this context specifically refers to the survival of cancer cells, rather than bacterial viability as determined by the MTT assay. While live bacterial cells showed a reduced cytotoxic effect compared to the cell-free supernatant, this aligns with prior research suggesting that secreted metabolites—such as short-chain fatty acids, bacteriocins, and hydrogen peroxide—are major contributors to the anticancer efficacy of lactic acid bacteria. Nonetheless, the decrease in cancer cell viability observed with direct exposure to live bacteria implies that other mechanisms could play a role, including cell–cell interactions, localized metabolite production, and modulation of oxidative stress at the cell surface [16, 61–67]. The heightened sensitivity of HT-29 cells to live L. helveticus may relate to their intestinal origin, rendering them more relevant to probiotic–host dynamics. Recent studies have similarly identified dose-dependent antiproliferative effects of live Lactobacillus strains on colorectal cancer cells, further endorsing the biological relevance of these findings [34, 68]. These findings align with the study by Rouhi et al. [69], who reported the antiproliferative activity of L. helveticus on colorectal cells. Furthermore, Rouhi et al. [70] research on the strain L. plantarum TW57-4 showed that this probiotic, in addition to restricting the expression of L. monocytogenes virulence genes, can create unfavorable conditions for the survival of cancer cells by reducing biofilm-forming capacity and secreting antimicrobial metabolites. The study by Mahmoudi et al. (2023) indicates that fermented milk sera (FMSs) derived from the L. helveticus KMCH1 strain exhibit the most significant cytotoxic effect on HT-29 colon cancer cells. The researchers attribute the superiority of this strain to its stronger proteolytic activity, leading to the production of more bioactive peptides and consequently, a more potent anti-cancer property [71]. The similarity between our results and this study suggests that the anticancer function of probiotic strains is largely due to common mechanisms, including the reduction of oxidative stress and the induction of programmed cell death (apoptosis). Altogether, this data enhances the cytotoxicity findings obtained from the cell-free supernatant, indicating that L. helveticus exhibits anticancer properties via both secreted metabolites and, to a lesser extent, through direct interactions facilitated by live bacterial cells.

The freeze-dried CFS of L. helveticus BGTRM7-58 exhibited a significant dose-dependent cytotoxic effect against all three cancer cell lines, with the strongest viability reduction observed at the highest concentration (200 mg/mL). Importantly, the sensitivity ranking (HT-29 > HeLa > MCF-7) was completely consistent with that observed for live bacterial cells (Table 2). This consistency suggests that the anticancer activity of L. helveticus is mediated through secreted metabolites, and the relative resistance or sensitivity of each cell line is preserved regardless of whether live bacteria or their CFS is used. The strong cytotoxic effect at higher concentrations supports the potential application of CFS as a postbiotic agent. Furthermore, the dose-dependent nature of the response indicates that the observed effects are biologically specific rather than nonspecific toxicity. Overall, these findings confirm that L. helveticus BGTRM7-58 exerts its antiproliferative effects via both direct cell contact and secreted metabolites. (Table 3)

Table 3.

Cytotoxic effect of freeze-dried cell-free supernatant (CFS) of Lactobacillus helveticus BGTRM7-58 on different cancer cell lines evaluated by MTT assay

Concentration (mg/mL)	HT-29 (Viability %)	HeLa (Viability %)	MCF-7 (Viability %)
0.195	95.3 ± 2.5 a	97.2 ± 1.7 a	98.7 ± 1.5 a
0.39	93.8 ± 2.3 a	95.5 ± 1.8 a	96.0 ± 1.9 a
0.78	91.0 ± 2.1 a	92.5 ± 1.9 ab	94.5 ± 1.6 ab
1.56	86.2 ± 2.4 b	88.0 ± 2.1 b	91.0 ± 2.3 b
3.125	80.5 ± 2.6 c	83.5 ± 2.5 c	87.6 ± 2.1 c
6.25	73.6 ± 3.0 d	77.5 ± 2.7 d	83.0 ± 2.5 c
12.5	65.1 ± 3.2 e	70.2 ± 2.6 e	77.9 ± 2.4 d
25	55.7 ± 3.4 f	62.5 ± 2.9 f	70.3 ± 2.7 e
50	43.9 ± 3.6 g	53.1 ± 3.1 g	62.0 ± 2.9 f
100	31.8 ± 3.8 h	42.3 ± 3.5 h	54.9 ± 3.1 g
200	21.0 ± 4.2 i	32.5 ± 3.8 i	45.8 ± 3.6 h

Data represent cancer cell viability (%) after 24 h incubation with different concentrations of freeze-dried CFS, expressed as mean ± SD (n = 3).

Cell anti-adhesion property

Anti-adhesion assays, including competition, inhibition, and displacement, are considered among the most critical indicators of probiotic functionality. They demonstrate the extent to which a strain can compete with pathogens for binding sites on the epithelium or even displace them after initial colonization [72]. The strain was able to prevent the adhesion of S. aureus by approximately 50.65% in the competition assay, 47.49% in the inhibition assay, and 29.20% in the displacement method (p < 0.05) (Fig. 4). Regarding the dynamic of pathogen interference, the consistently higher percentages observed in the competition and inhibition assays compared to the displacement test shed light on the strain’s primary defense strategy. Specifically, ‘prophylactic inhibition’ (exclusion) indicates that when L. helveticus BGTRM7-58 pre-colonizes the epithelium, it forms a dense physical barrier, completely masking specific host receptors (e.g., mucin binding sites) and preventing pathogen access via steric hindrance. Conversely, ‘competition’ implies that during simultaneous exposure, the probiotic relies on its highly active surface molecules, such as Surface-layer (S-layer) proteins, to outcompete S. aureus for identical attachment loci due to a superior binding affinity. The lower success rate in ‘displacement’ confirms that removing an already established, strongly adhered pathogen is thermodynamically more challenging. Thus, this L. helveticus strain acts predominantly as a pre-emptive protective shield rather than a post-infection curative agent [73]. The findings from this study are consistent with recent reports. Kioussi et al. [74] showed that L. helveticus is capable of reducing the adherence of Campylobacter jejuni to epithelial cells through competition for receptors. In another study, the anti-adhesion activity of L. helveticus strains against E. coli O157:H7 was reported, with competition being proposed as the main mechanism for binding sites [74].

Fig. 4.

Anti-infection activity of L. helveticus BGTRM7-58 against S. aureus, assessed using competition, inhibition, and displacement assays. The ability of the strain to prevent or reduce S. aureus adhesion/infection was evaluated, and data are presented as mean ± standard deviation (SD) from three independent experiments (n = 3)

Anti-biofilm activity

In recent years, probiotics have emerged as a promising alternative for reducing or eliminating pathogenic biofilms. Probiotics exert their effects through mechanisms such as competition, inhibition of establishment (prevention), and disruption of pre-formed biofilms (displacement) [75]. Competition may involve co-growth with pathogens or the secretion of antimicrobial compounds; prevention refers to the initial coating of surfaces with probiotics or their metabolites to hinder the formation of pathogenic biofilms; and displacement is defined as the breakdown of mature biofilms by probiotics [75]. In this study, the effects of the target probiotic strain on the formation and disruption of the S. aureus biofilm were investigated.

The results demonstrated that the ability to form biofilms significantly decreased with increasing concentrations (including 4MIC and 2MIC) of the CFS. At the highest concentration (4MIC), only 13.42% of the control biofilm was formed (~ 87% reduction), whereas this value increased to 77.20% at the lower concentration (1/4MIC) (Fig. 5a).

Fig. 5.

a biofilm formation rate and (b) Biofilm degradation activity of the cell-free supernatant (CFS) of L. helveticus BGTRM7-58 against mature biofilms of S. aureus. Different letters indicate significant differences among the samples

Following a similar trend, the disruption of the mature biofilm also decreased with reduced concentration, with only 11.20% remaining at the 4MIC concentration (~ 89% reduction) (Fig. 5b). This pattern clearly indicates that the anti-biofilm effects are dose-dependent, remaining significant but less potent at lower concentrations. Previous studies also support the effectiveness of probiotic strains in inhibiting biofilm formation and promoting disruption. A relevant study evaluating Lacticaseibacillus paracasei B31-2 showed that, in addition to possessing desirable probiotic traits, this strain exhibited considerable anti-biofilm capabilities [36].

Gene expression analysis

The presence of L. helveticus BGTRM7-58 led to a significant reduction in the expression of several key virulence genes in S. aureus (Fig. 6). Specifically, the expression of the agr and hla genes, which are involved in regulating the quorum sensing system and the production of alpha-hemolysin, respectively, was markedly decreased. This reduction can significantly impair the bacterium’s ability to coordinate group behavior and cause damage to host cells [76]. Furthermore, the reduced expression of the spa gene indicates a diminished ability of the bacterium to adhere to epithelial cells [77], while the decreased expression of icaA is consistent with a reduced biofilm-forming capacity. Another important observation was the reduced expression of mecA, which may lead to higher sensitivity to β-lactam antibiotics. Cella et al. [78] demonstrated that probiotic metabolites enhance the sensitivity of methicillin-resistant S. aureus to Cefoxitin by inhibiting agr and reducing hla expression. Similarly, Ramezani et al. [79] reported that Lactobacillus supernatants downregulate the expression of spa and other virulence genes. In line with our results, Jiang et al. [77] showed that biosurfactants from L. helveticus disrupt the biofilm-forming ability of S. aureus by weakening the extracellular matrix.

Fig. 6.

Relative expression levels of S. aureus virulence genes (mecA, agr, spa, icaA, and hla) after treatment with L. helveticus BGTRM7-58. qRT-PCR analysis was performed using the 2^−ΔΔCt method, with 16 S rRNA as the internal reference gene. The term “control” in the graph refers to the untreated S. aureus culture, for which the expression level of each target gene was normalized to 1. 0. Different letters indicate significant differences among the samples. Data are presented as mean ± SD (n = 3). Different letters indicate statistically significant differences (p < 0.05)

The simultaneous downregulation of the agr locus and its downstream effector hla strongly implies that L. helveticus BGTRM7-58 secretes active extracellular metabolites—such as specific short-chain fatty acids or quorum-quenching signaling inhibitors—that directly interfere with the S. aureus Quorum Sensing (QS) network. By repressing the agr system, the probiotic effectively ‘blinds’ the pathogen, precluding it from reaching the necessary autoinducer threshold required to secrete tissue-damaging hemolysins. Furthermore, the significant repression of mecA, the pivotal gene encoding the altered penicillin-binding protein (PBP2a), suggests that the structural integrity of the pathogen’s cell wall is heavily compromised under the environmental stress induced by the probiotic. This synergistic transcriptional silencing effectively disarms S. aureus, stripping it of its extreme toxigenicity and simultaneously re-sensitizing it to conventional β-lactam therapies, which highlights the strain’s profound therapeutic potential [80, 81].

Scanning electron microscopy (SEM)

In addition to quantitative results, structural analysis using SEM provides a clear visual depiction of the process of cellular damage under treatment conditions. In the control samples (Fig. 7a), a dense, network-like biofilm structure is clearly visible. Conversely, in the samples treated with the CFS of L. helveticus BGTRM7-58 (Fig. 7b), the structural density is reduced, the micro-colonies appear more dispersed, and the EPS matrix is visibly discontinuous and disrupted. Wang and Zeng [82] showed that the CFS derived from Lactobacillus pentosus L-36 created pores measuring 1.4 to 3.2 nm on the membrane of S. aureus, which led to increased permeability, membrane depolarization, and the leakage of nucleic acids and proteins. Similarly, Pei et al. [63], utilizing the bacteriocin Plantaricin YKX, demonstrated that the cytoplasmic membrane of S. aureus is the primary target, and SEM images following treatment showed the progressive degradation of the cellular structure.

Fig. 7.

Scanning electron microscopy (SEM) images of S. aureus showing morphological changes in the untreated control (a) and in cells treated with the cell-free supernatant (CFS) of L. helveticus BGTRM7-58 (b)

The severe architectural collapse and cellular dispersion of the S. aureus biofilm matrix observed in the SEM micrographs robustly corroborate the molecular downregulation of the icaA gene, which is fundamentally essential for synthesizing Polysaccharide Intercellular Adhesin (PIA). The visual evidence of disrupted micro-colonies suggests that the bioactive molecules within the L. helveticus BGTRM7-58 CFS (most likely a combination of biosurfactants, organic acids, and bacteriocins) exert a dual mechanical and biochemical attack. Initially, biosurfactants lower the interfacial tension to prevent primary aggregation, while secreted enzymes or acids rapidly disintegrate the established EPS. This targeted enzymatic degradation of the protective exopolysaccharide shield not only induces profound physical membrane deformities and cellular leakage but also forces the embedded sessile cells into an unprotected planktonic state, radically diminishing their virulence and survival capacity [83, 84].

Conclusion

In summary, this study presents compelling evidence that Lactobacillus helveticus BGTRM7-58, derived from traditional Iranian Khiki cheese, stands out as a highly promising probiotic candidate due to its remarkable functional and safety properties. The strain demonstrated a remarkable ability to inhibit the adhesion of S. aureus and exhibited strong antimicrobial activity with a MIC of 15.625 mg/mL.

Moreover, the strain showcased notable antioxidant activity and selective cytotoxicity against various cancer cell lines. Comprehensive safety assessments confirmed the absence of hemolytic activity, DNase production, biogenic amine synthesis, and harmful antibiotic resistance. Future investigations should focus on identifying the specific bioactive metabolites responsible for these beneficial effects, validating the strain’s efficacy in relevant in vivo models for infection or cancer, and assessing its potential for incorporation into functional food products, particularly probiotic-enriched dairy items.

Authors’ contributions

Zeinab Mousavi : Writing – review & editing, Resources, Methodology, Investigation. Behrooz Alizadeh Behbahani: Writing – review & editing, Supervision, Resources, Methodology, Investigation, Conceptualization. Hossein Jooyandeh & Morteza Taki: Writing – original draft, Resources, Methodology. Alireza Vasiee : Writing – original draft, Methodology.

Funding

Not applicable.

Data availability

All data relevant to the study are included in the article. The 16 S rRNA gene sequence obtained in this study was used for species identification through BLAST analysis against publicly available sequences in the NCBI database. The closest match was L. helveticus BGTRM7-58 (https://www.ncbi.nlm.nih.gov/nuccore/410810547).

Declarations

Ethical approval and consent to participate

This article does not involve any studies with human or animal subjects.

Consent for publication

Not Applicable.

Competing interests

The authors declare no competing interests.

Clinical trial number

not applicable.