Skip to main content
NCBI home page
Insects logoLink to Insects
. 2026 Jun 8;17(6):601. doi: 10.3390/insects17060601

TmAbd5 Is Essential for Endocuticle Formation in the Yellow Mealworm, Tenebrio molitor

Rongrong Yu 1,†, Haoran Wang 1,†, Gaohua Liu 1, Xiaoming Zhao 2, Mureed Abbas 2, Nan Chang 1, Xuekai Shi 1, Yujing Yang 1, Yuping Zhang 1,*
Editor: Klaus H Hoffmann
PMCID: PMC13299641  PMID: 42355334

Simple Summary

The yellow mealworm, Tenebrio molitor, is an important edible insect widely bred for its efficient growth and high-quality protein. Its outer covering, called the cuticle, plays a vital role in growth and protection. The cuticle contains special proteins that help form and strengthen this protective layer during development. In this study, we identified and examined a specific cuticle protein named TmAbd5 in the yellow mealworm to better understand its role. We found that this protein is mainly produced in the body surface and is especially active during the first three days of the late developmental larvae stage. When the production of this protein was reduced, the insects were still able to molt normally. However, important structural changes were observed in the inner layer of the cuticle, which became thicker and exhibited wider spacing between layers after pupation. These findings improve our understanding of how the insect’s outer covering forms and develops. This knowledge may support future efforts to utilize mealworms, including improving their breeding and making more effective use of their biological resources.

Keywords: Tenebrio molitor, TmAbd5, RNA interference, biological function, endocuticle

Abstract

Tenebrio molitor (Coleoptera: Tenebrionidae) is a suitable candidate for use as a biomass resource, recognized for its large-scale breeding and the high nutritional value of its protein content. Feeding obese Zucker rats the cuticle of T. molitor enhances fatty liver metabolism through the mediation of gut microorganisms. Cuticular proteins are demonstrated to be pivotal in the formation of the insect cuticle throughout the developmental stage. The endocuticle structural glycoprotein (Abd) belongs to the RR-1 subclass, a major group of structural cuticular proteins characterized by the conserved Rebers–Riddiford (RR) motif. Nevertheless, there remains a paucity of research into the molecular properties and functions of SgAbd (endocuticle structural glycoprotein) in Coleoptera. In this study, we successfully identified and described the gene TmAbd5 in T. molitor. The coding sequence of TmAbd5 is 306 bp, corresponding to a 101-aa protein. The functional domain predicted that TmAbd5 consists of a signal peptide and a chitin-binding domain 4 (ChtBD4). Motif prediction analysis indicated that TmAbd5 belongs to the CPR (cuticular proteins with Rebers–Riddiford consensus) family with the RR-1 motif. Expression analysis revealed that TmAbd5 is upregulated in the integument, particularly during the first three days of development in the 13th instar stage. Although the RNAi-mediated silencing of TmAbd5 did not cause apparent phenotypic abnormalities and the insects successfully molted into pupae, histological examination revealed a substantial thickening of the endocuticle at 72 h post-pupation, along with a notable increase in lamellar spacing and a disrupted pore canal. In summary, TmAbd5 contributes to the formation and structural organization of the endocuticle, which provides a theoretical basis for the screening of target genes for cuticle development and for the effective utilization of cuticle resources in T. molitor.

1. Introduction

The insect integument consists of a secreted multi-layered cuticular structure and single-layered epidermal cells. The cuticle comprises three horizontal layers: the envelope, epicuticle, and procuticle [1,2]. The envelope, a complex structure composed of lipids and proteins, provides protection from dehydration and pathogens. The epicuticle, primarily made of lipids and proteins, helps maintain body shape and rigidity. The procuticle is a helicoidally arranged structure consisting of chitin fibrils and cuticular proteins (CPs) assembled into a protein–chitin matrix, providing the exoskeleton with flexibility, strength, and stability [3]. To adapt growth and avoid the restriction of a rigid exoskeleton, insects periodically undergo ecdysis, during which the old cuticle is degraded and replaced by a newly synthesized one [4,5,6]. The exocuticle and epicuticle are deposited before apolysis, whereas the endocuticle is formed after ecdysis and continues to develop until the next apolysis [7].

To date, a large number of cuticular proteins have been discovered in various insects, including Manduca sexta, Nilaparvata lugens, and Anopheles gambiae [8,9,10]. Cuticular proteins are divided into CPAPs (cuticular proteins analogous to peritrophins), CPFs (cuticular proteins with forty-four highly conserved amino acids), CPFLs (CPFs like conserved amino acids in the C-terminal), CPLCs (cuticular proteins of low complexity), CPGs (cuticular proteins rich in glycine), CPRs, and CPHs (cuticular proteins hypothetical), among others, according to the conserved motifs. Among these, the CPR family, as the most prominent cuticular protein family, includes three subclasses: RR-1, RR-2, and RR-3 [11]. Cuticle proteins are essential for cuticle formation throughout insect development; a disruption to or reduction in their expression can severely affect cuticle morphology, integrity, and function, often resulting in lethality. For example, in Aedes aegypti, silencing AaCPR100A disrupted endocuticle formation in larvae, significantly reduced the egg hatching rate, and increased mortality [12]. In Spodoptera exigua, knockout of the cuticular protein gene SeCPG316 resulted in a blackish and hardened cuticle, abnormal pupation, and increased mortality [13]. In N. lugens, silencing fifteen cuticle protein genes from the CPR family resulted in insect mortality [10].

The abdomen serves as the central site for digestion and reproductive metabolism in insects. Multiple Abd genes have been identified in the abdominal cuticle across various insect orders. In Orthoptera, eight Abd family genes have been identified in Schistocerca gregaria and Locusta migratoria [14,15]. In L. migratoria, LmAbd5 plays a key role in the formation of the endocuticle structure [16]. In Lepidoptera, Abd5 from Helicoverpa armigera contributes to cuticle compaction and lamellar organization, thereby enhancing resistance to fenvalerate [17]. In Hemiptera, AgAbd2 is required for maintaining endocuticle thickness during the molting of Aphis gossypii, and its transcript levels are significantly upregulated in response to Metarhizium anisopliae infection, providing protection against fungal invasion [18,19]. In Coleoptera, TcZelda (Zinc finger protein) and TcAbd cooperate to regulate embryonic and wing development, and the silencing of TcZelda results in the significant downregulation of Abd gene expression; however, the molecular signatures and physiological functions of Abd genes in this order remain largely unexplored [20].

The yellow mealworm, Tenebrio molitor (Coleoptera: Tenebrionidae), is an essential edible insect species that provides efficient biomass instead of food and feed, with large-scale propagation and high nutritional value [21,22,23,24]. Mammals reared using the cuticle of T. molitor as feed exhibit enhanced fatty liver metabolism through the mediation of gut microorganisms [25]. In this study, we identified five endodermal structural protein genes (TmAbd2, TmAbd4, TmAbd5, TmAbd8 and TmAbd9) from the transcriptome of T. molitor. Furthermore, we selected TmAbd5 to explore its molecular characteristics and biological function. The expression profile of TmAbd5 indicated that it has a high transcription level in the integument, particularly during the first three days of the 13th instar larval stage. The RNA interference-mediated knockdown of TmAbd5 led to significant thickening of the endocuticle at 72 h post-pupation, accompanied by an increased interval between the lamellae and disrupted pore canal within the endocuticle structure. These findings elucidate the molecular mechanism of cuticle formation during development in T. molitor, and the results enrich our knowledge of insect cuticular proteins, thus providing an essential theoretical basis for screening target genes for cuticle development and the further effective utilization of cuticle resources in T. molitor [26].

2. Materials and Methods

2.1. Insect Rearing

The T. molitor individuals were purchased from the Xinyang Mixue Industry Co., Ltd. (Luoyang, China), and reared in an artificial climate incubator (Boxun, Shanghai, China) under controlled conditions: a temperature of 26 °C, relative humidity of 70%, and a light/dark cycle of 18:6. Larvae were fed with fresh wheat bran and provided with lettuce to maintain adequate body moisture.

2.2. Prediction and Analysis of the Structural Features of TmAbd5

The transcript sequence of TmAbd5 was retrieved from the T. molitor transcriptome database. Based on the cDNA sequence, the translated protein sequence, molecular mass, and isoelectric point were predicted according to the Expasy translate and Expasy Compute pI/Mw tools (https://www.expasy.org/). The conserved domain was identified using the SMART online website(http://smart.embl-heidelberg.de/), and SignaIp 4.1 was employed for signal peptide prediction. Conserved protein motifs were represented with the WebLogo website (https://weblogo.threeplusone.com/create.cgi). The Abd5 homolog amino acids were clustered and a phylogenetic tree was built in MEGA.11 with 1000 bootstrap replicates. The homology sequence of Abd in the different insects for construction of the phylogenetic tree is shown in Table 1.

Table 1.

Homologous sequence of Abds used for phylogenetic tree development.

Orders Species Genes Accession Numbers Access Date
Siphonaptera Ctenocephalides felis CfAbd5 XP_026468045.1 1 October 2018
Diptera Bradysia coprophila BcAbd5 XP_037044862.153 5 March 2026
Condylostylus longicornis ClAbd5 XP_055373233.1 24 April 2023
Stomoxys calcitrans ScAbd4 XP_013106443.1 2 September 2023
Musca domestica MdAbd4 XP_005184506.2 24 August 2023
Anastrepha obliqua AoAbd4 XP_054739170.1 3 April 2023
Anopheles gambiae AgAbd4 XP_318989.4 19 December 2023
Neuroptera Chrysoperla carnea CcAbd5 XP_044736842.1 27 October 2021
Chrysoperla carnea CcAbd2 XP_044743078.1 27 October 2021
Phlebotomus argentipes PaAbd2 XP_059620308.1 28 September 2023
Blattodea Zootermopsis nevadensis ZnAbd5 XP_021921395.1 6 August 2017
Orthoptera Locusta migratoria LmAbd5 ASQ42725.1 7 August 2017
Locusta migratoria LmAbd4 ASQ42724.1 7 August 2017
Schistocerca gregaria SgAbd5 XP_049839296.1 10 August 2022
Schistocerca nitens SnAbd5 XP_049793153.1 5 August 2022
Phasmatoptera Timema douglasi TdAbd2 CAD7195650.1 24 November 2020
Hymenoptera Cataglyphis hispanica ChAbd8 XP_050448044.1 9 September 2022
Pseudomyrmex gracilis PgAbd8 XP_020289403.1 8 March 2017
Venturia canescens VcAbd8 XP_043269765.1 12 July 2024
Belonocnema kinseyi BkAbd8 XP_033208504.1 23 February 2022
Coleoptera Asbolus verrucosus AvAbd5 RZC34611.1 13 February 2019
Asbolus verrucosus AvAbd2 RZC40729.1 13 February 2019
Aromia moschata AmAbd2 KAJ8937326.1 13 February 2019
Anoplophora glabripennis AgAbd8 XP_018580236.2 10 January 2018
Aethina tumida AtAbd8 XP_019876049.1 11 August 2022
Acanthoscelides obtectus AoAbd2 CAH1983138.1 24 January 2023
Dalotia coriaria DcAbd8 XP_065163194.1 29 January 2025
Phaedon cochleariae PcAbd2 CAH1117680.1 18 October 2022
Nicrophorus vespilloides NvAbd8 XP_017774729.1 24 August 2016
Zophobas morio ZmAbd5 XP_063918219.198 27 March 2024
Tenebrio molitor TmAbd5 XP_068904910.1 8 October 2024
Tribolium castaneum TcAbd5 XP_970596.1 10 April 2024
Tribolium castaneum TcAbd2 XP_973729.2 10 April 2024
Tribolium castaneum TcAbd8 XP_969336.1 10 April 2024
Tribolium madens TmadAbd5 XP_044267494.1 16 October 2021
Open in a new tab

2.3. Expression Pattern of TmAbd5 in Different Stages, Tissues and Developmental Days

For the developmental stage expression analysis, four biological replicates were prepared, each consisting of ten eggs and three individuals from each developmental stage, including early instar larvae, middle instar larvae, late instar larvae, pupae, and adults. For the tissue expression pattern, the integument, fat body, Malpighian tubules, foregut, midgut, and hindgut were dissected and collected from forty 2-day-old 13th instars. For developmental expression profiling in the integument, samples were collected from 180 individuals across different developmental days. Each assay included four biological replicates and two technical replicates, each consisting of three larvae. RNA concentration was detected using a NanoDrop 2000 spectrometer (Thermo Fisher, Waltham, MA, USA), and integrity was confirmed using 1% agarose gel (Sangon, Shanghai, China). Reverse transcription was carried out using HiScript III RT SuperMix (Vazyme, Nanjing, China). Using Primer 5.0, specific primers were designed and subsequently synthesized by Sangon Biotech (Table 2). Then, 20 µL of reaction mixture was prepared for real-time quantitative PCR (RT-qPCR), including 10 μL of SYBR PremixExTaqTMII (TOYOBO, Tokyo, Japan), 6.4 μL of ddH2O (sterile deionized water), 2 µL of cDNA reverse transcription template, and 0.8 µL (10 µM) each of forward and reverse primers. The RT-qPCR assay was performed on a Step-One-Plus Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) with a reaction procedure consisting of pre-denaturation at 95 °C for 10 s, followed by 40 cycles of denaturation at 95 °C for 5 s, and annealing and elongation at 60 °C for 30 s. Then, a melting curve was created from the detection of the fluorescence intensity of the samples from 60 °C to 95 °C, which determined the specific gene-specific peaks and avoided primer dimers. The transcription levels of TmAbd5 were quantified using the 2−ΔΔCt method. Discrepancies between samples were calibrated using RPS3 as an internal reference.

Table 2.

Primer sequences used in the study.

Prime Primer Sequences (5′-3′) Application Length (bp)
TmAbd5 F: GCGGAGAGTACACCTACAAGCTC RT-qPCR 92
R: GGTCTGTGTGTGGGGTTGGT
RPS3 F: GTGGTCGTTTCTGGCAAACT 141
R: CAACACTCCTTGCCTCAACA
dsTmAbd5 F: taatacgactcactatagggAGTGGTGATCCTTCTCTGCG dsRNA 176
R: taatacgactcactatagggCGGCGTTCTTCAGCTCTC
dsGFP F: taatacgactcactatagggGTGGAGAGGGTGAAGG 571
R: taatacgactcactatagggGGGCAGATTGTGTGGAC
Open in a new tab

Lowercase letters indicate the T7 promoter sequence.

2.4. Double-Stranded RNA (dsRNA) Preparation and Silence Efficiency Detection

A pair of dsRNA primers with the T7 promoter sequences shown in Table 2 was designed using Primer 5.0 software and synthesized by Sangon Biotech (Sangon, Shanghai, China). A 25 μL amplification reaction system was used, containing 12.5 μL PCR MasterMix (Tiangen, Beijing, China), 0.5 μL each of forward and reverse primers, and 1 μL cDNA of TmAbd5 template and sterile deionized water (Sangon, Shanghai, China) up to the final volume. The PCR conditions were 95 °C pre-denaturation for 1 min; 35 cycles of 95 °C denaturation for 30 s, 60 °C annealing for 30 s, and 72 °C extension for 1 min; and a final incubation at 72 °C for 8 min. PCR products were purified using a gel recovery kit (Vazyme, Nanjing, China), and dsRNA was synthesized using the T7 RNAi Express kit (Promega, Madison, WI, USA). dsGFP and dsTmAbd5 were detected using configured 1% agarose gel electrophoresis.

An amount of 1 μL of dsTmAbd5 (0.5 μg) was administered by piercing the intersegmental membrane of the 3rd and 4th abdominal segments of 2-day-old 13th instars with a microinjector (Gaoge, Shanghai, China). The RNAi control group was injected with dsRNA specific to green fluorescent protein (dsGFP). Integument samples were dissected from the larvae overnight and dsTmAbd5 was obtained for silencing efficiency analysis via RT-qPCR, with four biological replicates (each containing three larvae) and two technical replicates.

2.5. Phenotypic Observation

The equivalent dsRNA was injected into the thirty 2-day-old 13th instars according to the description in Section 2.4. Subsequently, the larvae were incubated and phenotypic changes in T. molitor were observed every day until the larvae molted into adults. The phenotypes of the adults derived from dsGFP- and dsTmAbd5-injected larvae were recorded and analyzed.

2.6. Microstructure Observation with H&E Staining

Six 2-day-old 13th instar were collected for the injection of equivalent dsGFP or dsTmAbd5 according to the description in Section 2.4. The integuments of the second abdominal segment were dissected after molting into the pupal stage at 72 h and fixed with 3% glutaraldehyde at 4 °C. The samples were then embedded, sectioned, and dewaxed. Hematoxylin and eosin (H&E) was applied as previously described [27]. After dehydration and sealing, nine images of each section were captured under a DS-Ri2 inverted fluorescence microscope (Nikon Corp., Tokyo, Japan). The assay was carried out with three biological replicates, with each containing one larva.

2.7. Ultrastructure Observation by TEM

A transmission electron microscope (TEM) (HITACHI, Tokyo, Japan) was used to determine the consequences of TmAbd5 silencing in the ultrastructure of the integument. After silencing the transcription of TmAbd5 according to the description in Section 2.4, six integuments from the third abdominal segment were dissected from larvae 72 h after molting into the pupal stage, cut into small pieces (approximately 2 mm3), and then fixed, dehydrated, impregnated, and embedded. The sections were stained with uranyl acetate (SPI Supplies, West Chester, PA, USA) and 2.6% lead nitrate (Sigma-Aldrich, Louis, MO, USA) solution according to established protocols [28]. Twelve images were captured for each sample with an LSM 880 confocal laser scanning microscope (Carl Zeiss, Oberkochen, Germany). The assay was carried out with three biological replicates, each containing one larva.

2.8. Statistics

The expression characteristics of TmAbd5 in various stages, tissues and different developmental days of the integument were evaluated via one-way analysis of variance (ANOVA) with Tukey’s test using SPSS 22.0 software. Different letters on the histograms indicate significant differences. Student’s t test was employed for the comparison of silence efficiency and endocuticle thickness after injection with dsRNA. Asterisks on the column show the considerable difference between dsGFP and dsTmAbd5 groups (** p < 0.01; *** p < 0.001).

3. Results

3.1. Bioinformatic Analysis of TmAbd5

In accordance with the T. molitor transcriptome database, a query was generated using the keywords “endocuticle structural glycoprotein”. Consequently, the full-length TmAbd5 sequence was retrieved, which consisted of the 306 bp coding region of TmAbd5 and the 101 amino acids of the encoding protein. Conserved functional domain analysis showed that TmAbd5 contains a signal peptide (1–16 aa) and a chitin-binding domain type 4 (ChtBD4; 38–93 aa) (Figure 1A). The predicted isoelectric point (PI) and molecular weight (MW) of the protein are 4.90 and 10.97 kDa, respectively. Motif analysis revealed that TmAbd5 possesses the RR consensus (Figure 1B). The accession number of TmAbd5, which we submitted to the GenBank database, is XP068904910.1.

Figure 1.

Figure 1

Open in a new tab

The full-length cDNA sequence and conserved motif prediction of TmAbd5. (A) The nucleotide, predicted amino acid, and conserved function prediction. The signal peptide is underlined, and the chitin-binding domain (ChtBD4) is shown in the box. (B) The conserved motif analysis of TmAbd5 was carried out using Weblogo website. Asterisk showed the Stop codon.

3.2. Phylogenetic Analysis of TmAbd5

The phylogenetic analysis showed that TmAbd5 from T. molitor clusters with Coleoptera Abd5 homologs. Specifically, TmAbd5 exhibits the closest evolutionary relationship with Abd5 from Tribolium castaneum and Tribolium madens, while it is most distantly related to Abd5 of Asbolus verrucosus (Figure 2).

Figure 2.

Figure 2

Open in a new tab

A phylogenetic tree of the Abd5 homologous sequence in different insects. The phylogenetic tree was constructed with 1000 independent analyses by MEGA.11 software. The TmAbd5 is marked with a solid orange circle. Number on the branch showed the confidence level.

3.3. Expression Traits of TmAbd5 in Various Stages, Tissues and Different Developmental Days of the Integument

The expression characteristics of TmAbd5 in various stages, tissues and at various developmental days were assessed. The developmental stage expression analysis revealed that TmAbd5 is highly expressed during the larval stages compared with the egg, pupal, and adult stages (Figure 3A). Therefore, the larval stage was selected for subsequent tissue-specific expression profiling. The relative transcription level of TmAbd5 in various tissues indicated that it was more highly expressed in the integument compared with other tissues (Figure 3B). To further examine its expression during development, the transcript levels of TmAbd5 in the integument were assessed across different developmental days of the 13th instar larval stage. The results demonstrated that TmAbd5 expression was significantly higher during the first three days, after which it gradually declined from day 4 to day 15 (Figure 3C).

Figure 3.

Figure 3

Open in a new tab

The specific expression pattern of TmAbd5 in the different stages, tissues and developmental days. (A) Relative expression levels of TmAbd5 across different developmental stages. E, eggs; EL, early instar larvae; ML, middle instar larvae; LL, late instar larvae; P, pupae; A, adults. (B) The relative expression of TmAbd5 among tissues. IN: integument; FB: fat body; MA: Malpighian tubules; FG: foregut; MG: midgut; HG: hindgut. (C) The relative expression of TmAbd5 at different developmental days. Data are represented in the form of means ± SE. Different letters on the bars indicate significant differences (p < 0.05, one-way ANOVA and Tukey analysis). RPS3 was used as a reference gene to calibrate the transcription level of TmAbd5. Each assay contains four biological replications.

3.4. TmAbd5 Is Irreplaceable in Endocuticle Formation

RNA interference (RNAi) was employed to silence the transcription level of TmAbd5, followed by phenotypic observation. Silencing efficiency assays indicated that the transcript level of TmAbd5 was obviously reduced by 91.7% at 24 h after the injection of dsTmAbd5 relative to controls (Figure 4). Subsequent histological examination using H&E dyeing revealed that the endocuticle of the dsTmAbd5-treated group became notably thicker than that of the control group with an increase of 22.4% (Figure 4B,C), which indicated that TmAbd5 is involved in endocuticle formation.

Figure 4.

Figure 4

Open in a new tab

Silence efficiency and microstructure after dsTmAbd5 injection. (A) The relative expression of TmAbd5 after dsRNA injection. Asterisk on the bar indicates significant difference after injection of dsGFP (control) and dsTmAbd5. Statistically significant difference was analyzed with Student’s t test (** p < 0.01). (B) Microstructure observation of cuticle after injection of dsGFP and dsTmAbd5. Exo: exocuticle, endo: endocuticle. Scale bar is 100 μm. (C) Comparison of endocuticle thickness after injection of dsGFP and dsTmAbd5 at 2 days old with H&E staining. Data are represented in the form of means ± SE. Statistically significant difference was analyzed using Student’s t test (*** p < 0.001).

3.5. TmAbd5 Influence on the Compactness of the Endocuticle

To observe whether dsTmAbd had an effect on lamellar organization, the ultrastructure of the cuticle was observed after the injection of dsTmAbd5 using TEM. The result revealed that, following the injection of dsGFP, the endocuticle is tight and the pore canal is long and continuous across the lamellar. However, the lamellar structure of the endocuticle in the dsTmAbd5 group appeared wider and looser, and the pore canal was interrupted and discontinuous (Figure 5). Together, these findings demonstrate that TmAbd5 is indispensable for lamellar organization and pore canal formation in the endocuticle of T. molitor.

Figure 5.

Figure 5

Open in a new tab

The ultrastructure of the cuticle was observed using TEM after the injection of dsGFP and dsTmAbd5. Exo: exocuticle, endo: endocuticle, Pc: pore canal. Scale bars are 10 μm and 1 μm. Box indicates the magnifying area of the endocuticle. The black line shows the cuticle lamella. Black dashed lines indicate the boundary of the lamella, and the orange dashed line shows the pore canal going through the lamellae.

4. Discussion

The insect cuticle, which performs essential physiological functions, consists of four distinct layers: the envelope, epicuticle, exocuticle, and endocuticle [29]. Cuticular proteins are the predominant structural proteins in the cuticle. The CPR family is known to be the most prominent and is classified into three clusters: the RR-1 subfamily, predominantly expressed in the soft cuticle; the RR-2 subfamily, mainly expressed in the rigid cuticle; and the RR-3 subfamily, which remains relatively less studied at present [11]. In this study, a post-molting cuticle protein encoded by TmAbd5 was retrieved from the transcriptome database of T. molitor. The functional domain prediction of TmAbd5 revealed that it consists of a signal peptide and a chitin-binding domain (ChtBD4), indicating that TmAbd5 is a secretory protein with chitin-binding capability. Conserved motif analysis further confirmed that TmAbd5 contains a typical RR-1 conserved motif, which infers that it belongs to the CPR family. These results are consistent with previous findings on the LmAbd5 protein in L. migratoria [16]. Moreover, Abd5 homologs from Coleoptera species formed a distinct clade with high bootstrap support, suggesting a close evolutionary relationship among Abd5 proteins within this order.

The expression profile of Abd genes highlighted tissue- and stage-specific patterns across different developmental periods. For example, in L. migratoria, LmAbd1, LmAbd2, LmAbd6, and LmAbd9 are highly expressed in the cuticle, whereas LmAbd5 shows high expression in the foregut, hindgut, and cuticle [15,16,30,31]. In Reticulitermes aculabialis, Abd2 and Abd9 exhibited high expression levels in the head of worker ants, with significantly higher expression levels in nymphs than in adults [32]. In Aphis citricola, Abd2 is upregulated in the abdominal region [18]. In the study, we found that TmAbd5 inhibited a high expression in the integument, which is similar to the cuticle’s high expression pattern in H. armigera [17], suggesting a potential role in cuticle formation. Furthermore, the analysis of TmAbd5 expression in the integument during the 13th instar larval stage showed that transcript levels were highest during the first three days after molting. In L. migratoria, LmAbd5 is highly expressed 0–72 h after molting, which appears to be similar to the expression profile in the integument [16]. These findings indicate that cuticle formation is a dynamic developmental process, with endocuticle formation completed mainly within three days after molting [33]. The expression pattern of TmAbd5 coincides with this critical period, suggesting that it is responsible for the formation and structural maintenance of the endocuticle in T. molitor.

Abd family proteins play crucial roles in the cuticle, as well as in growth and development. In L. migratoria, Abd family proteins are required for the maintenance of the cuticle inter-segmental membrane and the lamellar structure of the endocuticle, and for facilitating oviposition [15,16,29,30]. Similarly, in Frankliniella occidentalis, the Abd1 protein has been shown to be necessary for oviposition, longevity, and body shape maintenance [34]. Functional explorations of the Abd5 protein have demonstrated that it is responsible for the maintenance of the cuticle structure in L. migratoria and H. armigera. In L. migratoria, when LmAbd5 is silenced, the nymphs are able to molt successfully despite the lack of a normal phenotype; furthermore, the lamellar of the endocuticle is looser and the endocuticle is thicker [16]. In H. armigera, the molt phenotype is not observed. However, the silencing of HaAbd5 leads to the tight cuticle lamellar architecture becoming looser and thicker, resulting in the greater susceptibility of the cuticle to fenvalerate penetration [17]. In this study, RNAi combined with microscopic and ultrastructural observation was adopted to elucidate the actions of TmAbd5 in T. molitor. Although the larvae injected with dsTmAbd5 successfully molted into the pupal stage without apparent phenotypic abnormalities, microscopic and ultrastructural analyses found that the endocuticle exhibited significantly increased interlamellar spacing, leading to a looser architecture and an overall thicker endocuticle. This is similar to the phenotype of L. migratoria and H. armigera, showing that the biological functions of Abd5 in insects were conserved. Furthermore, we found that the pore canal, which is responsible for transporting lipids to the envelope, was discontinuous and interrupted in the endocuticle, showing the specific biological function of TmAbd5 in the cuticle. However, the penetration, sensitivity, and water retention of the cuticle should be explored further in future research. Overall, the results suggest that TmAbd5 is responsible for lamellar structure organization and pore canal formation, thus positioning it as a target gene for the development of T. molitor. In future work, we will combine the target gene and nanoparticles in oral RNAi to determine more applications [35].

5. Conclusions

In this study, the molecular properties and functions of TmAbd5 in T. molitor were established. The results demonstrated that TmAbd5 belongs to the CPR family, subclass RR-1. TmAbd5 was highly expressed in the integument and contributed to the formation of the endocuticle of T. molitor. In summary, the results offer insights into the architecture and function of the cuticle during the growth and development of T. molitor. Moreover, this study enhances the current knowledge of insect cuticular proteins and offers an essential theoretical basis for developing and utilizing cuticular resources in T. molitor.

Author Contributions

Conceptualization, Methodology, Writing—original draft, Writing—review and editing, R.Y.; Formal analysis, Methodology, Writing—original draft, H.W.; Formal analysis, Visualization, G.L.; Conceptualization, Writing—review and editing, X.Z.; Investigation, Writing—review and editing, M.A.; Validation, N.C.; Investigation, Data curation, Visualization, X.S.; Methodology, Visualization, Y.Y.; Supervision, Conceptualization, Project administration, Writing—review and editing, Y.Z. All authors have read and agreed to the published version of the manuscript.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

Funding Statement

This research was supported by Fundamental Research Program of Shanxi Province, China (202303021211184, 202303021212250, 202303021222217), and the Shanxi Key Laboratory of Nucleic Acid Biopesticides Open Fund of Shanxi Province, China (HSSW202402).

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Mitov M., Soldan V., Balor S. Observation of an anisotropic texture inside the wax layer of insect cuticle. Arthropod Struct. Dev. 2018;47:622–626. doi: 10.1016/j.asd.2018.10.003. [DOI] [PubMed] [Google Scholar]
  • 2.Locke M. The wigglesworth lecture: Insects for studying fundamental problems in biology. J. Insect Physiol. 2001;47:495–507. doi: 10.1016/S0022-1910(00)00123-2. [DOI] [PubMed] [Google Scholar]
  • 3.Muthukrishnan S., Mun S., Noh M.Y., Geisbrecht E.R., Arakane Y. Insect cuticular chitin contributes to form and function. Curr. Pharm. Des. 2020;26:3530–3545. doi: 10.2174/1381612826666200523175409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Riddiford L.M. A Life’s Journey Through Insect Metamorphosis. Annu. Rev. Entomol. 2020;65:1–16. doi: 10.1146/annurev-ento-011019-025103. [DOI] [PubMed] [Google Scholar]
  • 5.Qu M.B., Guo X.X., Tian S., Yang Q., Kim M., Mun S., Noh M.Y., Kramer K.J., Muthukrishnan S., Arakane Y. AA15 lytic polysaccharide monooxygenase is required for efficient chitinous cuticle turnover during insect molting. Commun. Biol. 2022;5:518. doi: 10.1038/s42003-022-03469-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Zhang Y.C., Li H.J., Liu X.M., Li H.L., Lan Q.Y., Wu H.H., Wang Y.L., Zhang J.Z., Zhao X.M. Nuclear Receptor FTZ-F1 Controls Locust Molt by Regulating the Molting Process of Locusta migratoria. Insects. 2024;15:237. doi: 10.3390/insects15040237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Noh M.Y., Muthukrishnan S., Kramer K.J., Arakane Y. Development and ultrastructure of the rigid dorsal and flexible ventral cuticles of the elytron of the red flour beetle, Tribolium castaneum. Insect Biochem. Mol. Biol. 2017;91:21–33. doi: 10.1016/j.ibmb.2017.11.003. [DOI] [PubMed] [Google Scholar]
  • 8.Cornman R.S., Togawa T., Dunn W.A., He N., Emmons A.C., Willis J.H. Annotation and analysis of a large cuticular protein family with the R&R Consensus in Anopheles gambiae. BMC Genom. 2008;9:22. doi: 10.1186/1471-2164-9-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Dittmer N.T., Tetreau G., Cao X., Jiang H., Wang P., Kanost M.R. Annotation and expression analysis of cuticular proteins from the tobacco hornworm, Manduca sexta. Insect Biochem. Mol. Biol. 2015;62:100–113. doi: 10.1016/j.ibmb.2014.12.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Pan P.L., Ye Y.X., Lou Y.H., Lu J.B., Cheng C., Shen Y., Moussian B., Zhang C.X. A comprehensive omics analysis and functional survey of cuticular proteins in the brown planthopper. Proc. Nat. Acad. Sci. USA. 2018;115:5175–5180. doi: 10.1073/pnas.1716951115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Rebers J.E., Riddiford L.M. Structure and expression of a Manduca sexta larval cuticle gene homologous to Drosophila cuticle genes. J. Mol. Biol. 1988;203:411–423. doi: 10.1016/0022-2836(88)90009-5. [DOI] [PubMed] [Google Scholar]
  • 12.Chen J., Wu Y.C., Chen J.K., Lu H.R., Cheng G., Tu Z.J., Liao C.H., Han Q. Roles of a newly lethal cuticular structural protein, AaCPR100A, and its upstream interaction protein, G12-like, in Aedes aegypti. Int. J. Biol. Macromol. 2024;268:131704. doi: 10.1016/j.ijbiomac.2024.131704. [DOI] [PubMed] [Google Scholar]
  • 13.Jan S., Liu S.S., Hafeez M., Zhang X.M., Dawar F.U., Guo J.Y., Gao C., Wang M. Isolation and functional identification of three cuticle protein genes during metamorphosis of the beet armyworm, Spodoptera exigua. Sci. Rep. 2017;7:16061. doi: 10.1038/s41598-017-16435-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Andersen S.O. Amino acid sequence studies on endocuticular proteins from the desert locust, Schistocerca gregaria. Insect Biochem. Mol. Biol. 1998;28:421–434. doi: 10.1016/S0965-1748(98)00028-9. [DOI] [PubMed] [Google Scholar]
  • 15.Zhao X.M., Jia P., Zhang J., Yang Y., Liu W.M., Zhang J.Z. Structural glycoprotein LmAbd-9 is required for the formation of the endocuticle during Locust molting. Int. J. Biol. Macromol. 2019;125:588–595. doi: 10.1016/j.ijbiomac.2018.11.279. [DOI] [PubMed] [Google Scholar]
  • 16.Zhao X.M., Jia P., Gou X., Liu W.M., Ma E.B., Zhang J.Z. Expression and functional analysis of endocuticle structural glycoprotein gene LmAbd-5 in Locusta migratoria. Sci. Agric. Sin. 2017;50:1820–1829. [Google Scholar]
  • 17.Zheng J., Wu P., Huang Y., Zhang Y., Qiu L. Identification of insect cuticular protein genes LCP17 and SgAbd5 from Helicoverpa armigera and evaluation their roles in fenvalerate resistance. Pestic. Biochem. Phys. 2024;199:105775. doi: 10.1016/j.pestbp.2024.105775. [DOI] [PubMed] [Google Scholar]
  • 18.Fan J.Q., Jiang S.R., Zhang T., Gao H.Y., Chang B.H., Qiao X.W., Han P.F. Sgabd-2 plays specific role in immune response against biopesticide Metarhizium anisopliae in Aphis citricola. Pestic. Biochem. Phys. 2024;203:10. doi: 10.1016/j.pestbp.2024.106003. [DOI] [PubMed] [Google Scholar]
  • 19.Guo M.Y., Qu X.T., Cheng S.H., Wang H.Q., Xue Y., Shen J., Wang D. The endocuticle structural glycoprotein AgSgAbd-2-like is required for cuticle formation and survival in the melon aphid Aphis gossypii. Insect Sci. 2026;1:172–182. doi: 10.1111/1744-7917.13499. [DOI] [PubMed] [Google Scholar]
  • 20.Gao S.S., Xue S., Gao T., Lu R.X., Zhang X.Y., Zhang Y.L., Zhang K.P., Li R.M. Transcriptome analysis reveals the role of Zelda in the regulation of embryonic and wing development of Tribolium castaneum. Bull. Entomol. Res. 2023;113:587–597. doi: 10.1017/S0007485323000263. [DOI] [PubMed] [Google Scholar]
  • 21.Nowak V., Persijn D., Rittenschober D., Charrondiere U.R., Charrondiere U.R. Review of food composition data for edible insects. Food Chem. 2016;193:39–46. doi: 10.1016/j.foodchem.2014.10.114. [DOI] [PubMed] [Google Scholar]
  • 22.Van H.A., Oonincx D.G.A.B. The environmental sustainability of insects as food and feed. Agron. Sustain. Dev. 2017;37:43. doi: 10.1007/s13593-017-0452-8. [DOI] [Google Scholar]
  • 23.Yoo J.S., Cho K.H., Hong J.S., Jang H.S., Chung Y.H., Kwon G.T., Shin D.G., Kim Y.Y. Nutrient ileal digestibility evaluation of dried mealworm (Tenebrio molitor) larvae compared to three animal protein by-products in growing pigs. Asian-Australas. J. Anim. Sci. 2018;32:387–394. doi: 10.5713/ajas.18.0647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Wang S.Y., Hackney Price J., Zhang D. Hydrocarbons catalysed by TmCYP4G122 and TmCYP4G123 in Tenebrio molitor modulate the olfactory response of the parasitoid Scleroderma guani. Insect Mol. Biol. 2019;28:637–648. doi: 10.1111/imb.12581. [DOI] [PubMed] [Google Scholar]
  • 25.Saeb A., Grundmann S.M., Gessner D.K., Schuchardt S., Most E., Wen G., Eder K., Ringseis R. Feeding of cuticles from Tenebrio molitor larvae modulates the gut microbiota and attenuates hepatic steatosis in obese Zucker rats. Food Funct. 2022;13:1421–1436. doi: 10.1039/D1FO03920B. [DOI] [PubMed] [Google Scholar]
  • 26.Li Z.Y., Liu Y.M., Liang Y.Q., Pan T.Q., Liu J.S. RNA interference-based pesticides: Mechanism, application, and commercialization in sustainable pest management. Pestic. Biochem. Physiol. 2026;219:107034. doi: 10.1016/j.pestbp.2026.107034. [DOI] [PubMed] [Google Scholar]
  • 27.Song T.Q., Yang M.L., Wang Y.L., Liu Q., Wang H.M., Zhang J., Li T. Cuticular protein LmTwdl1 is involved in molt development of the migratory locust. Insect Sci. 2016;23:520–530. doi: 10.1111/1744-7917.12342. [DOI] [PubMed] [Google Scholar]
  • 28.Yu R.R., Duan J.Q., Zhao X.M., Abbas M., Zhang Y.P., Shi X.K., Chen N., Zhang J.Z. Knickkopf (LmKnk) is required for chitin organization in the foregut of Locusta migratoria. Insect Sci. 2024;31:1412–1424. doi: 10.1111/1744-7917.13313. [DOI] [PubMed] [Google Scholar]
  • 29.Moussian B., Seifarth C., Müller U., Berger J., Schwarz H. Cuticle differentiation during Drosophila embryogenesis. Arthropod Struct. Dev. 2006;35:137–152. doi: 10.1016/j.asd.2006.05.003. [DOI] [PubMed] [Google Scholar]
  • 30.Zhao X.M., Ma Q., Shao T., Jia P., Wu Z.C., Huo C.Y., Wang Y.X., Liu W.M., Zhao Z.W., Wang C.Z., et al. The Tra/Dsx-JHBP axis controls female-specific gene expression and oviposition in locusts. PLoS Biol. 2025;23:e3003321. doi: 10.1371/journal.pbio.3003321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Jia P., Zhang J., Yang Y., Liu W.M., Zhang J.Z., Zhao X.M. Expression and function analysis of endocuticle structural glycoprotein gene LmAbd-2 in Locusta migratoria. Sci. Agric. Sin. 2019;52:651–660. [Google Scholar]
  • 32.Ye C., Song Z., Wu T., Zhang W., Saba N.U., Xing L., Su X. Endocuticle is involved in caste differentiation of the lower termite. Curr. Zool. 2021;67:489–499. doi: 10.1093/cz/zoab005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Charles J.P. The regulation of expression of insect cuticle protein genes. Insect Biochem. Mol. Biol. 2021;40:205–213. doi: 10.1016/j.ibmb.2009.12.005. [DOI] [PubMed] [Google Scholar]
  • 34.Yuan J.J. Master’s Thesis. Yangtze University; Jinzhou, China: 2019. [(accessed on 15 July 2021)]. Resistance Monitoring and Cloning and Quantitative Analysis of SgAbd-1-like Gene in Frankliniella occidentalis (Pergande) Available online: https://d.wanfangdata.com.cn/thesis/D02295864. [Google Scholar]
  • 35.Liu J., He Q., Lin X., Smagghe G. Recent progress in nanoparticle-mediated RNA interference in insects: Unveiling new frontiers in pest control. J. Insect Physiol. 2025;167:104884. doi: 10.1016/j.jinsphys.2025.104884. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Articles from Insects are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES