Simple Summary
Skeletal muscle plays a decisive role in the yield and quality of meat in mammals. It is regulated by a complex molecular network. Through transcriptome sequencing, we identified THBS1 as a core differentially expressed gene; however, its specific regulatory functions in skeletal muscle remain unclear. In this study, we demonstrated that the THBS1 gene inhibits the proliferation and differentiation of C2C12 myoblasts. It was also found to enhance the activity of the TGF-β signaling pathway, thereby suppressing cell proliferation and differentiation. These findings provide significant theoretical support for the potential application of the THBS1 gene as a molecular marker in regulating muscle growth and facilitating genetic improvements in livestock.
Keywords: THBS1, myoblasts, TGF-β signaling pathway, skeletal muscle, cellular differentiation
Abstract
Background: Thromboxane B2 Synthase 1 (THBS1), also known as TSP-1, is a multifunctional glycoprotein involved in various cellular processes that plays a crucial role in skeletal muscle development and repair. It acts as a key physiological activator of transforming growth factor-β1 (TGF-β1), both in vivo and in vitro. Methods: This study aimed to investigate the effects of THBS1 on myoblast proliferation and differentiation using the mouse skeletal muscle satellite cell line C2C12 and to reveal its regulatory relationship with the TGF-β signaling pathway through a series of cellular and molecular experiments. Results: Overexpression or knockout of THBS1 in C2C12 cells regulates and upregulates the activity of the TGF-β signaling pathway, thereby inhibiting the proliferation and differentiation of C2C12 cells. Conclusions: These results provide a theoretical foundation for future research aimed at enhancing skeletal muscle quality in livestock and poultry and lay the groundwork for developing therapeutic strategies for skeletal muscle disorders.
1. Introduction
Skeletal muscle is one of the tissues constituting the largest proportion of body weight in mammals and plays a decisive role in the meat yield and quality of livestock and poultry [1]. It also provides critical structural support and protection for vital organs [2]. The formation of skeletal muscle is strictly regulated by a complex molecular network that coordinates multiple key developmental stages [3]. Initially, mesenchymal stem cells differentiate into myoblasts, which proliferate through asymmetric division to generate proliferative myoblasts [4]. After a limited number of divisions, these myoblasts exit the cell cycle and enter a terminal differentiation program [5]. Differentiated cells fuse with each other via surface membrane proteins, forming multinucleated myotubes [6]. These myotubes undergo continuous fusion and cytoskeletal remodeling, ultimately maturing into contractile muscle fibers [7].
Thrombospondin 1(THBS1) has been implicated in various cancers, with elevated expression observed in breast cancer, thyroid cancer, lung adenocarcinoma, esophageal squamous cell carcinoma, melanoma, and oral squamous cell carcinoma [8]. Conversely, THBS1 expression is diminished in certain malignancies, including cervical cancer, glioma, and prostate cancer [9,10]. Moreover, THBS1 is known to act as an inhibitor of angiogenesis and tumorigenesis [11,12].
In aging muscle stem cells, changes in the expression and functional interaction between CD47 and its ligand THBS1 contribute to the gradual decline of muscle stem cell function [13]. Sarcopenia, characterized by the progressive loss of muscle mass and function, is not merely the result of skeletal muscle fiber atrophy, but is also associated with the functional exhaustion of muscle stem cells (MuSCs) [14]. Studies on the adhesion of THBS1 protein to skeletal muscle cells have identified multiple binding sites within the THBS1 molecule, including the amino-terminal globular domain, and heparin and sulfated guanosine binding sites within the type I domain [15]. THBS1 has been recognized as the primary physiological activator of transforming growth factor-β1 (TGF-β1) both in vivo and in vitro [16].
A study by Davy Vanhoutte et al. examined muscle phenotype using a skeletal muscle-specific THBS1 transgenic mouse model, generated via adenovirus-mediated gene overexpression and interference [17]. They found that THBS1 was upregulated under conditions of skeletal muscle atrophy, and its overexpression led to severe muscle atrophy. This phenomenon was driven by the activation of the TGF-β-Smad2/3 signaling pathway, which induces ATF4 expression, regulates the autophagy-lysosomal pathway (ALP), and activates the ubiquitin-proteasome system (UPS), ultimately promoting muscle atrophy. Specific inhibition of TGF-β receptor signaling or knockout of Smad2/3 in skeletal muscle significantly alleviated THBS1-induced muscle atrophy, indicating that the TGF-β-Smad2/3-ATF4 signaling axis plays a pivotal role in THBS1-induced muscle atrophy [18].
Currently, exploring the mechanisms regulating meat production performance and skeletal muscle quality is a key research focus in the livestock industry. In this study, THBS1 was identified as a core differentially expressed gene (DEG) based on the laboratory’s previously generated high-throughput whole-transcriptome sequencing data of Duroc pigs with divergent average daily gain (ADG), as well as single-nucleus transcriptome sequencing (snRNA-seq) data of Jiangquan black pigs. The effects of THBS1 on myoblast proliferation, cell cycle regulation, and differentiation were investigated using in vitro myoblast cell models. Furthermore, we examined the dynamic regulatory mechanisms of the TGF-β/Smad signaling pathway mediated by THBS1 in muscle cell development. The findings provide essential theoretical support for the potential application of THBS1 as a molecular marker in regulating muscle growth and facilitating genetic improvements in livestock.
2. Materials and Methods
2.1. Cell Culture and Differentiation
The mouse C2C12 cell line was purchased from Wuhan Puno Life Technology Co., Ltd. (Wuhan, China) Cells were cultured in complete medium within an incubator maintained at 5% CO2, 95% humidity, and 37 °C, with timely replacement of complete medium. When cell density reached 80–90%, cells were passaged at a 1:2 ratio or cryopreserved.
Induction of Differentiation: When cell density reached approximately 70%, differentiation was induced using differentiation induction medium (DMEM supplemented with 2% horse serum). The differentiation induction medium was replaced as needed.
2.2. Cell Transfection
The transfection reagents used were liposomal nucleic acid transfection reagent from Yisheng Biotechnology Co., Ltd. (Shanghai, China), and Lipofectamine TM2000 product from Invitrogen (Waltham, MA, USA). For cell transfection, we inoculated a certain number of cells into a six-well cell culture plate 20–24 h before transfection to achieve a cell culture density of 70%~95% during transfection. Transfection complexes were prepared according to the following ratios (per well): We diluted siRNA or overexpression vector with 100 μL Opti-MEM, and transfection reagent with 100 μL Opti-MEM (the corresponding amount of si RNA transfection reagent is 5 μL, and the ratio of overexpression plasmid to transfection reagent is 1:2). This was left to stand still for 5 min, before slowly adding the diluted transfection reagent dropwise into the diluted siRNA or overexpression plasmid solution. Then, we mixed it gently and incubated it at 15–25 °C for 20 min to form a transfection complex. The complete culture medium was discarded from the six-well plate and replaced with serum-free culture medium. Transfection complexes were added dropwise to each well, and the culture plate was shaken to gently mix the contents. Growth medium was changed after 4–6 h.
2.3. Construction of Overexpression Vectors and Extraction of Recombinant Plasmids
The mouse PCMV3-C-THBS1 overexpression vector was provided by Beijing Yiqiao Shenzhou Technology Co., Ltd. (Beijing, China); the THBS1 gene sequence accession number is NM_011580.3, and the plasmid sequence is shown in Appendix B.
The competent cells were removed from the −80 °C ultra-low temperature freezer and melted on ice. We then placed 100 μL of competent cells in a 1.5 mL sterile enzyme-free centrifuge tube. The constructed overexpression plasmid was added, gently mixed, and left to stand in an ice bath for 2 min. The centrifuge tube was exposed to heat shock in a 42 °C water bath for 30 s and then quickly transferred to an ice bath for 2 min, being careful not to shake the centrifuge tube. We added 200 μL of antibiotic-free LB medium, gently mixed it well, and incubated it on a shaker at 37 °C and 200 rpm for 1 h. We transferred the transformed competent cells onto antibiotic-resistant LB agar medium and spread the liquid evenly with a coating rod. We placed the plate at 37 °C until the liquid was diluted, inverted the plate, and incubated overnight. Then, we prepared 200 mL LB liquid culture medium, sterilized it with high-pressure steam, and let it cool. We added an appropriate amount of transformed bacterial solution and antibiotics, and incubated it overnight on a shaker at 37 °C and 200 rpm. We used the plasmid extraction kit from Tiangen Biochemical Technology Co., Ltd. (Beijing, China), to extract plasmids according to the instructions.
2.4. Synthetic siRNA and Negative Control
The mouse THBS1 gene sequence (accession number: NM_011580.4) was submitted to Shanghai Jima Biotechnology Co., Ltd. (Shanghai, China), which designed four pairs of siRNAs and one pair of negative controls (Negative Control siRNA, si-NC), with sequences shown in Table A1. Upon receipt of the siRNAs, they were briefly centrifuged to sediment at the tube bottom, followed by addition of 125 μL DEPC buffer for dissolution, achieving a final concentration of 20 μM. The diluted siRNAs were stored at –20 °C. The specific sequence is listed in Appendix A.1.
2.5. qRT-PCR
Total RNA was extracted using the Total RNA Extraction Kit provided by Sangon Biotech (Shanghai, China). The specific operation steps were as follows: 1 mL of lysis buffer was added to each well of a 6-well plate, and the mixture was pipetted repeatedly to fully lyse the cells and collect the lysate; 200 μL of chloroform was then added, followed by centrifugation at 4 °C, 12,000 rpm for 10 min. Next, 500 μL of the upper aqueous phase was carefully transferred to a new tube, mixed with 250 μL of absolute ethanol, and loaded into an RNA adsorption column for centrifugal filtration. The column was then washed with 500 μL of protein removal buffer and centrifuged at 12,000 rpm for 1 min to discard the flow-through, followed by an additional wash with 500 μL of wash buffer and centrifugation at 12,000 rpm for 1 min to remove residual buffer. The column was air-dried for 10 min to evaporate residual ethanol, and RNA was finally eluted with 30 μL of nuclease-free water via centrifugation at 12,000 rpm for 1 min.
cDNA synthesis was performed using the Evo M-MLV Reverse Transcriptase Premix Kit (Accurate Biology, Changsha, China) in a 20 μL reaction system following the manufacturer’s protocol.
Quantitative real-time PCR (qPCR) was carried out on a Roche LightCycler 96 Real-Time PCR System (Roche Diagnostics, Basel, Switzerland). The thermal cycling program was set as follows: an initial denaturation at 95 °C for 30 s, followed by 40 cycles of denaturation at 95 °C for 5 s and annealing/extension at 60 °C for 30 s. Each group includes three biological replicates and three technical replicates to minimize experimental error. The statistical significance of differences among groups was examined using a t-test or one-way ANOVA. The primer sequences used in this study are listed in Appendix A.2.
2.6. CCK-8 Cell Proliferation Detection
The CCK-8 cell proliferation detection kit was provided by Beyotime Biotechnology Co., Ltd. (Shanghai, China). First, 100 μL of cell suspension (per well) was inoculated into a 96-well plate and cultured in an incubator until the cell density reached 80% for transfection. We then added 10 μL of CCK-8 reagent to each well at 12 h, 24 h, 36 h, and 48 h and then incubated it in the dark for 2 h. We then measured the absorbance at 450 nm wavelength and calculated cell viability according to the following formula:
| [experimental group-blank group]/[control group-blank group] × 100%. |
2.7. EdU-488 Cell Proliferation Detection
The EdU-488 cell proliferation detection kit was provided by Beyotime Biotechnology Co., Ltd. (Shanghai, China) Crawling treatment was carried out by adding 100 μL of cell suspension onto the slides, incubating them in a culture box for 1 h, and then adding 2 mL of complete culture medium for transfection. We then added the prepared 2× working solution and incubated it for 2 h. We removed the culture solution and added 1 mL of fixative (4% paraformaldehyde) to each well. We then fixed it at room temperature for 15 min. We removed the fixative, added 1 mL PBS to each well, and washed three times. We gently shook and washed on a shaker for five minutes each time. Then, we added 1 mL of 0.3% Triton X-100 permeate to each well and incubated at room temperature for 10 min. We removed the permeate and washed each well three times with 1 mL of PBS for five minutes each time. We added 500 μL of pre-prepared Click reaction solution, gently shook the culture plate to mix it thoroughly, and incubated it at room temperature in the dark for 30 min. We removed the reaction solution and washed each well three times with 1 mL of PBS for five minutes each time. We added an appropriate amount of anti-fluorescence quenching sealing agent (including DAPI) on the slide, used tweezers to grind the edge of the slide, and gently removed it; the slide was placed upside down on the slide with sealing agent added, and the edge was sealed with nail polish. The cell proliferation was observed under a fluorescence inverted microscope.
2.8. Cell Cycle and Apoptosis Detection Using Flow Cytometry
Preparation of cycle cell samples: Cell culture medium was collected in a 1.5 mL centrifuge tube and washed twice with 1 mL PBS. We added 1 mL of trypsin, let it stand for 2 min, and then added the cell culture medium collected above. The cells were collected into a new 1.5 mL centrifuge tube and centrifuged at 1000 rpm for 5 min. We removed the supernatant, added 1 mL of PBS to resuspend the cells, and centrifuged at 1000 rpm for 5 min. Fixed cells were added to the prepared PI staining solution and stained; 500 μL of PI staining solution was added to each centrifuge tube, and the cells were slowly resuspended. Then, the cells were incubated in the dark at 37 °C for 30 min and tested on the machine.
Preparation of apoptotic cell samples: We sucked out the cell culture medium and placed it in a new 2 mL sterile enzyme-free centrifuge tube. We washed the cells once with PBS, added 1 mL of trypsin without EDTA to digest the cells, and let them stand at room temperature. We paid attention to digestion time and avoided digestion times that were too short or too long. We added the cell culture medium collected above, gently blew down the cells, and transferred them to a new centrifuge tube. They were centrifuged at 1000 rpm for 5 min. We discarded the supernatant, collected the cells, and resuspended the cells in PBS. The resuspended cells were centrifuged at 1000 rpm for 5 min. After discarding the supernatant, we added 195 μL of Annexin V-FITC binding solution and gently resuspended the cells. We added 5 μL of Annexin V-FITC and mixed gently, and then added 10 μL of PI staining solution and mixed gently. This was incubated at room temperature in the dark for 20 min, resuspended twice during the incubation process, and then placed in an ice bath. Machine testing was performed immediately.
2.9. Western Blot
C2C12 cells were lysed using RIPA lysis solution containing PMSF (Beyotime, Shanghai, China). The BCA protein assay kit (Beyotime, Shanghai, China) was used to quantify protein. The treated cells were cultured for the desired number of days, washed once with PBS, and then lysed with RIPA lysis solution containing PMSF and collected into 1.5 mL centrifuge tubes. Lysates were centrifuged at 12,000 rpm for 5 min at 4 °C, and the supernatant was collected. The supernatants were subjected to BCA protein analysis (Beyotime, Shanghai, China) for protein quantification. Protein samples were diluted to the same concentration with lysate, added to SDS-PAGE up-sampling buffer, then heated at 100 °C in a metal bath for 10 min, and stored at −20 °C. The 20 µg protein was loaded in each well and then separated via SDS-PAGE. Subsequently, proteins were transferred to a PVDF membrane. After blocking nonspecific sites with blocking solution, the PVDF membranes were sequentially incubated with primary antibodies overnight at 4 °C (the information on antibodies could be found in Appendix C.), washed three times with TBST, and then with secondary antibodies for 1 h. ECL luminescent solution was added to the PVDF membrane and incubated for 5 min away from any light; then, the protein bands were detected using a chemiluminescent imager.
2.10. Statistical Analysis
All data were analyzed using IBM SPSS Statistics 20 software. Each group includes three biological replicates and three technical replicates to minimize experimental error. The statistical significance of differences among groups was examined using a t-test or one-way ANOVA. Images were plotted using GraphPad Prism 5.0, with data for each group expressed as Mean ± SEM. Statistical significance is expressed as * p < 0.05; ** p < 0.01; *** p < 0.001.
3. Results
3.1. Expression of THBS1 in C2C12 Cell Differentiation Induction
Differentiation induction medium was used to induce differentiation of cells. Their differentiation status was observed under a microscope at D1, D3, D5, D7, and D9 days, as shown in Figure 1A. At D0 and D5 days, fluorescence staining of the cytoskeleton (β-actin) was performed. The results are shown in Figure 1C and indicate a good state of cell differentiation. The expression of THBS1, MyoG, and MyoD was detected in differentiated cells on days D1, D3, D5, D7, and D9, as shown in Figure 1B. The expression of the THBS1 gene showed a significant downward trend followed by an upward trend. The expression level of MyoG gene showed a significant increase with the increase in differentiation days. The MyoD gene showed a trend of first decreasing and then increasing, and the trend was significant at D5.
Figure 1.
Expression of THBS1 at different stages of C2C12 cell differentiation. (A) Myotube fusion state; (B) expression levels of THBS1, MyoG, and MyoD genes on each day of differentiation compared to D1; (C) analyzed by laser confocal microscopy, blue represents the nucleus (DAPI) and red represents the β-actin protein. Magnification is 630× (* p < 0.05,** p < 0.01).
3.2. Subcellular Localization of THBS1
Cell differentiation was induced using differentiation induction medium and culture until day 5. Immunofluorescence staining was employed on D0 and D5 to analyze the subcellular localization of THBS1 in myoblasts, and the cells were photographed under a confocal laser microscope. As shown in Figure 2, THBS1 is expressed in the nucleus on both D0 and D5.
Figure 2.
CelluLar sub-localization assay of THBS1 protein, analyzed using laser confocal microscopy. Blue represents nuclei (DAPI), red represents THBS1 protein. Magnification is 630×.
3.3. The Effect of THBS1 on Apoptosis of C2C12 Cells
The interfering fragment and overexpression vector of the THBS1 gene were transfected into C2C12 cells, and apoptosis was detected using an apoptosis detection kit and flow cytometry. As shown in Figure 3, overexpression of the THBS1 gene (Figure 3A) significantly increased the number of apoptotic cells (p < 0.01), while interference with the THBS1 gene (Figure 3B) significantly reduced the number of apoptotic cells (p < 0.01). This demonstrates that overexpression of the THBS1 gene promotes apoptosis in C2C12 cells.
Figure 3.
Effect of THBS1 on apoptosis of C2C12 cells determined by flow cytometry. (A) Detection of apoptosis after interference with THBS1 and apoptosis rate; (B) detection of apoptosis after overexpression of THBS1 and apoptosis rate (** p < 0.01).
3.4. Effect of THBS1 on the Proliferation of C2C12 Cells
3.4.1. Flow Cytometry Detection of C2C12 Cell Cycle
The interfering fragment and overexpression vector of THBS1 gene were transfected into C2C12 cells, and cell cycle and apoptosis were detected using a cell cycle and apoptosis detection kit and a flow cytometer. As shown in Figure 4, after overexpression of the THBS1 gene (Figure 4A), the number of cells in the G0/G1 phase significantly increased (p < 0.05), while the number of cells in the S phase decreased, indicating that overexpression of the THBS1 gene can cause cells to stagnate in the G0/G1 phase and inhibit DNA synthesis. After interfering with the THBS1 gene (Figure 4B), there was a significant decrease in G0/G1 phase cells and a significant increase in S phase cells (p < 0.05). Interference with the THBS1 gene can prolong the S phase of cells, promote DNA synthesis, and thus promote cell proliferation. These results indicate that the THBS1 gene has an inhibitory effect on cell proliferation.
Figure 4.
Effects of THBS1 on C2C12 cell cycle as determined by flow cytometry. (A) Cell cycle assay after interference with THBS1 and the number of cells in each period of the cell cycle; (B) cell cycle assay after overexpression of THBS1 and the number of cells in each period of the cell cycle (* p < 0.05).
3.4.2. The Effect of THBS1 on the C2C12 Cell Proliferation Activity
The interference fragment and overexpression vector of the THBS1 gene were transfected into C2C12 cells, and cell proliferation activity was detected using CCK-8 reagent at 12 h, 24 h, 36 h, and 48 h. The OD values measured at a wavelength of 450 nm are shown in Figure 5. Compared with the control group, overexpression of THBS1 significantly reduced cell activity at 12 and 24 h (p < 0.05) and significantly decreased cell activity at 36 h (p < 0.01). Interference with THBS1 significantly increased cell viability at 12, 24, and 48 h (p < 0.01) and at 36 h (p < 0.05), indicating that the THBS1 gene can inhibit C2C12 cell viability.
Figure 5.
Effects of THBS1 on C2C12 cell cycle was determined by CCK-8 (* p < 0.05, ** p < 0.01, *** p < 0.001).
3.4.3. EDU Detection of C2C12 Cell Proliferation Ability
The interference fragment and overexpression vector of the THBS1 gene were transfected into C2C12 cells. The cells were stained with EdU, and fluorescence was detected under a fluorescence microscope. As shown in Figure 6, after interfering with the THBS1 gene, the positive rate of EdU cells (green fluorescence) significantly increased. Overexpression of the THBS1 gene significantly reduced the positivity rate of EdU cells.
Figure 6.
Effect of EdU detection of THBS1 on cell proliferation. Blue represents cell nuclei, and EdU (green) fluorescence represents cell proliferation. (A) EdU cell assay after overexpression of THBS1 gene; (B) EdU cell assay after interfering with THBS1 gene. Magnification is 400× (* p < 0.05, *** p < 0.001).
3.4.4. The Effect of THBS1 on Cell Proliferation and Differentiation
The interference fragment and overexpression vector of THBS1 gene were transfected into C2C12 cells at corresponding concentrations. The cells were cultured for 24–48 h and then collected to detect the expression of proliferation marker genes CDK4, Ki67, and PCNA. As shown in Figure 7A, overexpression of THBS1 significantly reduced the expression of proliferation marker PCNA (p < 0.05) and Ki67. After interfering with THBS1, the expression levels of proliferation marker genes PCNA and Ki67 in the si-THBS1 group were significantly increased (p < 0.01), as was the expression level of CDK4 (p < 0.05). This indicates that the THBS1 gene has the ability to inhibit cell proliferation. At D5, we used qRT-PCR technology to detect the expression of differentiation marker genes MyoD, MyoG, and MEF2C. The results are shown in Figure 7B. At D5 days, compared with the si NC group, the expression levels of MEF2C and MyoD in the si-THBS1 group significantly increased (p < 0.05), and the expression level of MyoG showed a non-significant increase.
Figure 7.
Effects of THBS1 on proliferation marker genes and differentiation marker genes in C2C12 cells detected by qRT-PCR. (A) Proliferation marker gene assay after overexpression of THBS1 gene and interference with THBS1 gene (* p < 0.05, ** p < 0.01); (B) Assay for differentiation marker genes at D0 and D5 days after interference with the THBS1 gene (* p < 0.05, ** p < 0.01, *** p < 0.001).
3.5. WB Detection of Cell Differentiation
Western blot technology was used to detect the expression levels of differentiation marker protein MyoG. As shown in Figure 8A, compared to the si-NC group, the si-THBS1 group exhibited significantly elevated MyoG protein levels at D0 (p < 0.05) and markedly elevated MyoG protein levels at D5 (p < 0.01). As shown in Figure 8B, compared to the PCMV3-C group, the PCMV3-C-THBS1 group exhibited a significantly reduced MyoG protein level on day D0 (p < 0.01) and a markedly decreased MyoG protein level on day D5 (p < 0.01). These results indicate that overexpression of the THBS1 gene has an inhibitory effect on cell differentiation. The analysis of overexpression and interference results indicates that the THBS1 gene has the ability to inhibit cell differentiation.
Figure 8.
(A) Effects of interfering THBS1 on differentiation of C2C12 cell differentiation; (B) effect of overexpression of THBS1 on differentiation of C2C12 cell differentiation (* p < 0.05, ** p < 0.01, *** p < 0.001).
3.6. The Effect of TGF-β Signaling Pathway on the Proliferation and Differentiation of C2C12 Cells
In this study, cells were treated with the TGF-β signaling pathway activator SR1-01138 and the inhibitor Viatertide during cell culture and induced differentiation. Four experimental groups were set up: the group treated with 20 μmol/L SR1-01138 (designated SR20), the group treated with 20 μmol/L Viatertide (designated V20), and the negative control group supplemented with equal volume of DMSO. Among these, the vehicle control corresponding to the SR1-01138 treatment was designated D20, and the vehicle control corresponding to the Viatertide treatment was designated VD20. We collected cells and detected the expression of differentiation marker genes for proliferation using qRT-PCR technology. As shown in Figure 9A, the activation of the TGF-β signaling pathway significantly reduced the expression levels of proliferation marker genes (CDK4, PCNA, CDK2, and Cyclin D1) (p < 0.05). As shown in Figure 9B, inhibition of the TGF-β signaling pathway significantly reduced the expression levels of proliferation marker genes (PCNA and CDK2) (p < 0.05), indicating that the TGF-β signaling pathway has the ability to inhibit C2C12 cell proliferation.
Figure 9.
Real-time quantitative fluorescence PCR (qRT-PCR) analysis of the regulatory effects of the TGF-β signaling pathway on proliferation and expression of differentiation marker genes in C2C12 cells. (A) Addition of the SR1-01138 signaling pathway activator and analysis of the expression levels of genes associated with pathway proliferation markers. (B) Addition of the SR1-01138 signaling pathway activator and analysis of the expression levels of genes associated with pathway differentiation markers. (C) Addition of a Viatertide signaling pathway inhibitor alters the expression levels of genes associated with pathway proliferation. (D) Addition of a Viatertide signaling pathway inhibitor alters the expression levels of genes associated with pathway differentiation (* p < 0.05).
As shown in Figure 9C, activation of the TGF-β signaling pathway significantly reduced the expression levels of differentiation marker genes (MyoD and MEF2C) (p < 0.05). As shown in Figure 9D, inhibition of the TGF-β signaling pathway significantly reduced the expression levels of differentiation marker genes (MyoG, MyoD, and MEF2C) (p < 0.05), indicating that the TGF-β signaling pathway has the ability to inhibit C2C12 cell proliferation and C2C12 cell differentiation.
3.7. The Effect of THBS1 Gene on TGF-β Signaling Pathway
We transfected the interfering fragment of the THBS1 gene into C2C12 cells at the corresponding concentrations, induced cell differentiation, and treated the cells with activators and inhibitors of signaling pathways. Cells were cultivated to D5, and collected from D0 and D5. qRT-PCR technology was used to detect the expression levels of pathway-related factors (TGFB1, SMAD2, LTBP1). As shown in Figure 10A, the expression level of LTBP1 significantly decreased (p < 0.05) and the expression levels of TGFB1 and SMAD2 decreased at D0. At D5, the expression levels of TGFB1 and SMAD2 were significantly reduced (p < 0.05), and the expression level of LTBP1 was non-significantly reduced.
Figure 10.
Detection of genes related to signaling pathways detected by qRT-PCR. (A) Detection of pathway-associated genes at D0 and D5 after interference with the THBS1 gene; (B) detection of pathway-related genes at D0 and D5 after overexpression of THBS1 gene (* p < 0.05).
The same experiment was conducted using the overexpression vector of the THBS1 gene. As shown in Figure 10B, the expression level of LTBP1 significantly increased at D0 (p < 0.05), while the expression levels of TGFB1 and SMAD2 increased. At D5, the expression levels of TGFB1 and SMAD2 significantly increased (p < 0.05), and the expression level of LTBP1 increased.
3.8. Interference with THBS1 and Simultaneous Activation of TGF-β Signaling Pathway
To verify whether the THBS1 gene affects cell differentiation through the TGF-β signaling pathway, we first introduced interfering fragments into the cells and then treated them with signaling pathway activators (SR). We collected cell samples at D0 and D5 of differentiation and measured the expression levels of proliferation marker genes PCNA and CDK4 at D0 using real-time quantitative PCR (qRT-PCR). We also detected the expression levels of differentiation marker genes MyoD and MyoG at D5 of differentiation. As shown in Figure 11A, at D0, compared with the si-THBS1 + NC group and the si-NC + NC group, the expression of PCNA was significantly increased (p < 0.05), and the expression of CDK4 was extremely significantly increased (p < 0.001). Compared with the si-NC + NC group, the si-NC + SR group showed a significant decrease in PCNA expression (p < 0.05) and a decrease in CDK4 expression. The expression levels of PCNA and CDK4 were significantly increased in the si-THBS1 + NC group compared to the si-NC + SR group (p < 0.001). There was no significant difference in PCNA expression between the si-THBS1 + SR group and si-THBS1 + NC group, while the expression of CDK4 was significantly reduced (p < 0.05). This indicates that interference with THBS1 can, to some extent, rescue the proliferation inhibition caused by activators.
Figure 11.
Detection of proliferation and differentiation marker genes by qRT-PCR. (A) Expression levels of PCNA and CDK4 after interfering with THBS1 while activating the TGF-β signaling pathway; (B) Expression levels of MyoG and MyoD after interfering with THBS1 while activating the TGF-β signaling pathway (* p < 0.05, ** p < 0.01, *** p < 0.001, “ns” means p > 0.05).
Figure 11B shows that at D5, compared with the si-THBS1 + NC group and the si-NC + NC group, the expression level of MyoG significantly increased (p < 0.05) and the expression level of MyoD increased. Compared with the si-NC + NC group, the si NC + SR group showed a significant decrease in MyoD expression (p < 0.05) and a decrease in MyoG expression. Compared with the si-NC + SR group, the si-THBS1 + NC group showed a significant increase in MyoG expression (p < 0.01) and MyoD expression (p < 0.05). Compared with si-THBS1 + NC, the expression levels of MyoG and MyoD in the si-THBS1 + SR group were significantly reduced (p < 0.01). The results indicate that interference with THBS1 may, to some extent, salvage the differentiation inhibition caused by activators.
4. Discussion
Skeletal muscle development is a complex process governed by a precise network of regulatory genes and signaling pathways [19]. Our study identifies THBS1 as a novel negative regulator of MyoGenesis, exerting its effects primarily by modulating the transforming growth factor-beta (TGF-β) signaling pathway in C2C12 myoblasts. The findings demonstrate that THBS1 inhibits both proliferation and differentiation, positioning it as a potential key node in the regulatory circuitry controlling muscle mass. In a mouse model, knockdown of THBS1 weakened the THBS1-TGF-β-Smad2/3-ATF4 signaling pathway and reduced skeletal muscle atrophy induced by denervation and nutritional stress. This study indicates that THBS1 is a necessary endogenous mediator of muscle atrophy [20].
A series of gain- and loss-of-function experiments consistently established the inhibitory role of THBS1. This identified THBS1 as a significantly downregulated gene associated with myogenesis and energy metabolism in neonatal Hanwoo calves under maternal overnutrition conditions [21]. Studies have demonstrated that in C2C12 myoblasts, THBS1 expression levels gradually decline from day 2 to day 6 during the transition from adhesion to differentiation, consistent with the findings of this study. However, our analysis revealed a rebound in THBS1 expression on day 9 of differentiation, which may be associated with the completion of myoblast fusion [22]. Overexpression of THBS1 significantly suppressed myoblast proliferation, induced G0/G1 cell cycle arrest, and promoted apoptosis. This is consistent with findings in HCC-related research, where knockdown of miR-222-3p can directly target the overexpression of THBS1, thereby inhibiting the progression of HCC in vitro and suppressing cell proliferation [23]. Conversely, THBS1 knockdown enhanced proliferation, facilitated S-phase entry, and reduced apoptosis. These phenotypic changes were corroborated by corresponding alterations in the expression of key proliferation markers (PCNA, Ki67, CDK4). Furthermore, THBS1 knockdown led to the upregulation of critical MyoGenic regulatory factors (MyoD, MyoG, MEF2C) and their protein products, whereas overexpression suppressed them. This collective evidence strongly suggests that THBS1 acts as a brake on both the expansion and the differentiation of the myoblast pool. The TGF-β pathway is a well-documented inhibitor of MyoGenesis [24,25,26]. Our data confirm its role in C2C12 cells, as pathway activation was suppressed, while its inhibition enhanced, the expression of both proliferation and differentiation markers. Previous studies have shown that THBS1 regulates the proliferation and apoptosis of MDCK cells through the TGF-β/Smad signaling pathway [27]. Given that THBS1 is a known physiological activator of latent TGF-β [28], we investigated the functional interplay between them. The observation that THBS1 knockdown could partially rescue the proliferation inhibition caused by TGF-β pathway activation provides compelling evidence that THBS1 functions, at least in part, through this pathway. The more pronounced rescue effect on proliferation markers compared to differentiation markers suggests that the THBS1-TGF-β axis exerts a stronger influence on controlling cell cycle progression, while its impact on terminal differentiation may involve additional, parallel mechanisms or be secondary to the proliferation arrest.
In conclusion, our study delineates a model wherein THBS1 serves as an upstream modulator that fine-tunes the TGF-β signaling pathway to restrain myoblast proliferation and differentiation. This not only expands our understanding of the molecular mechanisms controlling MyoGenesis but also highlights THBS1 as a potential target for strategies aimed at enhancing muscle growth in livestock or countering muscle-wasting conditions. Future work should focus on validating these findings in vivo and elucidating the potential TGF-β-independent mechanisms through which THBS1 may influence muscle cell fate.
5. Limitations of the Study
While this study has demonstrated that THBS1 inhibits the proliferation and differentiation of C2C12 myogenic cells by regulating the TGF-β signaling pathway, several limitations remain that require further investigation. To date, the regulatory function of THBS1 has only been validated in vitro cell models; no primary pig skeletal muscle cell model has been established, and future experiments will employ such cells for verification. Although this study confirms that THBS1 exerts its effects via modulation of the TGF-β pathway, the upstream-downstream regulatory relationship between the two pathways remains unclear, and the mechanistic evidence for TGF-β pathway activation is incomplete. Subsequent studies should consider additional validation through protein phosphorylation assays.
6. Conclusions
The THBS1 gene plays a crucial regulatory role in the proliferation and differentiation of C2C12 myoblasts. Overexpression of the THBS1 gene can inhibit the expression of genes related to myoblast proliferation and differentiation, while interference with THBS1 has the opposite effect. THBS1 suppresses the proliferation and differentiation processes of myoblasts by affecting the TGF-β signaling pathway. A series of experiments revealed that overexpression of the THBS1 gene promotes the activity of the TGF-β signaling pathway, which exerts an inhibitory effect on the proliferation and differentiation of myoblasts. Additionally, interference with the THBS1 gene can reverse the inhibitory effects on proliferation and differentiation caused by the activation of the TGF-β signaling pathway. This study used an in vitro myoblast model to clarify the role of thrombospondin-1 (THBS1) in the molecular regulatory network of muscle growth and development, providing novel molecular targets for deciphering the genetic regulatory mechanisms of muscle. Future work will further refine the THBS1 regulatory network by characterizing its upstream transcriptional regulatory elements, interacting proteins, and cross-talk with other key pathways of muscle development.
Appendix A
Appendix A.1
The mouse THBS1 gene sequence (accession number: NM_011580.4) was submitted to Shanghai Jima Biotechnology Co., Ltd., which designed four pairs of siRNAs and one pair of negative controls (Negative Control siRNA, si-NC), with sequences shown in Table A1. Upon receipt of the siRNAs, they were briefly centrifuged to sediment at the tube bottom, followed by addition of 125 μL DEPC buffer for dissolution, achieving a final concentration of 20 μM. The diluted siRNAs were stored at –20 °C.
Table A1.
Sequence information of siRNA interference.
| Gene | Forward (5′–3′) | Reverse (5′–3′) |
|---|---|---|
| THBS1-Mus-2667 | GCCAGUACGUUUACAACGUTT | ACGUUGUAAACGUACUGGCTT |
| THBS1-Mus-3044 | GUGCCAGAUAUUGAUGACATT | UGUCAUCAAUAUCUGGCACTT |
| THBS1-Mus-3582 | CCGGUUAUAUCAGAGUGGUTT | ACCACUCUGAUAUAACCGGTT |
| THBS1-Mus-2875 | GGCCGACCAUGAUAAAGAUTT | AUCUUUAUCAUGGUCGGCCTT |
| Si-NC | UUCUCCGAACGUGUCACGUTT | ACGUGACACGUUCGGAGAATT |
Appendix A.2
Primer sequences were designed using Primer 5.0 software; the fluorescent quantitative primer sequence information is shown in Table A2.
Table A2.
The primer sequences of RT-qPCR.
| Gene | Forward (5′–3′) | Reverse (5′–3′) |
|---|---|---|
| Mus-THBS1 | CCTGGACTTGCTGTAGGTTAT | AGGACTGGGTGACTTGTTTC |
| Mus-MyoD | TCCGCTACATCGAAGGTCTG | GTCCAGGTGCGTAGAAGGC |
| Mus-MyoG | CGGGCTATGAGCGGACTGAG | CACAGACTTCCTCTTACACACCTTAC |
| Mus-Mef2c | GCAGCAGCAGCACCTACATAAC | TGAGTAGAAGGCAGGGAGAGATTTG |
| Mus-CDK4 | GATGTCTGTGCTACTTCCCGAACTG | TGTCCTCAGGTCCTGGTCTATATGC |
| Mus-CDK2 | ACTACTCTACAGCCGTGGACATC | CAATCTCAGAATCTCCAGGGAACAG |
| Mus-Cyclin | GAGGCGGATGAGAACAAGCAGAC | GGAGGGTGGGTTGGAAATGAACTTC |
| Mus-PCNA | AGAGGAGGAAGCAGTTACCATAGAG | ACATACTGAGTGTGACTGTAGGAGAG |
| Mus-LTBP1 | ATCTTCCCTTGCCCCGTCCAG | GTTCTCGCCACCAGTGTCGTAAG |
| Mus-TGFB1 | GCAACAATTCCTGGCGTTACCTTG | AGCCCTGTATTCCGTCTCCTTGG |
| Mus-SMAD2 | GAGACCTTCCATGCGTCACAGC | GGAGAGCAAGCCTAAGCAGAACC |
| Mus-SMAD3 | TCGTCCATCCTGCCCTTCACC | ACTTCTCCTCCTGCCCGTTCTG |
| Mus-β-actin | GTGACGTTGACATCCGTAAAGA | GCCGAACTCATCGTACTCC |
Appendix A.3
With three technical replicates per sample, experiments were conducted using the reaction systems specified in Table A3 and the procedures outlined in Table A4, performed on ice to minimize operational errors. Prior to primer use, preliminary experiments were conducted to establish relative standard curves, determine appropriate cDNA template concentrations, and verify primer specificity. The relative expression levels of each gene were calculated using the 2−ΔΔCt method.
Table A3.
Reaction system of real-time PCR.
| Component Name | Volume (μL) |
|---|---|
| 2×SYBR® Green Pro Taq HS Premix | 10.0 |
| Primer F (10 uM) | 0.4 |
| Primer R (10 uM) | 0.4 |
| Template cDNA | 2.0 |
| RNase free water | 7.2 |
| Total | 20.0 |
Table A4.
Reaction program of real-time PCR.
| Cyclic Step | Temperature (°C) | Time (s) | Cycle Number |
|---|---|---|---|
| Step 1 | 95 | 30 | 1 |
| Step 2 | 95 | 5 | 40 |
| 60 | 30 | ||
| Step 3 | Dissociation Stage | ||
Appendix B
The mouse PCMV3-C-THBS1 overexpression vector was provided by Beijing Yiqiao Shenzhou Technology Co., Ltd. (Beijing, China); the THBS1 gene sequence accession number is NM_011580.3, and the plasmid sequence is shown in Figure A1.
Figure A1.
Mapping of mouse THBS1 gene overexpression vectors.
Appendix C
Appendix C.1
Detailed information about the antibodies used in this study is provided in Table A5.
Table A5.
Antibody.
| Antibody | Company of Production | Catalog Number | Dilute Strength |
|---|---|---|---|
| GAPDH | Proteintech | Cat No. 10494-1-AP | 1:1000 |
| THBS1 | Proteintech | Cat No. 67241-1-Ig | 1:1000 |
| MyoG | Proteintech | Cat No. 26762-1-AP | 1:1000 |
Appendix C.2
To investigate the effects of the TGF-β signaling pathway on C2C12 cells, this study employed the TGF-β signaling pathway activator SR1-01138 and inhibitor Viatertide. The activator was added to C2C12 cells at concentrations of 10 μmol/L, 20 μmol/L, and 30 μmol/L during culture, while the inhibitor was added at concentrations of 15 μmol/L, 20 μmol/L, and 25 μmol/L. Expression levels of pathway-related factors (TGFB1, SMAD2, and SMAD3) were subsequently measured using RT-qPCR, as shown in Figure A2. The concentration of 20 μmol/L was ultimately selected for subsequent experiments.
Figure A2.
Detection of genes related to signaling pathways were detected by RT-qPCR (A) Expression of pathway-related genes at different concentrations of signaling pathway activators (B) Expression of pathway-related genes at different concentrations of signaling pathway inhibitors (* p < 0.05, ** p < 0.01).
Appendix D
Author Contributions
J.Q.: Data curation, Writing—original draft, Writing—reviewing and editing, Conceptualization, Methodology, Software; X.J.: Visualization, Investigation; J.W.: Visualization, Investigation; Y.W.: Visualization, Investigation, Writing; W.C.: Visualization, Investigation; H.C.: Visualization, Investigation; J.H.: Visualization, Investigation; H.T.: Visualization, Investigation; J.C.: Visualization, Investigation; B.X.: Conceptualization, Methodology, Funding acquisition, Writing—reviewing and editing; Y.Z.: Conceptualization, Software, Writing—reviewing and editing. All authors have read and agreed to the published version of the manuscript.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
All the original data involved in this experiment can be obtained from the author.
Conflicts of Interest
The authors declare no conflicts of interest.
Funding Statement
This study was supported financially by the National Key R&D Program of China (No. 2021YFD1301200), the Agricultural Animal Breeding Project of Shandong Province (No. 2020LZGC012), Shandong Province Pig Industry Technology System Project (No. SDAIT-08-02).
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
References
- 1.Yang Y., Wu J., Liu W., Zhao Y., Chen H. The function and regulation mechanism of non-coding RNAs in muscle development. Int. J. Mol. Sci. 2023;24:14534. doi: 10.3390/ijms241914534. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Aoi W., Inoue R., Mizushima K., Honda A., Björnholm M., Takagi T., Naito Y. Exercise-acclimated microbiota improves skeletal muscle metabolism via circulating bile acid deconjugation. iScience. 2023;26:106251. doi: 10.1016/j.isci.2023.106251. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.He M., Li Y., Tang Q., Li D., Jin L., Tian S., Che T., He S., Deng L., Gao G., et al. Genome-wide chromatin structure changes during adipogenesis and myogenesis. Int. J. Biol. Sci. 2018;14:1571–1585. doi: 10.7150/ijbs.25328. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Chaturvedi D., Reichert H., Gunage R.D., VijayRaghavan K. Identification and functional characterization of muscle satellite cells in drosophila. eLife. 2017;6:e30107. doi: 10.7554/elife.30107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Ishii A., Lo S.H. A role of tensin in skeletal-muscle regeneration. Biochem. J. 2001;356:737–745. doi: 10.1042/bj3560737. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Davis L.A., Fogarty M.J., Brown A., Sieck G.C. Structure and function of the mammalian neuromuscular junction. In: Prakash Y.S., editor. Comprehensive Physiology. Wiley; Hoboken, NJ, USA: 2022. pp. 3731–3766. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Hidaka Y., Chiba-Ohkuma R., Karakida T., Onuma K., Yamamoto R., Fujii-Abe K., Saito M.M., Yamakoshi Y., Kawahara H. Combined effect of midazolam and bone morphogenetic protein-2 for differentiation induction from C2C12 myoblast cells to osteoblasts. Pharmaceutics. 2020;12:218. doi: 10.3390/pharmaceutics12030218. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Shen J., Cao B., Wang Y., Ma C., Zeng Z., Liu L., Li X., Tao D., Gong J., Xie D. Hippo component YAP promotes focal adhesion and tumour aggressiveness via transcriptionally activating THBS1/FAK signalling in breast cancer. J. Exp. Clin. Cancer Res. 2018;37:175. doi: 10.1186/s13046-018-0850-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Jiang L., Fang T., Hu T., Feng J., Yan P. Mir-338-3p targeting THBS1 attenuates glioma progression by inhibiting the PI3K/akt pathway. Biol. Direct. 2024;19:9. doi: 10.1186/s13062-023-00443-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Shen J., Zhou L., Ye K., Gong J., Wu F., Mo K., Zhu Y., Chen C., Zhan R. The role of SPI1/VSIG4/THBS1 on glioblastoma progression through modulation of the PI3K/AKT pathway. J. Adv. Res. 2025;71:487–500. doi: 10.1016/j.jare.2024.06.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Tsuchida R., Osawa T., Wang F., Nishii R., Das B., Tsuchida S., Muramatsu M., Takahashi T., Inoue T., Wada Y., et al. BMP4/thrombospondin-1 loop paracrinically inhibits tumor angiogenesis and suppresses the growth of solid tumors. Oncogene. 2014;33:3803–3811. doi: 10.1038/onc.2013.358. [DOI] [PubMed] [Google Scholar]
- 12.Jin A., Zhou J., Yu P., Zhou S., Chang C. High expression of THBS1 leads to a poor prognosis in papillary thyroid cancer and suppresses the anti-tumor immune microenvironment. Technol. Cancer Res. Treat. 2022;21:15330338221085360. doi: 10.1177/15330338221085360. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Porpiglia E., Mai T., Kraft P., Holbrook C.A., de Morree A., Gonzalez V.D., Hilgendorf K.I., Frésard L., Trejo A., Bhimaraju S., et al. Elevated CD47 is a hallmark of dysfunctional aged muscle stem cells that can be targeted to augment regeneration. Cell Stem Cell. 2022;29:1653–1668.e8. doi: 10.1016/j.stem.2022.10.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Fukada S. The roles of muscle stem cells in muscle injury, atrophy and hypertrophy. J. Biochem. 2018;163:353–358. doi: 10.1093/jb/mvy019. [DOI] [PubMed] [Google Scholar]
- 15.Adams J.C., Lawler J. Cell-type specific adhesive interactions of skeletal myoblasts with thrombospondin-1. Mol. Biol. Cell. 1994;5:423–437. doi: 10.1091/mbc.5.4.423. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Binsker U., Kohler T.P., Krauel K., Kohler S., Habermeyer J., Schwertz H., Hammerschmidt S. Serotype 3 pneumococci sequester platelet-derived human thrombospondin-1 via the adhesin and immune evasion protein hic. J. Biol. Chem. 2017;292:5770–5783. doi: 10.1074/jbc.m116.760504. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Murphy-Ullrich J.E., Suto M.J. Thrombospondin-1 regulation of latent TGF-β activation: A therapeutic target for fibrotic disease. Matrix Biol. 2018;68–69:28–43. doi: 10.1016/j.matbio.2017.12.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Bige N., Shweke N., Benhassine S., Jouanneau C., Vandermeersch S., Dussaule J.-C., Chatziantoniou C., Ronco P., Boffa J.-J. Thrombospondin-1 plays a profibrotic and pro-inflammatory role during ureteric obstruction. Kidney Int. 2012;81:1226–1238. doi: 10.1038/ki.2012.21. [DOI] [PubMed] [Google Scholar]
- 19.Li Y., Chen Y., Jin W., Fu S., Li D., Zhang Y., Sun G., Jiang R., Han R., Li Z., et al. Analyses of MicroRNA and mRNA expression profiles reveal the crucial interaction networks and pathways for regulation of chicken breast muscle development. Front. Genet. 2019;10:197. doi: 10.3389/fgene.2019.00197. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Vanhoutte D., Schips T.G., Minerath R.A., Huo J., Kavuri N.S.S., Prasad V., Lin S.-C., Bround M.J., Sargent M.A., Adams C.M., et al. Thbs1 regulates skeletal muscle mass in a TGFβ-Smad2/3-ATF4-dependent manner. Cell Rep. 2024;43:114149. doi: 10.1016/j.celrep.2024.114149. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Shokrollahi B., Park M., Baek Y.C. Differential gene expression in neonatal calf muscle tissues from Hanwoo cows overfed during mid to late pregnancy period. Sci. Rep. 2024;14:23298. doi: 10.1038/s41598-024-74976-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Lim J.H., Beg M.M.A., Ahmad K., Shaikh S., Ahmad S.S., Chun H.J., Choi D., Lee W.-J., Jin J.-O., Kim J., et al. IgLON5 Regulates the Adhesion and Differentiation of Myoblasts. Cells. 2021;10:417. doi: 10.3390/cells10020417. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Sun Y., Shi P., Wu Q., Liu B., Yu Z., Jia H., Chang H. MiR-222-3p induced by hepatitis B virus promotes the proliferation and inhibits apoptosis in hepatocellular carcinoma by upregulating THBS1. Hum. Cell. 2021;34:1788–1799. doi: 10.1007/s13577-021-00577-1. [DOI] [PubMed] [Google Scholar]
- 24.Sellathurai J., Nielsen J., Hejbøl E.K., Jørgensen L.H., Dhawan J., Nielsen M.F.B., Schrøder H.D. Low oxygen tension enhances expression of myogenic genes when human myoblasts are activated from G0 arrest. PLoS ONE. 2016;11:e0158860. doi: 10.1371/journal.pone.0158860. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Abd Eldaim M.A., Zhao K., Murakami M., Yoshioka H., Itoyama E., Kitamura S., Nagase H., Matsui T., Funaba M. Regulatory expression of uncoupling protein 1 and its related genes by endogenous activity of the transforming growth factor-β family in bovine myogenic cells. Cell Biochem. Funct. 2021;39:116–125. doi: 10.1002/cbf.3592. [DOI] [PubMed] [Google Scholar]
- 26.Lee K.-P., Shin Y.J., Panda A.C., Abdelmohsen K., Kim J.Y., Lee S.-M., Bahn Y.J., Choi J.Y., Kwon E.-S., Baek S.-J., et al. miR-431 promotes differentiation and regeneration of old skeletal muscle by targeting Smad4. Genes Dev. 2015;29:1605–1617. doi: 10.1101/gad.263574.115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Li R., Zhang F., Wang L., Wang S., Zhou M., Wang J., Zhang Y., Tan X., Chen W., Yang K., et al. Mechanism of THBS1 regulation of MDCK cell proliferation and apoptosis through TGF-β/smad signalling. Int. J. Mol. Sci. 2025;26:395. doi: 10.3390/ijms26010395. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Schultz-Cherry S., Lawler J., Murphy-Ullrich J.E. The type 1 repeats of thrombospondin 1 activate latent transforming growth factor-beta. J. Biol. Chem. 1994;269:26783–26788. doi: 10.1016/s0021-9258(18)47087-1. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All the original data involved in this experiment can be obtained from the author.