Goose astrovirus genotype 2 induces autophagy in goose renal tubular epithelial cells requiring the ERK2 signaling pathway: Pharmacological evidence for a pro-viral role of autophagy

Abstract

Goose astrovirus genotype 2 (GAstV-2) is an emerging pathogen responsible for gout in goslings, posing a serious threat to the goose breeding industry in China. Although the disease has caused significant economic losses, the mechanisms underlying GAstV-2-induced pathogenesis, particularly gout formation, remain poorly understood. In this study, we investigated the effect of GAstV-2 infection on autophagy in primary goose renal tubular epithelial (GRTE) cells and explored the associated signaling pathways. Our results demonstrated that GAstV-2 infection induced autophagic flux in GRTE cells, and pharmacological induction of autophagy increased, whereas inhibition decreased, GAstV-2 replication, which is consistent with a pro-viral role of autophagy. Furthermore, we found that GAstV-2 induced autophagy in GRTE cells through the extracellular signal-regulated kinase 2 (ERK2) signaling pathway, as determined using specific inhibitors and RNA interference assays. Collectively, this study reveals that GAstV-2 induces autophagy in GRTE cells requiring the ERK2 signaling pathway, and pharmacological induction of autophagy increased, whereas inhibition decreased, viral replication, consistent with a pro-viral function of autophagy.

Introduction

Since its first identification in 2017, goose astrovirus genotype 2 (GAstV‑2) has rapidly emerged as a primary causative agent of fatal visceral and articular gout in goslings across major goose‑producing regions of China (Zhang et al., 2017). The disease predominantly affects 5–20‑day‑old goslings, with mortality rates exceeding 30% and causing massive economic losses to the poultry industry. Clinically, infected goslings present with severe hyperuricemia, widespread urate deposition on the heart, liver, kidneys, and joint cavities, as well as acute renal tubular injury (Zhang et al., 2018; Yin et al., 2021; He et al., 2022). Notably, recent evidence suggests that GAstV-2 may cross species barriers to infect other birds such as ducks and chickens, raising concerns about its potential for broader avian transmission (Wei et al., 2020; Chen et al., 2021; He et al., 2023). Currently, no effective medical treatment is available for GAstV-2 infections, and control relies mainly on biosecurity measures.

Gout in goslings primarily arises from hyperuricemia, which results from excessive hepatic purine metabolism or impaired renal excretion of uric acid. Poultry lack key enzymes in the urea cycle, forcing nitrogenous waste to be excreted as uric acid; thus, renal dysfunction directly triggers urate accumulation and crystal deposition (Crespo, 2024). The kidney is a major target organ of GAstV‑2, with characteristic pathological lesions including swelling, degeneration, necrosis, and shedding of renal tubular epithelial cells (Wei et al., 2023). Recent studies have confirmed that GAstV‑2 infection causes acute kidney injury (AKI), elevated serum creatinine and uric acid, renal fibrosis, apoptosis, and inflammatory responses, all of which contribute to gout pathogenesis (Bi et al., 2024). However, the precise molecular mechanisms linking GAstV‑2 infection, renal cellular stress, and gout formation remain largely undefined.

Autophagy is an evolutionarily conserved catabolic process that maintains cellular homeostasis by degrading damaged organelles and proteins (Mizushima and Komatsu, 2011). However, excessive autophagy can lead to cell death (Liu et al., 2023). Many viruses have been shown to manipulate autophagy to promote their replication (Münz et al., 2025). In the context of astrovirus infections, emerging evidence indicates that autophagy plays a significant role in viral replication and pathogenesis. For instance, porcine astrovirus (PAstV-4) infection has been shown to upregulate mitophagy and activate the ERK2 signaling pathway, thereby contributing to the disruption of intestinal mucosal function (Tao et al., 2024). Importantly, inhibition of ERK2 signaling was found to reduce PAstV-4 replication, highlighting the functional importance of this pathway in astrovirus biology. Notably, other viruses such as Seneca Valley virus (SVV) also exploit autophagic pathways to facilitate their replication and evade host immunity (Song et al., 2022, 2024; Xie et al., 2025). However, whether GAstV-2 similarly induces autophagy requiring the ERK2 signaling, and the precise role of autophagy induction during GAstV 2 infection in renal tubular epithelial cells remain unknown.

In this study, we established a primary culture model of goose renal tubular epithelial (GRTE) cells, the key target cells of GAstV‑2. We demonstrate that GAstV‑2 efficiently replicates and induces complete autophagic flux in GRTE cells. Mechanistically, GAstV-2 induces autophagy in GRTE cells requiring the ERK2 signaling pathway, and pharmacological induction of autophagy increased, whereas inhibition decreased, viral replication, consistent with a pro-viral function of autophagy. Collectively, our findings reveal a novel mechanism of GAstV‑2 pathogenesis and provide potential targets for developing antiviral strategies against this emerging goose pathogen.

Materials and methods

Cells, Virus, and Drugs

Primary GRTE cells were isolated from 5-day-old Zhedong goslings (Shandong Province, China). Kidney tissues were minced, homogenized, and filtered through D-Hanks solution containing 4% penicillin-streptomycin. The filtrate was digested with 0.1% collagenase I at 37°C for 30 min, filtered through sterile gauze, and centrifuged at 400 × g for 8 min. Cells were washed three times and cultured in DMEM/F12 supplemented with 5% fetal bovine serum and 100 U/mL penicillin at 37°C with 5% CO₂. Cells were identified by alkaline phosphatase (ALP) staining using a BCIP/NBT Alkaline Phosphatase Color Development Kit (Beyotime Biotechnology). Cells were used within passages 2 to 3. The GAstV-2 strain GAstV-SDPY (GenBank accession No. MH052598) was isolated in our laboratory from goslings with gout. All drugs were purchased from Sigma-Aldrich (USA).

Virus Infection and Replication Kinetics

GRTE cells were infected with GAstV-SDPY at a multiplicity of infection (MOI) of 0.5. Cell supernatants and lysates were collected at 24, 48, 72, 96, and 120 h post-infection (hpi). Viral loads were quantified by qPCR as described (Yin et al., 2020).

Indirect immunofluorescence assay

Infected GRTE cells were fixed with 4% paraformaldehyde for 10 min, washed three times with phosphate-buffered saline (PBS), and incubated with a GAstV-specific monoclonal antibody (prepared in our lab) as the primary antibody (Yang et al., 2021). After washing, cells were incubated with fluorescein isothiocyanate (FITC)-labeled goat anti-mouse IgG (CWBIO, Beijing, China). Fluorescence was visualized using a fluorescence microscope (Nikon, Tokyo, Japan).

Transmission electron microscopy

Transmission electron microscopy (TEM) was performed as described previously(Zhao et al., 2022). Briefly, harvested cells were fixed with 2.5% glutaraldehyde in 0.1 M phosphate buffer (pH 7.4) for 2 h at 4°C, post-fixed with 1% osmium tetroxide for 1 h, dehydrated through a graded ethanol series, and embedded in Epon. Ultrathin sections were stained with uranyl acetate and lead citrate, then examined under a transmission electron microscope (HT7700, Hitachi, Japan).

Quantitative real-time PCR

Total RNA was extracted using the TransGen Virus RNA Kit (TransGen Biotech, Beijing, China). RNA (1 μg) was reverse-transcribed using the Transcriptor First Strand cDNA Synthesis Kit (TransGen Biotech). qPCR was performed using a LightCycler 96 thermocycler (Roche Applied Science, USA) with primers listed in Table 1. Target gene expression was normalized to GAPDH and calculated using the 2^−ΔΔCT method. Each sample was analyzed in triplicate.

Table 1.

Primers used in this study for real-time PCR.

Primer	Accession number	Sense(5′to3’)	Product length
LC3B-F	XM_013197595	ATGCCACCGTGCTTCCTCT	192bp
LC3B-R		TGCTTCCACCCTACTTTCAGATT
ATG5-F	XM_013175657	ATGAGATAACCGAAAGGGAA	217bp
ATG5-R		GGAAGGGCTGTATTTGATG
Beclin1-F	XM_013199763	AAAAGCGTGGACAACCAGATGC	130bp
Beclin1-R		CAAGCCTGAAGTTATTTATCGTGCC
GAPDH-F	MG674174.1	TCAAGGCTGAGAATGGGAAAC	191bp
GAPDH-R		GGCGGAGATGATGACACG

Autophagy detection by fluorescent plasmid transfection

GRTE cells were transfected with pGFP-LC3 or mRFP-GFP-LC3 plasmids using Lipofectamine 2000 (Invitrogen). After 18 h, cells were infected with GAstV-2 or treated with reagents for 24 h. Finally, autophagic flux was observed using a laser scanning confocal microscope (Leica, Wetzlar, Germany).

Western blot analysis

Western blotting was performed as previously described (Ghosh et al., 2014). Primary antibodies included rabbit anti-LC3B (L8918, Sigma), rabbit anti-p62 (P0067, Abcam), rabbit anti-ERK2 (4695T), rabbit anti-pERK2 (4370T), rabbit anti-β-actin (4970T; all from Cell Signaling Technology), and anti-ORF2 (prepared in our lab). HRP-conjugated goat anti-rabbit IgG (Bioss, Beijing, China) was used as the secondary antibody. Protein bands were visualized using a ChemiDoc Touch imager (Bio-Rad) and quantified with ImageJ software.

Transfection and RNA interference

GRTE cells were cultured in 12-well plates and transfected with siRNAs (Table 2) using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer's instructions. At 24 h post-transfection, cells were infected with GAstV-2 at an MOI of 0.5 or mock-infected. Cells were harvested at 36 hpi for subsequent analyses.

Table 2.

Sequences of siRNA for ERK2.

Types	Name	Sense(5′to3’)	Antisense(5′to3’)
siRNAs	ERK2-219	CAAGCUGUUAAAGACUCAATT	UUGAGUCUUUAACAGCUUGTT
	ERK2-335	CUUCGAAUUUGCUGCUUAATT	UUAAGCAGCAAAUUCGAAGTT
	ERK2-735	CACCCUUCAAGUUUGAUAUTT	AUAUCAAACUUGAAGGGUGTT
	Negative control	UUCUCCGAACGUGUCACGUTT	ACGUGACACGUUCGGAGAATT

Statistical analysis

All experiments were repeated at least three independent times. Data are presented as mean ± standard error of the mean (SEM). Statistical comparisons between two groups were performed using two-tailed Student’s t-test. For comparisons involving three or more groups, one-way analysis of variance (ANOVA) was used, followed by Tukey’s honest significant difference (HSD) post-hoc test for multiple comparisons. Values of p < 0.05 were considered statistically significant (*p < 0.05, **p < 0.01, ***p < 0.001). All statistical analyses were conducted using SPSS 25.0 (IBM, Armonk, NY, USA), and graphs were generated with GraphPad Prism 8.3 (GraphPad Software, San Diego, CA, USA).

Results

Efficient replication of GAstV-SDPY in primary GRTE cells

To establish an in vitro model for studying GAstV-2 infection, primary GRTE cells were isolated and characterized. ALP staining showed positive staining in GRTE cells, confirming their proximal tubular epithelial identity (Fig. 1A). GAstV-SDPY efficiently infected GRTE cells, leading to pronounced cytopathic effects (CPE) at 48–72 hpi (Fig. 1B). IFA revealed specific fluorescence signals in the cytoplasm of infected cells, whereas no signal was detected in mock-infected controls (Fig. 1C). Viral titers increased significantly from 1 to 4 days post-infection (dpi) (Fig. 1D). These results indicate that GAstV-SDPY can effectively replicate in primary GRTE cells.

Fig. 1.

Replication of GAstV-SDPY in primary GRTE cells. (A) Alkaline phosphatase staining of GRTE cells: (a) positive staining; (b) negative control. (B) Morphology of GRTE cells at 48 hpi (a) and 72 hpi (b) with GAstV-SDPY (MOI = 0.5); (c, d) mock-infected controls. (C) IFA detection of GAstV-SDPY in GRTE cells: (a) infected; (b) mock-infected. (D) Growth curve of GAstV-SDPY in GRTE cells. Cells were infected at an MOI of 0.5, and viral genome copies in the supernatant were quantified by qPCR using a standard curve. Results are expressed as log₁₀ genome copies/mL (mean ± SEM, n = 3).

GAstV-2 infection induces ultrastructural changes and autophagy in GRTE cells

TEM was used to examine ultrastructural changes in GRTE cells at 48 hpi. Infected cells exhibited nuclear envelope rupture, swollen mitochondria, and disrupted mitochondrial cristae. Notably, autophagosomes and autolysosomes were observed in infected cells, whereas these structures were rarely seen in uninfected controls (Fig. 2). These findings suggest that GAstV-2 infection induces autophagy in GRTE cells.

Fig. 2.

Ultrastructural changes in GRTE cells infected with GAstV-SDPY at 48 hpi. (A–B) Autophagosomes (red arrows) and autolysosomes (black arrows) were observed in infected cells. (a–b) Normal ultrastructure of mock-infected GRTE cells.

GAstV-2 induces complete autophagic flux in GRTE cells

To further investigate whether GAstV-2 induces autophagy, GRTE cells were infected with GAstV-SDPY, and the expression of autophagy-related genes and proteins was analyzed. qPCR results showed that the mRNA levels of LC3B, Beclin1, and ATG5 were significantly upregulated in infected cells (Fig. 3A). Western blot analysis revealed a marked increase in LC3-II expression and a decrease in p62 expression at 24 and 48 hpi (Fig. 3B), indicating autophagic flux.

Fig. 3.

GAstV-2 induces complete autophagic flux in GRTE cells. (A) mRNA expression levels of LC3B, ATG5, and Beclin1 at 24, 36, and 48 hpi measured by qRT-PCR.(B) Protein expression levels of LC3-II and p62 at 24 and 48 hpi determined by western blot.(C) GRTE cells transfected with pGFP-LC3 and then infected with GAstV-2 (MOI = 0.5) for 24 h. GFP-LC3 puncta were observed by confocal microscopy.(D) GRTE cells transfected with mRFP-GFP-LC3 and then infected with GAstV-2 (MOI = 0.5) for 24 h. Autophagosomes (yellow puncta) and autolysosomes (red-only puncta) were visualized by confocal microscopy.

To visualize autophagosome formation, GRTE cells were transfected with pGFP-LC3 and then infected with GAstV-2. Confocal microscopy showed a punctate distribution of GFP-LC3 in infected cells, whereas a diffuse pattern was observed in uninfected cells (Fig. 3C). To confirm autophagic flux, cells were transfected with mRFP-GFP-LC3 and infected with GAstV-2. An increase in red-only puncta (autolysosomes) was observed in infected cells compared to controls (Fig. 3D), confirming that GAstV-2 induces complete autophagic flux.

GAstV-2 induces autophagy requiring the ERK2 signaling pathway

To elucidate the signaling pathway involved, we assessed ERK2 phosphorylation in infected GRTE cells. GAstV-2 infection significantly increased the phosphorylation levels of ERK2 (Thr202/Tyr204) (Fig. 4A). Time-course analysis revealed that p-ERK2 levels increased as early as 12 hpi, preceding the rise in LC3-II at 24 hpi (data not shown). To determine whether ERK2 activation is required for GAstV-2-induced autophagy, cells were treated with the ERK2 pathway inhibitor U0126 or transfected with ERK2-specific siRNA prior to infection. Both U0126 treatment and ERK2 knockdown significantly reduced the GAstV-2-induced increase in LC3-II expression (Fig. 4B and D). These results indicate that GAstV-2-induced autophagy requires the ERK2 signaling pathway.

Fig. 4.

GAstV-2 induces autophagy via the ERK2 signaling pathway. (A) GRTE cells were infected with GAstV-2 (MOI = 0.5) for 24 h. Phosphorylated ERK2 (p-ERK2) and total ERK2 levels were assessed by western blot.(B) GRTE cells were pretreated with U0126 (20 μM) for 2 h and then infected with GAstV-2 for 36 h. LC3-II expression was analyzed by western blot.(C) Screening of siRNA knockdown efficiency. (D) GRTE cells were transfected with ERK2-specific siRNA (siRNA735) or negative control (NC) for 24 h, followed by GAstV-2 infection for 48 h. LC3-II expression was analyzed by western blot. β-actin served as a loading control.

Pharmacological modulation of autophagy affects GAstV-2 replication

To investigate the functional role of autophagy in GAstV-2 replication, GRTE cells were treated with rapamycin (Rapa, an autophagy inducer) or 3-methyladenine (3-MA, an autophagy inhibitor) prior to infection. qPCR analysis of the culture supernatant showed that GAstV-2 genomic RNA levels were significantly higher in Rapa-treated cells and lower in 3-MA-treated cells compared to controls at 24, 48, and 72 hpi (Fig. 5A). Consistent with this, Western blot analysis revealed that ORF2 protein expression was enhanced by Rapa treatment and reduced by 3-MA treatment (Fig. 5B). The opposite effects of two pharmacologically unrelated agents support a pro-viral role of autophagy in GAstV-2 replication.

Fig. 5.

Pharmacological modulation of autophagy affects GAstV-2 replication. (A) GRTE cells were pretreated with 3-MA (6 mM) or Rapa (2.5 μM) for 6 h, then infected with GAstV-2 (MOI = 0.5). ORF2 mRNA expression was measured by qPCR at 24, 48, and 72 hpi. (B) GRTE cells were treated as in (A) and harvested at 48 hpi. ORF2 and LC3-II protein expression were analyzed by western blot.

Discussion

Renal tubular epithelial cells are major target cells for GAstV-2 infection in goslings (Wei et al., 2023), yet the cellular responses to infection remain poorly understood. In this study, we successfully established primary GRTE cells as an in vitro model to investigate GAstV-2-induced autophagy and its underlying mechanisms. Our findings demonstrate that GAstV-2 infection induces complete autophagic flux in GRTE cells requiring the ERK2 signaling pathway, and pharmacological induction of autophagy increased, whereas inhibition decreased, viral replication, consistent with a pro-viral role of autophagy.

The establishment of a primary GRTE cell culture system was critical for this study. Proximal renal tubular epithelial cells are characterized by high ALP activity, and BCIP/NBT staining confirmed the identity and purity of the isolated cells (Rodig, 2019).GAstV-2 efficiently replicated in these cells, inducing CPE within 48–72 hpi, making this a suitable model for mechanistic studies. Autophagy is a double-edged sword in viral infections; it can either restrict or promote viral replication depending on the context (Choi et al., 2018). Our results showed that GAstV-2 infection induced a complete autophagic flux, as evidenced by increased LC3-II expression, decreased p62 expression, and the formation of autophagosomes and autolysosomes. Importantly, pharmacological modulation of autophagy revealed that rapamycin (an inducer) increased, whereas 3-MA (an inhibitor) decreased, GAstV-2 replication, suggesting that the virus may exploit the autophagic machinery to enhance its propagation. In future studies, we will continue to utilize gene knockdown technology to target core autophagy genes (e.g., ATG5 or Beclin1), thereby determining whether modulating autophagic flux directly affects GAstV 2 replication.

Recent studies have begun to elucidate the interplay between GAstV-2 infection and host cellular processes. Hou et al. demonstrated that GAstV-2 infection induces apoptosis and activates the RIG-I/MDA5 and NLRP3 inflammatory pathways in goose embryonic kidney cells (Hou et al., 2024). Lu et al. reported that GAstV-2 infection triggers endoplasmic reticulum stress and subsequent apoptosis in gosling hepatocytes (Lu et al., 2025). Notably, Zhu et al. showed that the iNOS inhibitor aminoguanidine alleviated GAstV-2-induced gout by reducing autophagy-related gene expression (LC3II, ATG5, and Beclin1) in the kidney, further supporting the functional importance of autophagy in GAstV-2 pathogenesis (Zhu et al., 2024).

Our results demonstrated that GAstV-2 infection induces autophagy requiring the ERK2 signaling pathway, as determined using the specific inhibitor U0126 and ERK2-specific siRNA. However, the precise molecular mechanisms by which activated ERK2 transmits signals to initiate autophagy in GAstV-2-infected GRTE cells remain to be fully elucidated. In the current study, we have established ERK2 as a necessary upstream signaling molecule, but we did not identify its direct downstream effectors. Based on published literature in other viral systems, several potential mechanisms merit future investigation. For example, ERK2 has been reported to directly phosphorylate Beclin1 at Thr119, thereby enhancing autophagosome formation (Zhao et al., 2018). Alternatively, ERK2 may regulate the ULK1 complex via phosphorylation of AMBRA1 or modulate the nuclear translocation of transcription factor TFEB, which drives the expression of autophagy-related genes (Settembre et al., 2011). We acknowledge that identifying the downstream targets of ERK2 in GAstV-2-induced autophagy represents an important direction for future studies.

In addition to the ERK pathway, many other signaling cascades regulate autophagy. For instance, members of the mitogen-activated protein kinase (MAPK) family, particularly p38 MAPK, have been shown to play critical roles in virus-induced autophagy regulation (Song et al., 2022). Beyond MAPK signaling, the PI3K-AKT-mTOR axis represents another well-characterized autophagic regulatory cascade (Rajendran et al., 2024). Several viruses exploit this axis to their advantage; for example, porcine reproductive and respiratory syndrome virus (PRRSV) has been demonstrated to manipulate the PI3K/Akt/mTOR pathway to modulate autophagic flux and facilitate viral replication (Yang et al., 2025). Recently, Huang et al. reported that infectious bronchitis virus (NIBV) induces incomplete autophagy in chick kidney tissues via the AMPK-TFEB signaling pathway (Huang et al., 2026). Although NIBV and GAstV-2 are distinct viruses, both target the kidney and manipulate autophagic processes. Whether these pathways contribute to GAstV-2 infection remains to be investigated in future work.

In summary, this study demonstrates that GAstV-2 induces autophagy in primary goose renal tubular epithelial cells requiring the ERK2 signaling pathway and that this autophagic response promotes viral replication. These findings enhance our understanding of the pathogenesis of GAstV-2 infection and may provide a basis for the development of novel antiviral strategies.

Author contributions

Conceived and designed the experiments: FW JY LH JD YT. performed the experiments: FW JY YY PZ LH. analyzed the data: FW JY PZ. Write the paper: FW.

Ethics statement

This study was approved by the Animal Care and Use Committee of Shandong Agricultural University (Approval Number: # SDAUA-2022-199) and performed in accordance with the “Guidelines for Experimental Animals” of the Ministry of Science and Technology (Beijing, China).

Disclosures

The authors declare that the research was conducted in the absence of any commercial or financial relationship that could be construed as a potential conflict of interest.