The effects of dietary oxyberberine supplementation on the growth performance, carcass traits, blood biochemical parameters and intestinal health in broilers

Abstract

Oxyberberine (OBB), a novel intestinal metabolite of berberine (BBR), has demonstrated anti-tumor, anti-inflammatory and antioxidant activities superior to those of BBR. Nevertheless, current studies on OBB have focused primarily on rodents, and its potential as a livestock feed additive for nutritional regulation remains largely unexplored. The present study aimed to elucidate the effect of dietary OBB on growth performance, biochemical parameters and intestinal health of broilers. A total of 300 1-d female broilers (Shengze 901+) were randomized into five treatment groups (6 pens/treatment and 10 birds/pen): basal diet group as control (Control), basal diet + 50 mg/kg BBR (BBR 50), basal diet + 25 mg/kg OBB (OBB 25), basal diet + 50 mg/kg OBB (OBB 50), basal diet + 75 mg/kg OBB (OBB 75). The feeding trial lasted for 6 weeks, dividing into an early stage (1-21 d) and a late stage (21-42 d). These findings demonstrated that supplementing with 25 mg/kg OBB dramatically improved the growth performance of broilers during the later growth phase (P < 0.05), and also apparently increased semi-eviscerated, eviscerated and breast muscle weights (P < 0.05). OBB supplementation markedly increased the activities of SOD, CAT, T-AOC and GSH-Px (P < 0.05), while also significantly decreasing serum DAO and enhancing immune function by boosting IgA, IgM, and IgG concentrations (P < 0.05). OBB supplementation markedly (P < 0.05) lowered serum UN, TC, and TG levels, as well as noticeably upregulated the expressions of tight junction proteins and augmented the number of goblet cells (P < 0.05). 16S rRNA sequencing revealed that significant enrichment of Prevotellaceae, Desulfovibrio and Bacillales in the OBB 25 group. Taken together, supplementation with OBB, especially 25 mg/kg, could improve growth performance and slaughter performance, which may be related to improving antioxidation capacity, immune function and intestinal barrier function.

Introduction

With the growing demands for poultry products, high-density intensive breeding has become both a popular and inevitable trend (Cruz et al., 2024). However, the large-scale intensive farming system triggers a series of irreversible breeding dilemmas in commercial broilers, including reduced growth performance, weakened immune function, and increased oxidative stress (Son et al., 2022). In addition, long-term abuse of prophylactic antibiotics in intensive farming has led to severe issues including drug resistance and drug residues, which poses a huge threat to food safety (Zheng et al., 2025). Therefore, exploiting safe, green, efficient natural feed alternatives to antibiotics has become an urgent and core task to balance poultry production efficiency and food safety, and maintain the sustainable development of poultry industry.

In recent decades, an increasing number of researchers have turned their attention to traditional Chinese medicine (TCM), its bioactive compounds and their main active metabolite as potential dietary additives for poultry (Liu et al., 2023). Berberine (BBR), a quaternary proto-berberine alkaloid from the root and the stem bark of Coptis chinensis, has possessed broad-spectrum biological activities closely related to antibiotic substitution including anti-inflammation, antioxidation, anti-colitis, immunomodulatory and antibacterial effects (Ai et al., 2021; Shakeri et al., 2024; Wang et al., 2024). Given its excellent biological activity, BBR has been widely applied in animal husbandry as a potential feed additive to alleviate stress injury, improve livestock and poultry health and enhance growth performance (Zhu et al., 2021; Zhu et al., 2019). However, the clinical application of BBR in animal production is severely limited by its extremely low oral bioavailability (<1%) (Khoshandam et al., 2022).

Oxyberberine (OBB) is a novel metabolite derived from the intestinal metabolite of BBR (Dou et al., 2021). Accumulating evidence have revealed that OBB has been shown to exert a diverse range of pharmacological activities, including anti-oxidation, anti-inflammation, immune modulatory activities (Dou et al., 2022; Li et al., 2025; Zhao et al., 2021). In addition to these pharmacological effects, OBB also exhibited superior intestinal protection activity to its precursor, BBR (Li et al., 2020). In addition to the aforementioned effects, OBB exhibited excellent tolerability and a favorable safety profile, with an LD₅₀ value of 5243.6 mg/kg (Li et al., 2019). More importantly, our preliminary findings have indicated that OBB exhibited excellent effect in boosting broilers growth performance, yet the molecular and physiological mechanisms underlying this improvement warrant further investigation.

Currently, most of the attention on the beneficial effects of OBB against several disorders has focused only on related studies with rats or mice. However, to date, knowledge regarding the influence of dietary supplementation of OBB in livestock and poultry remains scare. Therefore, the present study aimed to explore the effects of dietary OBB supplementation on the growth performance, carcass traits, blood biochemical parameters and intestinal health in broilers, so as to provide a theoretical basis for the development and application of OBB as a novel green alternative feed additive in broiler production.

Materials and methods

Experimental design, animals, housing and diets

A total of 300 female chickens (Shengze 901+, fast growing) at 1 day of age, with an average initial body weight of approximately 40 g, were randomized into 5 groups: Control group, BBR 50 group, OBB 25, 50 and 75 groups. Specifically, the control group was fed with a basal diet, the BBR 50 group was provided with a basal diet containing 50 mg/kg BBR, and the OBB treatment groups were fed with basal diets supplemented with 25, 50 and 75 mg/kg OBB, respectively. The dosages of OBB and BBR were selected based on our preliminary experiment and previous study (Chen et al., 2026; Li et al., 2020; Li et al., 2023). Each treatment group consisted of 6 replicate pens with 10 birds in per replicate (60 chicks per group). The basal diet was a corn-soybean meal-based diet, which was formulated in accordance with the chicken feeding standard NY/T33-2004. The basal diet nutritional level is illustrated in Table 1 (Chen et al., 2025). All broilers were allowed free access to water and diets ad libitum in a room where the temperature was manually controlled. All chickens were vaccinated and subjected to immunization in accordance with standard protocols for broilers. During the first week, the room temperature was controlled at 34 °C, lowered by 1 °C each week until reaching 25 °C at the end of the rearing period. The ambient humidity was maintained between 50 and 60% throughout the duration of the trial. The entire feeding experiment period lasted for 42 days. Animal experiments were carried out based on the guidelines for laboratory animals established by the Jiangxi Academy of Agricultural Science.

Table 1.

Composition and chemical analysis of the experimental diets (starter and finisher diets).

Items	Starter (d 1-21)	Finisher (d 21-42)
Ingredients (% w/w)
Corn	50.31	54.37
Soybean meal	34.92	30.63
Rapeseed meal	5.00	5.08
Soybean oil	5.35	5.61
L-Lysine•HCl	0.15	0.10
DL- Methionine	0.18	0.14
Threonine	0.08	0.05
Limestone	1.87	1.13
CaHPO4	0.85	1.58
Salt (NaCl)	0.30	0.30
Premix1	1.00	1.00
Total Calculated nutrient levels 2	100	100
Metabolizable energy (MJ/kg)	12.55	12.75
Crude protein (%)	21.08	19.50
Lysine (%)	1.15	1.10
Methionine (%)	0.50	0.45
Calcium (%)	0.97	0.90
Available phosphorous (%)	0.27	0.40
Methionine + Cysteine (%)	0.85	0.78

¹The premix provides the following per kg of diets: vitamin A, 12500 IU; vitamin D, 2500 IU; vitamin E, 25 mg; vitamin K3, 3 mg; vitamin B1, 3 mg; vitamin B2, 8 mg; vitamin B6, 7 mg; vitamin B12, 0.03 mg; D-pantothenic acid, 20 mg; nicotinic acid, 50 mg; biotin, 0.1 mg; folic acid, 1.5 mg; Fe, 100 mg; Cu, 100 mg; Mn, 100 mg; Zn, 100 mg; I, 0.6 mg; Se, 0.16 mg.

²Calculated according to NRC (1994).

Sample collection

At 42 days of age, following 12 h of overnight fasting, two birds were randomly selected from each replicate based on their average body weight. Subsequently, blood samples were harvested from wing veins using non-anticoagulant tubes, which were then left standing at room temperature for 3 h before centrifugation (3000 g, 10 min). After centrifugation, the supernatant was harvested and kept at −80 °C for subsequent experiments. After blood collection, these broilers were sacrificed with intraperitoneal injections of sodium pentobarbital followed by cervical dislocation. Once sacrificed, the liver and intestine were promptly withdrawn from the broilers and washed gently three times with PBS. Afterward, the specimens were cut into two parts: one was placed into 10% paraformaldehyde (PFA) overnight and subsequently subjected to histological morphology and the remaining one was snap-frozen in liquid nitrogen and kept at −80 °C until analysis. Finally, cecum contents were harvested for subsequent microbiological analysis.

Growth performance and carcass evaluation

After a 12-hour overnight fast, all broilers in each replicate cage were weighed individually on day 42. Meanwhile, feed intake was recorded per replicate on day 42 to determine average daily feed intake (ADFI), the average daily gain (ADG) and feed-to-gain ratios (F/G).

All birds were fasted over night before the termination of the experiment. Subsequently, twelve birds per treatment (2 chickens per replicate/pen) with body weight (BW) near the replicate average were chosen, following which they were slaughtered by jugular vein exsanguination. The defeathered carcass, including the head and feet, was weighed as the carcass weight. After the removal of the head, feet, neck, and abdominal fat, the semi-eviscerated carcass, eviscerated carcass, breast muscle, leg muscle and abdominal fat were weighed, respectively. In addition, the liver, heart, spleen, lung, thymus and Bursa of Fabricius were harvested for weighing to calculate the organ coefficient. The organ coefficient was calculated as the following formula: organ index = organ weight (g)/live weight before slaughter (kg).

Measurement of the immunological parameters

The immunological related parameters were determined as described by Zhang et al (Zhang et al., 2026). The levels of serum IgA, IgG and IgM were determined with corresponding ELISA kits (Shanghai Enzyme-linked Biotechnology Co., Ltd., Shanghai, China) according to the manufacturer’s protocols.

Antioxidant status measurement

The oxidation-stress related indicators were analyzed as described previously (Nie et al., 2025). The activities of SOD, CAT, T-AOC and GSH-Px in serum samples were assayed with commercially available kits from Nanjing Jiancheng Bioengineering Institute (Nanjing, China) following the manufacturer’s recommendations.

Measurement of serum biochemical parameters

The biochemical parameters were measured as described by Yuan et al (Yuan et al., 2023). The harvested serum was used to measure the activities of alanine transaminase (ALT), aspartate transaminase (AST), alkaline phosphatase (ALP), albumin (ALB), urea nitrogen (UN), triglyceride (TG) and total cholesterol (TC) using the corresponding kits from Nanjing Jiancheng Bioengineering Institute (Nanjing, China) in accordance with the manufacturer’s instructions.

Histological examination

The liver and jejunum were subjected to 10% paraformaldehyde (PFA) fixation for at least 24 h. After post-fixation, tissues were dehydrated in graded ethanol, cleared with xylene, infiltrated with paraffin, and cut into 5 μm sections with microtome (Leica RM2016, Germany). Then, these slices were subjected to hematoxylin and eosin (H&E) staining and images were captured using an Olympus BX53 light microscope. Finally, the villus heights and crypt depths of the jejunum were measured using an Image-Pro Plus software (American, Media Cybernetics).

Measurement of intestinal permeability

To further assess the effects of different treatments on the intestinal permeability of broilers, serum D-LA and DAO concentrations were measured by ELISA kits (Shanghai Enzyme-linked Biotechnology Co., Ltd., Shanghai, China) and all experimental steps were carried out following the protocols described previously (Yin et al., 2023).

Immunohistochemical staining

Immunohistochemical staining was performed following the established protocols. Briefly, the paraffin-embedded tissue sections were dewaxed in xylene and rehydrated in a series of descending graded ethanol series. Subsequently, the sections were treated with a freshly prepared 3% H₂O₂ to quench endogenous peroxidase activity, followed by incubation with 10% goat serum in PBS for 30 mins. After blocking, these sections were then incubated overnight at 4 °C with the primary antibody against ZO-1, MUC-2 and Occludin (all diluted 1:200), followed by incubation with corresponding secondary antibodies for 1h at room temperature. Sequentially, sections were developed using 3,3’-diaminobenzidine (DAB) for 7 mins and counterstained with hematoxylin for 2 mins. Finally, the images were imaged using an Olympus BX 53 microscope (Olympus, Tokyo, Japan).

RNA isolation and real-time quantitative polymerase chain reaction (qRT-PCR)

Total RNA from jejunum samples were prepared with TRIzol Reagent RNA extraction kit (Invitrogen). The concentration and purity of the RNA were measured with a Nano-Drop 2000 spectrophotometer (Thermo Fisher). Afterward, purified RNA samples were converted to cDNA using a HiScript® II Q RT SuperMix (Vazyme, R223-01). Quantitative real-time PCR (qRT-PCR) was performed on the obtained cDNA using ChamQ Universal SYBR qPCR Master Mix (Vazyme, Q711-02) on an ABI QuantStudio 7 real-time PCR system (Applied Biosystems). PCR amplification was performed under the following cycling conditions: a hot-start activation at 95 °C for 30 s, followed by 40 cycles of 10 s of denaturation at 95 °C, and 30 s of annealing at 60 °C. The relative mRNA levels of target genes were normalized to GAPDH mRNA and expressed using the 2 ^−ΔΔCt method. The sequences of primers used for qRT-PCR are listed in Table 2.

Table 2.

Sequences of real-time PCR primers.

Gene		Gene sequence
β-actin	Forward	TGTTACCAACACCCACACCC
	Reverse	TCCTGAGTCAAGCGCCAAAA
ZO-1	Forward	CTTCAGGTGTTTCTCTTCCTCCTC
	Reverse	CTGTGGTTTCATGGCTGGATC
IL-1β	Forward	GTACCGAGTACAACCCCTGC
	Reverse	AGCAACGGGACGGTAATGAA
MUC-2	Forward	GTGCCAGCAAACTTGTCGTTCC
	Reverse	CAGCCACAGCCATCCACAGG
IFN-γ	Forward	ACGACACCATCCTGGACACC
	Reverse	TTTGGCGTTGGCTGTCGTTC
IL-10	Forward	CGCTGTCACCGCTTCTTCA
	Reverse	TCCCGTTCTCATCCATCTTCTC
Occludin	Forward	GCTGAGATGGACAGCATCAA
	Reverse	CCTCTGCCACATCCTGGTAT

DNA extraction and 16 rRNA sequencing for fecal microbial community

Total genomic DNA of each fecal sample was extracted with Soil DNA Kit (Omega Biotek, Norcross, GA, USA) according to the supplier’s instructions. Amplification of the V3-V4 region of the 16S rRNA was performed, using primers 338F/806R with the forward primer barcoded. The PCR products were separated on 2% agarose by gel electrophoresis, followed by extraction using AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA). The TruSeq DNA PCR-Free library preparation kit (Illumina, San Diego, CA, USA) was used for library preparation according to the manufacturer’s recommendations. Subsequently, library concentration was quantified with Qubit 2.0 Fluorometer and its quality was analyzed using Agilent 2100 Bioanalyzer system. Finally, Illumina sequencing libraries were constructed according to the manufacturer’s protocols and sequenced using an Illumina Nextseq 2000 platform (Illumina, San Diego, USA) and 300 bp paired-end reads were generated.

Statistical analysis

In the research, each pen served as an experimental unit and all experimental data were analyzed using a completely randomized design (CRD). Growth performance, slaughter performance, biochemical parameters, intestinal morphology, immunohistochemistry and gene expressions data were first checked for normal distribution with the Shapiro-Wilk test and for homogeneity of variances using Levene’s test. For comparison of multiple groups, the statistical significance of endpoints was performed by one-way ANOVA followed by Tukey’s honest significant difference post hoc test when the data was normally distributed with equal variance. Results were manifested as means ± standard deviation (SD). All statistical analyses were performed with SPSS statistical software (version 23.0, IBM). Difference was statistically significant for P-value less than 0.05, whereas a P-value less than 0.01 was designated highly significant. Plots were created with GraphPad Prism software.

Results

Growth performance

The influence of OBB addition on BW, ADG, ADFI and F/G of broiler chicks at different periods is illustrated in Table 3. From 1 to 21 days, in comparison to the control group, there are no appreciable differences observed in BW, ADG, ADFI and F/G among the groups (P > 0.05). However, from 1 to 42 days, supplementing with 25 mg/kg OBB markedly elevated ADG and BW (P < 0.05), but the change in F/G and ADFI were not substantial (P > 0.05). Although no statistically significant variations were observed in F/G and ADFI (P > 0.05), a downward trend in F/G was noted.

Table 3.

Effect of BBR and OBB supplementation on growth performance of broilers (Day 1-42).

Time	Item1	Diets					SEM	P
		Control	BBR50	OBB25	OBB50	OBB 75
Day 1	BW/g	42.12	42.07	42.32	42.20	42.08	0.39	0.246
Day 21		849.31	834.53	825.37	866.67	852.77	6.16	0.244
Day 42		2141.14b	2253.59ab	2359.27a	2207.38ab	2127.73b	27.76	0.042
Day 1-21	ADG/(g/d)	38.31	37.74	37.75	39.34	38.60	0.28	0.344
Day 1-42		49.81b	52.58ab	55.03a	51.45ab	49.58b	0.66	0.044
Day 1-21	ADFI/(g/d)	53.10	52.37	50.13	53.47	51.27	0.54	0.324
Day 1-42		97.91	95.53	96.86	95.31	93.12	0.78	0.376
Day 1-21	F/G	1.39	1.39	1.33	1.36	1.33	0.01	0.108
Day 1-42		1.97	1.82	1.77	1.86	1.88	0.03	0.361

^a-c Mean values in the same row that do not share a common letter differ significantly (P < 0.05), n = 6.

Serum biochemical parameters

Blood serum biochemical profiles reflect the overall health and nutritional status of broilers. As illustrated in Table 4, the serum levels of ALT, AST, ALP and ALB exhibited no significant variations among the groups (P > 0.05). However, dietary supplementation with OBB (25 mg/kg) substantially lowered the serum UN, TC and TG levels (P < 0.05). Notably, although no significant differences were detected between OBB 25 group and BBR 50 group in modulating TG, TC and UN levels (P > 0.05), supplementation with 25 mg/kg OBB showed a tendency to decrease these parameters.

Table 4.

Effect of OBB supplementation on biochemical indicators of broilers.

Items1	Diets					SEM	P
	Control	BBR50	OBB25	OBB50	OBB 75
ALT, U/L	44.73	40.38	43.21	41.84	41.12	0.78	0.430
AST, U/L	210.15	203.70	207.23	213.87	205.24	2.83	0.812
TG, mmol/L	0.52a	0.41b	0.40b	0.47ab	0.49ab	0.01	0.033
ALB, g/L	29.93	30.28	29.44	29.78	30.70	0.53	0.960
UN, mmol/L	3.09a	2.64b	2.40b	3.03a	2.45b	0.07	0.000
TC, mmol/L	3.68a	3.19ab	2.88b	2.93b	3.17ab	0.08	0.016
ALP, U/L	1070.93	1052.58	1037.17	1048.33	1068.55	15.01	0.954

^a-c Mean values in the same row that do not share a common letter differ significantly (P < 0.05), n = 12.

Carcass measurements

Results concerning the effects of different experimental treatments on carcass traits in broiler chickens are displayed in Table 5. Dietary supplementation with 25 mg/kg OBB apparently increased semi-eviscerated, eviscerated and breast muscle weights (P < 0.05), whereas 50 mg/kg BBR dramatically enhanced slaughter weight compared with the control group (P < 0.05). Moreover, the overall improvement with 25 mg/kg OBB exceeded that achieved with 50 mg/kg BBR. However, when compared with the control group, OBB inclusion at 50 and 75 mg/kg did not affect slaughter weight, semi-eviscerated, eviscerated and breast muscle weights (P > 0.05), although a dose-dependent decreasing trend was observed. Additionally, there was no variation in leg muscle weight and abdominal fat weight among the groups (P > 0.05).

Table 5.

Effect supplementation of BBR and OBB on carcass quality of broilers.

Items1	Diets					SEM	P
	Control	BBR50	OBB25	OBB50	OBB 75
Slaughter weight (g)	1995.65bc	2112.48a	2103.29ab	1998.38bc	1938.50c	18.50	0.006
Semi-eviscerated weight (g)	1850.31bc	1938.73ab	1969.36a	1862.15abc	1809.56c	17.53	0.018
Eviscerated weight (g)	1607.82bc	1699.12ab	1716.24a	1622.83abc	1573.98c	16.04	0.017
Breast muscle (g)	228.72c	253.12ab	262.34a	245.17abc	236.03bc	3.35	0.010
Leg muscle (g)	166.45	177.29	174.19	166.40	160.60	0.06	0.290
Abdominal fat (g)	29.72	29.47	34.22	29.82	29.72	0.87	0.322

^a-c Mean values in the same row that do not share a common letter differ significantly (P < 0.05), n = 12.

Organ weight

The results of the effects of OBB addition on the organ weight in broilers are shown Table 6. No significant variation was found for liver, lung and heart indexes across all groups (P > 0.05), suggesting no potential toxic effect of OBB supplementation on liver, lung and heart. Additionally, there were no significant variation in thymus and Bursa of Fabricius indexes among the groups (P>0.05).

Table 6.

Effect of BBR and OBB supplementation on organ indexes of broilers.

Items1	Diets					SEM	P
	Control	BBR50	OBB25	OBB50	OBB 75
Liver (g/kg)	1.90	1.81	1.86	1.88	1.92	0.03	0.831
Bursa of Fabricius (g/kg)	0.14	0.15	0.14	0.15	0.14	0.00	0.991
Thymus (g/kg)	0.29	0.32	0.27	0.29	0.23	0.01	0.340
Heart (g/kg)	0.47	0.43	0.43	0.49	0.47	0.11	0.308
Spleen (g/kg)	0.0946bc	0.0888c	0.1271a	0.1135ab	0.1087abc	0.00	0.002
Lung (g/kg)	0.50	0.52	0.47	0.45	0.47	0.12	0.355

^a-c Mean values in the same row that do not share a common letter differ significantly (P < 0.05), n = 12.

Immunological parameters

As presented in Table 7, serum levels of IgM, IgG and IgA were noticeably raised after OBB interventions (P < 0.05), with OBB 25 group showing the highest level, reflecting an improvement in immune function. Additionally, in comparison to BBR 50 group, dietary supplementation with 25 mg/kg OBB exhibited an upward trend in IgA and IgM, although none of these differences were statistically significant (P > 0.05).

Table 7.

Effect of OBB supplementation on immunity of broilers.

Items1	Diets					SEM	P
	Control	BBR50	OBB25	OBB50	OBB 75
IgA (μg/mL)	49.86b	55.20ab	61.41a	59.53a	52.20b	1.26	0.009
IgM (μg/mL)	121.49c	139.87ab	155.19a	153.38a	129.79bc	3.24	0.002
IgG (μg/mL)	381.71c	448.67b	499.56a	483.75a	446.95b	7.37	0.000

^a-c Mean values in the same row that do not share a common letter differ significantly (P < 0.05), n = 6.

Antioxidant indices

The effect of dietary administration with BBR and OBB on antioxidation capacity was presented in Table 8. Supplementing 25 mg/kg and 50 mg/kg OBB dramatically elevated serum SOD and CAT activities relative to the control group (P < 0.05). Additionally, in contrast to the BBR 50 group, the addition of 25 mg/kg OBB showed a tendency toward higher SOD and CAT activities, although the differences were not statistically significant (P > 0.05). Furthermore, all treatment groups showed higher GSH-Px and T-AOC activities than the control group. However, statistical significance was achieved for GSH-Px only in the OBB 25 group, and for T-AOC in the OBB 25 and 50 groups (P < 0.05). Moreover, despite the absence of significant differences between the groups, the OBB 25 group showed a tendency for higher GSH-Px and T-AOC activities than the BBR 50 group.

Table 8.

Effect of OBB supplementation on antioxidant parameters of broiler chickens.

Items1	Diets					SEM	P
	Control	BBR50	OBB25	OBB50	OBB 75
SOD (U/mL)	55.45b	100.22ab	147.52a	122.44a	57.85b	9.35	0.001
CAT (nmol/min/mL)	74.82c	104.81abc	141.07a	126.53ab	92.26bc	6.88	0.009
T-AOC (μmol Trolox/mL)	0.96c	1.06bc	1.23a	1.15ab	0.94c	0.03	0.000
GSH-Px (nmol /min/mL)	104.63b	116.36b	176.52a	150.26ab	120.96b	8.48	0.026

^a-c Mean values in the same row that do not share a common letter differ significantly (P < 0.05), n = 6.

Hepatic morphology

Histological analyses of liver sections (H&E staining) were presented in Fig. 1. The livers from the Control group displayed normal histology, with hepatocytes uniformly organized in cords around the central vein. Moreover, no signs of inflammatory cell infiltration or other pathological lesions were observed, indicating the structural integrity of the liver. In parallel to normal liver tissue, dietary supplementation with BBR and different dosages of OBB did not induce any visible morphological changes in hepatocytes.

Fig. 1.

Hepatic morphology in broilers supplemented with OBB based on hematoxylin and eosin staining observed under 200 x magnification.

Intestinal permeability indices

As shown in Table 9, the level of DAO in the serum in the OBB and BBR groups was distinctively diminished compared with the control group, especially in the group treated with 25 mg/kg OBB (P < 0.05). However, dietary supplementation with OBB tended to lower serum D-LA level relative to the control group, although no statistically significant differences were found among groups (P > 0.05).

Table 9.

Effect of BBR and OBB supplementation on serum diamine oxidase (DAO) and D-lactic acid (D-LA) level in broilers.

Items1	Diets					SEM	P
	Control	BBR50	OBB25	OBB50	OBB 75
DAO (U/mL)	15.00a	11.86b	10.19c	13.32ab	13.68ab	0.38	0.000
D-LA (μmol /mL)	124.96	121.33	116.53	118.34	111.50	2.25	0.407

^a-c Mean values in the same row that do not share a common letter differ significantly (P < 0.05), n = 12.

Intestinal histomorphology

The effect of dietary treatment on intestinal morphology was presented in Fig. 2 and Table 10. The average villus height, crypt depth, their ratio and length of villous epithelium were similar for all treatments, with no statistically significant differences observed (P > 0.05). Although the difference was not statistically significant, dietary supplementation with OBB (25 mg/kg) exhibited an upward trend. In addition, supplementation with OBB and BBR dramatically increased jejunum goblet cell numbers in broilers, with the greatest enhancement observed at 25 mg/kg OBB (P < 0.05).

Fig. 2.

Effects of dietary OBB supplementation on jejunal morphology structure of broilers (H&E staining, 200 x magnification).

Table 10.

Effect of OBB supplementation on jejunum villus (μm), crypt depth (μm), villus height to crypt depth ratio, the number of goblet cells, length of villous epithelium of broiler chickens.

Items1	Diets					SEM	P
	Control	BBR50	OBB25	OBB50	OBB 75
VH, μm	1345.56	1502.46	1554.49	1646.12	1433.16	56.25	0.573
CD, μm	222.00	214.60	241.54	205.45	228.39	9.82	0.839
VH/CD	6.45	6.96	6.88	8.08	6.45	0.31	0.485
Number of goblet cells	31.36b	47.80ab	66.97a	46.30ab	44.67ab	3.65	0.037
Length of villous epithelium	0.48	0.47	0.47	0.46	0.48	0.01	0.979

^a-c Mean values in the same row that do not share a common letter differ significantly (P < 0.05), n = 6.

Immunohistochemical analysis

As illustrated in Fig. 3, immunohistochemical staining results revealed that ZO-1 and Occludin expression levels were dramatically raised after dietary supplementation with OBB (25 mg/kg) compared with the control group (P < 0.05). However, no significant variation was observed in MUC-2 expression level after dietary supplementation with OBB (P > 0.05).

Fig. 3.

Effects of OBB supplementation on the expressions of Occuldin, MUC-2 and ZO-1 with immunohistochemistry method (n = 6). (A, C and E) The representative images of immunohistochemistry of Occuldin, MUC-2 and ZO-1 on the jejunal. Statistical analysis of (B) Occuldin, (D) MUC-2 and (F) ZO-1.

Intestinal barrier function and inflammation-related genes anlysis

As depicted in Fig. 4, the mRNA expression levels of ZO-1and Occludin were observably higher in the OBB (25, 50 and 75 mg/kg) groups than those in the control group (P < 0.05). Moreover, relative to the control group, treatment with OBB (25 and 50 mg/kg) substantially boosted jejunum mRNA level of IL-10 and lowered that of IL-1β (P < 0.05). Furthermore, there was no significant difference in the mRNA expression level of IFN-γ among these groups (P > 0.05).

Fig. 4.

Effects of BBR and OBB supplementation on inflammation and tight junction proteins-related gene expression in broiler (n = 6). (A) IFN-γ; (B) Occludin; (C) IL-10; (D) MUC-2; (E) IL-1β; (F) ZO-1.

Analysis of the cecal microbiota community by 16s rRNA sequencing

Data analyses of microbiota diversity and community profiles in cecal digesta are shown in Fig. 5A–C, Venn diagram analysis revealed that the control and OBB 25 group shared 162 core OTUs. In contrast, the OBB 25 group contained 18 unique OTUs, while the control group had 9. PCA revealed a distinct separation in microbial communities between the control and OBB 25 group, which was further corroborated by PLS-DA, indicating that the two communities are distinctly different. Moreover, Fig. 5D-H showed that Ace, Chao, Shannon, Simpson and Sobs indices were not significantly different between the control and OBB 25 group (P > 0.05).

Fig. 5.

Effect of OBB supplementation on cecal microbiota diversity of broilers (n = 6). (A) Venn diagram of OTUs level. (B) Principal component analysis (PCA) scores plot of the samples. (C) Partial least squares discriminant analysis (PLS-DA) scores plot of the samples. (D) Ace. (E) Chao. (F) Shannon. (G) Simpson and (H) Sobs.

As shown in Fig. 6, Bacteroidota and Firmicutes were the dominant phyla, jointly accounting for more than 55% of the total microbial abundance. At the family level, Bacteroidaceae dominated in both control and OBB 25 groups, with relative abundances of 27.32% and 40.55%, respectively. At the genus level, Bacteroides and Alistipes were the predominant genera in the two groups, occupying 41.27% and 48.71% correspondingly. LEfSe analysis further indicated that dietary OBB supplementation notably enriched multiple characteristic bacterial taxa in broilers, such as Prevotellaceae, Desulfovibrio, Bacillales and other differential microbes.

Fig. 6.

Effect of OBB supplementation on cecal microbial composition of broilers (n = 6). (A) Phylum level. (B) Family level. (C) Genus levels. (D) LDA distribution histogram (LDA > 2.0).

Discussion

Recently, with the implementation of strict regulations and bans on antibiotics use in livestock production, an increasing number of researchers have been increasingly turning their attention to the natural plant products or derivatives of natural products. BBR, a natural plant alkaloid originating from Berberis aristate and Coptis chinensis (Huanglian in Chinese), has been reported to possess a wide range of biological activities, ranging from antimicrobial and anti-inflammatory to antioxidant effects (Paudel et al., 2022; Pavlova et al., 2022; Wang et al., 2024). Due to its derivation from natural sources and beneficial pharmacological properties, BBR has been extensively applied to livestock production (Zhu et al., 2021; Zhu et al., 2019). However, the utilization of BBR in livestock production was still restricted due to its low bioavailability and poor solubility. the latest research revealed that BBR could undergo an oxidation reaction mediated by the intestinal microflora, transforming into a novel metabolite (OBB) (Li et al., 2020).

Interestingly, compared with the active ingredient BBR, OBB not only exhibited a more favorable safety profile, but also exerted superior biological properties, such as enhanced anti-inflammation and anti-oxidation effects (Chi et al., 1996; Li et al., 2023). When BBR was oxidized to OBB, the C-8 quaternary ammonium group was transformed into a more lipophilic and active lactam ring, which facilitated its passage across biological membranes and consequently enhanced its bioactivity (Li et al., 2020). Given that excessive inflammation and oxidative stress severely restrict growth and impair physiological health in broilers. We therefore hypothesize that OBB with superior anti-stress and anti-inflammation effects can exert favorable effects on growth performance and general health status of broilers, which deserves further systemic investigation.

Growth performance is the most direct and reliable indicator of broilers’ overall growth status, as it provides an immediate and accurate reflection of their development progress (Liu et al., 2021). Results from Kikusato et al indicated that supplementation with plant-derived isoquinoline alkaloids significantly alleviated the decrease in body weight gain induced by heat stress (Kikusato et al., 2021). In addition, Zhu also reported dietary supplementation with BBR (the prodrug of OBB) could increase final BW, ADG and ADFI in Arbor Acres broilers during the finisher period under high stocking density (Zhang et al., 2013). In line with these studies, our investigation indicated that the addition of OBB (25 mg/kg) to the diet resulted in superior growth performance among all treatments. The enhancement in growth performance may be attributed to its ability to improve immune function, antioxidant capacity and intestinal barrier function, along with a positive effect on appetite regulation, thus resulting in more efficient feed conversion. Interestingly, however, body weight exhibited a declining trend with increasing OBB dosage. This phenomenon might be attributed to deterioration of feed palatability caused by the intensified bitterness of the additive as its concentration increases, which further results in inadequate nutrition and subpar growth performance. Taken together, these results revealed that supplementing with 25 mg/kg OBB could effectively promote the growth performance of broilers.

In livestock production, slaughter performance, an essential reference index, is commonly used to evaluate the meat production efficiency in livestock and poultry. It can not only directly reveal the proportions of different tissue parts relative to the whole, but also demonstrate the disparities in nutrient deposition with them. In the present study, the inclusion of 25 mg/kg OBB in the diet markedly augmented semi-eviscerated, eviscerated and breast muscle weights. However, these parameters, along with growth performance, showed a decreasing trend with further increases in OBB dosage, likely due to deteriorating palatability. These results aligned with Xu et al who reported that adding 200 mg/kg areca nut extracts could markedly increase the average body weight and slaughter rate of 49-day-old broilers. (Xu et al., 2025). Additionally, the addition of isoquinoline alkaloid (sanguinarine) could dramatically increase carcass yield of feedlot bulls (Michels et al., 2018). These findings demonstrated that 25 mg/kg OBB exhibited a positive effect on improving the carcass traits of broilers, indicating its potential application as an effective feed additive.

Visceral organs serve as the cornerstone of life activities in poultry and livestock, whose development has a direct impact on their health status (Tong et al., 2022). In particular, well-developed and mature visceral and immune organs are fundamental to facilitating the rapid growth and enhancing the immunity of broilers. Our studies revealed that the addition of OBB to the diets has no effect on lung index, liver index, heart index, thymus index and Bursa of Fabricius index. However, dietary supplementation with OBB, especially 25 mg/kg, obviously increased spleen index, indicating an improvement in immune function. Similarly, comparable effects were observed in broilers when the diet was supplemented with 10 g/kg lotus leaf extract (Cheng et al., 2021). In addition, Amevor also reported that quercetin, in combination with vitamin E conspicuously elevated spleen weight (Amevor et al., 2021). These results demonstrated that dietary inclusion of OBB was beneficial for both the adaptive and innate immune responses.

The immune status of a flock is an indispensable factor in poultry production, acting as the first line of defense against endogenous and exogenous pathogens, including bacteria, viruses, fungi and other harmful microorganisms (Xu et al., 2021). When broilers were challenged by prolonged external stimuli, their immune system was susceptible to be weakened (Bilal et al., 2021). Accumulating evidence suggests that alkaloid-containing plants and TCM have a positive effect on regulating immunity. For example, Paper Mulberry leaf extract and alkaloid-rich TCM formula have been shown to enhance immune function in animals (Chen et al., 2020; Jiang et al., 2022). Our results are congruent with previous studies, indicating that dietary supplementation with OBB considerably boosted the serum IgG, IgM and IgA levels. Notably, 25 mg/kg OBB yielded the greatest improvement, surpassing the effects observed with 50 mg/kg BBR. Furthermore, dietary OBB supplementation could lower jejunum IL-1β mRNA expression while raising that of IL-10. These results indicated that supplementing the diet with OBB improved immune status of the broilers.

Blood biochemical parameters are frequently used to reflect an animal’s nutritional metabolic status and overall health (Kokore et al., 2021). In this experiment, dietary supplementation with OBB significantly lowered the serum TC, TG and UN levels, while elevating the levels of SOD, T-AOC, GSH-Px and CAT. Intriguingly, these parameters exhibited downward trend as the dosage increased. This may be attributed to the fact that persistently high Nrf2 activation might trigger its negative feedback regulators, which in turn suppress the transcription of antioxidant enzyme genes and diminish overall antioxidant status. Similar to our present study, Liu reported that the significant increases in TC and TG levels caused by a high-fat diet were attenuated after administration of Ramulus Mori (Sangzhi) Alkaloids (Chen et al., 2022). Furthermore, Li reported that supplementing the high-concentrated diet with Sophora alopecuroides alkaloids could enhance antioxidant functions in lambs, increasing both SOD and T-AOC levels (Li et al., 2025). Ye stated that supplementing the diets with Gelsemium elegans alkaloids could enhance antioxidant capacity of Megalobrama amblycephala, as reflected by significantly higher Cu/Zn-SOD and Mn-SOD activities (Ye et al., 2019). These findings demonstrated that dietary supplementation with OBB could strengthen the antioxidant system and favorably modulated lipid metabolism in broilers.

The histopathological observation serves as gold standard for the evaluation and characterization of biological tissues (Slaoui et al., 2017). For intestinal assessment, VH, CD, VH/CD and the number of goblet cells are widely recognized as critical parameters for evaluating intestinal function. The result of H&E staining showed that dietary supplementation with OBB did not cause discernible pathological alterations in the intestinal and hepatic tissues of broilers, nor were there significant variations in VH, CD, VH/CD and length of villous epithelium. Besides, supplementation with OBB dramatically increased the number of goblet cells, which concurred with previous study reporting that BBR supplementation similarly enhanced goblet cell numbers in weaned piglets (Sun et al., 2025). The increased number of goblet cells of the jejunum may be attributed to better lipophilicity properties of OBB, which could secrete biologically active products to protect against bacterial invasion and further motivate broilers growth performance. These results suggested that dietary supplementation with OBB is beneficial for improving growth performance of broilers, which is intimately related to stimulating epithelial cell renewal and increasing mucin secretion.

Apart from intestinal morphology, tight junction proteins are crucial for maintaining the integrity of the intestinal epithelial barrier. The disruption of the intestinal tight junctions will result in the destruction of the gut barrier structure and increased intestinal permeability. DAO and D-LA can work as markers for the assessment of intestine injury and monitor intestinal permeability. Previous studies indicated that drinking water supplemented with Coptis chinensis-dominant Chinese herbal formula could dramatically lower DAO activity in Salmonella enteritidis infected broilers (Zou et al., 2024). In agreement with former results, our study also observed lower serum DAO activity after dietary supplementation with OBB. Additionally, consistent with the result, this study also indicated that dietary supplementation with OBB improved the expression levels of Occludin and ZO-1, This effect may be attributed to the lipophilic nature of OBB, which facilitates its penetration through intestinal epithelial cells and subsequent activation of intracellular signaling pathways, thereby upregulating tight junction proteins expressions and reducing DAO activity. Similar results were observed with dietary supplementation with ovo isoquinoline alkaloid, which could strengthen intestinal barrier function by boosting the jejunal mRNA expressions of tight junction genes (Hundam et al., 2025). These findings indicated that OBB intervention played a protective role in improving intestinal barrier integrity.

As an essential organ, the poultry gut harbors a vast and diverse community of microorganisms, including beneficial bacteria and potential pathogens (Ricke et al., 2020). Some studies have revealed that diets with active ingredients originated from herbal medicine have been demonstrated to have a striking effect on modulating the structure and function of intestinal microbiota community (Zhang et al., 2021). In the present study, PCA and PLS-DA analysis consistently revealed that OBB could improve the microbial community. Additionally, LEfSe analysis demonstrated that Prevotellaceae, Bacillales, Bacillaceae and Oscillospira were significantly enriched after OBB (25 mg/kg) intervention. Bacillales, Bacillaceae and Oscillospira all belong to the phylum Firmicutes, while Prevotellaceae belong to the phylum Bacteroidetes. A growing body of research demonstrated that some bacteria from the phylum Firmicutes and Bacteroidetes played a crucial role in maintaining intestinal homeostasis (Li et al., 2023b; Talapko et al., 2022), and their abundance also is closely associated with the growth performance of animals. For instance, Zhu reported that the Bacteroidetes phylum and Bacteroides genus were both positively associated with higher ADFI as improved by dietary BBR (Zhu et al., 2021). Consistent with these results, our data showed that the dietary supplementation with OBB increased the abundance of the phylum Bacteroidetes and the genus Bacteroides, along with improving growth performance. Furthermore, Bacteroides and Ruminococcus-torques-group can use fermentation to produce short-chain fatty acid, which increase intestinal barrier function and promote health growth in broilers. In the present study, supplementation with OBB significantly elevated the relative abundance of Bacteroides and the Ruminococcus torques, as well as the expression levels of ZO-1 and Occludin, which is in line with previous findings (Rao et al., 2024). However, the underlying mechanisms by which the microflora, enriched by OBB supplementation, improve growth performance and intestinal health require further investigation. Taken together, these findings demonstrated that dietary supplementation with OBB modulated the microbial community, fostering a healthier intestinal environment in broilers.

To the best of our knowledge, this study has shed important new light on the potential use of TCM and natural compounds as feed additives. Moreover, in terms of cost-effectiveness, the use of OBB results in a reduction of 0.5 RMB per broiler in production costs relative to BBR. Nevertheless, there are still several limitations existing in this research, warranting further in-depth investigation. Firstly, long-term safety and pharmacokinetics studies should be evaluated in broilers before large-scale application. Secondly, more groups should be included in the mechanism analysis, not just the one with the best performance. Thirdly, further investigations involving male birds and a wider range of breeds were warranted to corroborate the current observations. Fourthly, A comparative evaluation of its efficacy against a positive control antibiotic merits further exploration. Finally, more detailed mechanisms of OBB as a potential additive merited further investigation.

In conclusion, dietary supplementation with OBB positively affected the performance growth, slaughter performance, and carcass traits. In addition, inclusion of OBB in broiler diets could not only enhance immune functions but also strengthen antioxidant capacity. Furthermore, supplementing the diet with OBB could modulate the microbial community. Our findings indicated that OBB had the potential to be exploited as a natural and effective dietary supplement to promote overall health and improve the growth performance of broiler chickens, with the optimal inclusion level of 25 mg/kg.

Ethics statement

All animal protocols used in this study were approved by the Experimental Animal Ethics Committee in Jiangxi Academy of Agricultural Sciences. All experimental procedures were conducted in compliance with the guidelines for the ethical review of laboratory animals for animal welfare, which are consistent with the standards of Institute Animal Care and Use Committee (No. 2024-JXAAS-XM-18).

CRediT authorship contribution statement

Gaoxiang Ai: Writing – original draft, Formal analysis, Data curation. Jiang Chen: Methodology, Investigation. Pingwen Xiong: Data curation. Yaoxing Dou: Writing – review & editing. Wenjing Song: Supervision, Software. Qiongli Song: Software. Weide Su: Visualization. Zhiheng Zou: Writing – review & editing, Supervision. Xiaolian Chen: Writing – review & editing, Funding acquisition, Conceptualization.

Disclosures

We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the position presented in, or the review of, the manuscript entitled, “The effects of dietary oxyberberine supplementation on the growth performance, carcass traits, immunity, oxidative capacity, intestinal morphology and intestinal microbiota in broilers”.