Abstract
Aims:
Doxorubicin (Dox) is a potent chemotherapeutic agent, but its use is limited by cardiotoxicity, primarily due to the disruption of Topoisomerase-2 beta (TOP2B) activity. Dexrazoxane (Dex), an FDA-approved cardioprotective drug, alleviates Dox-induced toxicity but lacks heart-specific targeting. This study investigates siRNA-mediated TOP2B knockdown as a more targeted strategy to protect cardiomyocytes from Dox-induced damage.
Materials and methods:
Human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) were treated with siRNA to knock down TOP2B and were then exposed to Dox. We compared the cardioprotective effects of siRNA-mediated knockdown to Dex treatment using cell viability, cell toxicity assay and electrophysiological evaluation was performed using a multielectrode array (MEA).
Key findings:
Our results demonstrate that TOP2B silencing significantly decreases apoptosis and improved cell viability, as compared to the Dex treatment. Additionally, electrophysiological assays using a Multielectrode Array (MEA) demonstrated enhanced contractility and conductivity in siRNA-treated hiPSC-CMs. Furthermore, transmission electron microscopy (TEM) data revealed that TOP2B knockdown preserves mitochondrial morphology and sarcomere structure, compared to Dox and Dex-treated groups.
Significance:
These findings suggest that siRNA-mediated TOP2B inhibition could provide a safer, more specific approach to mitigate Dox-induced cardiotoxicity.
Keywords: TOP2B, Cardiotoxicity, Doxorubicin, Dexrazoxane, Cardioprotection, siRNA knockdown, Apoptosis, hiPSC-CMs
1. Introduction
Anthracyclines (ANTs), such as doxorubicin (Dox), daunorubicin, and idarubicin, remain cornerstones of chemotherapy due to their potent efficacy against a wide spectrum of malignancies [1,2]. Despite their clinical value, the dose-limiting cardiotoxicity associated with ANTs represents a major challenge in oncology, affecting long-term cardiac function in cancer survivors. This cardiotoxicity, which can manifest as irreversible cardiomyopathy and heart failure, has emerged as a critical issue in the management of cancer patients, particularly with prolonged anthracycline use or cumulative dosing [3,4]. Histological characteristics of anthracycline-induced cardiomyopathy include vacuole formation, myofibrillar loss, and myocardial necrosis, underscoring the need for cardioprotective strategies that do not compromise the anticancer efficacy of ANTs [5,6]. Type II Topoisomerases (TOP2) are the molecular targets of ANTs anticancer activity [3]. TOP2 enzymes resolve the topological stress in DNA that arises due to over/under-winding of DNA strands during cellular processes by introducing double-stranded (ds) nicks in the DNA [7,8]. There are two isoforms of TOP2 expressed in humans: Topoisomerase-2 α (TOP2A) and Topoisomerase-2 β (TOP2B). These isoforms share 68 % identity in amino acid sequences and are encoded by genes on different chromosomes [9]. TOP2A is highly expressed in proliferating cells; however, TOP2B is abundantly expressed in terminally differentiated cells such as neurons and cardiomyocytes [7,10].
ANTs, specifically Dox, can disrupt the catalytic cycle of both types of topoisomerases at two distinct stages [11,12]. At low concentrations, Dox stabilizes the TOP2-DNA cleavage complex, preventing DNA religation, and thus increasing the accumulation of the cleavage complex. At higher concentrations, Dox acts as an intercalating agent, inhibiting TOP2 from binding to DNA. As a result, at higher doses, Dox inhibits the formation of the TOP2-DNA cleavage complex leading to transcriptional arrest and DNA damage, ultimately causing cell death [13,14]. TOP2A expression is high in tumor cells, and it is essentially required in the chromosome segregation step during cell division, making it a primary target for Dox activity [15]. Since Dox binds to both forms of TOP2, it results in Dox-induced cardiotoxicity via the TOP2B-mediated pathway in adult cardiomyocytes [16]. Furthermore, it has been reported that the functional and structural changes in mitochondria following Dox treatment are also dependent on TOP2B [17]. Transcriptomics analysis of TOP2B knockout (KO) mice treated with Dox demonstrated preserved mitochondrial biogenesis as compared to wild-type mice [17]. Genes like Trp53inp1, Apaf1, Bax, and Fas were found to be highly upregulated in mice after Dox treatment [17]. Overall, Dox causes cardiomyocyte death through the induction of cellular apoptosis, reduction of energy production, and generation of ROS, and in the absence of TOP2B, cardiomyocytes are protected against Dox cardiotoxicity [17].
Dexrazoxane (Dex) is the only FDA-approved drug used in conjunction with anthracycline (ANT) chemotherapy regimens. For a long time, its cardioprotective effects were believed to stem from its ability to chelate iron from the ANT-Fe complex. This mechanism involves the “redox-cycling” of the ANT-Fe complex, which, through the Fenton reaction, helps prevent the formation of reactive oxygen species (ROS) [18]. However, recent research indicates that Dex’s cardioprotective action primarily results from its inhibition of TOP2B [19]. Dex binds to the two ATP-binding sites in the N-terminal domain of TOP2B, creating a closed-clamp configuration that bridges two TOP2B monomers. Consequently, this Dex-bound TOP2B interferes with the interaction between ANTs and TOP2B, preventing the drugs from binding to the TOP2B-DNA complex. This mechanism may clarify how Dex protects against cardiotoxicity resulting from ANTs [20,21]. Nonetheless, concerns persist that Dex might interfere with the anticancer efficacy of ANTs by inhibiting TOP2A in tumor cells potentially reducing the overall effectiveness of chemotherapy [22].
Given these challenges, there is a pressing need for alternative cardioprotective strategies that specifically target TOP2B without affecting TOP2A. Although, TOP2B’s role in Dox-induced cardiotoxicity is not a novel concept, this study introduces a key aspect to the current investigations by utilizing the specific inhibition of TOP2B using RNA interference (RNAi) techniques, such as siRNA-mediated knockdown (KD). By selectively silencing TOP2B in cardiomyocytes, siRNA can mitigate the cardiotoxic side effects of ANTs while maintaining their antitumor effectiveness. Additionally, utilizing siRNA to precisely modulate gene expression paves the way for precision medicine approaches, where targeted delivery systems could enhance the specificity and efficacy of cardioprotective interventions [23].
In this study, we explore the potential of siRNA-mediated TOP2B knockdown (TOP2B-KD) as a novel cardioprotective strategy against Dox-induced cardiotoxicity. By directly comparing the effects of TOP2B silencing with those of Dex, a clinically established cardioprotective agent. We aim to elucidate the molecular mechanisms behind anthracycline-induced cardiomyopathy and propose a more targeted therapeutic approach to attenuate cardiac damage while preserving Dox’s anticancer efficacy. We performed experiments using human-induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs). The cells were either pretreated with Dex or transfected with TOP2B-specific siRNA before Dox treatment. Cardiomyocyte toxicity was assessed through cell viability assays (MTT, LDH release, and TUNEL), electrophysiological evaluation using a multielectrode array (MEA), and molecular analysis via quantitative real-time PCR (qRT-PCR). This is first time we report the electrophysiological activity using MEA, calcium signaling, and mitochondrial structural changes in hiPSC-derived cardiomyocytes following TOP2B knockdown. The study also explores the molecular mechanisms underlying cardiotoxicity, including apoptotic pathway regulation (TUNEL assay, Bax/Bcl-2 ratio) and mitochondrial integrity (ROS levels, morphology), providing new insights into how TOP2B silencing mitigates Dox-induced damage.
Our findings suggest that TOP2B-KD has significant cardioprotective effects against the Dox treatment. Specifically, the data indicate improvements in cell viability, reduced release of lactate dehydrogenase (LDH), maintained electrophysiological function, decreased rates of apoptosis, and downregulation of key apoptotic and cell cycle-related genes at the mRNA level. This study indicates that silencing TOP2B may provide a more precise and effective cardioprotective strategy than Dex during anthracycline chemotherapy. By adopting TOP2B silencing, researchers and clinicians could potentially mitigate cardiac side effects while ensuring the therapeutic efficacy of anticancer treatments.
2. Materials and methods
2.1. Culturing and maintenance of hiPSC-CMs
The hiPSC-CMs procured from CDI (Cat. #R1007, FUJIFILM Cellular Dynamics Inc.) were cultured according to the manufacturer’s protocol. Cells were maintained in CDI’s cardiomyocytes maintenance media for up to 14 days, incubated at 5 % CO2 in a humidified atmosphere at 37 °C before treating them with Dex or TOP2B siRNA as previously described [24-27].
2.2. Dexrazoxane and doxorubicin treatment
All the drugs were prepared in DMSO and the working concentrations were diluted in the maintenance media. Cells were preincubated with 200 μM of Dex (Cat. #38–571-0) for 12–16 h, followed by another incubation of 48 h with 1 μM of Dox (Cat. #J64000.MA). All the Assays were performed after 48 h of Dox treatment [28-30].
2.3. TOP2B knock-down using siRNA
Two siRNAs targeting TOP2B were obtained from ThermoFisher Scientific (Cat. #110843, #110845) and a Cy™3-labeled siRNA (Cat. # AM4621) was used as a negative control. Cells were seeded in 6-well and 24-well gelatin-coated plates for RNA and immunostaining respectively. Lipofectamine™ RNAiMAX Transfection reagent (Cat. #13778150, ThermoFisher) was used for transfection. The transfection was performed according to the manufacturer’s protocol. 10 μM final concentration of siRNAs (siRNA1 + siRNA2) and lipofectamine (1:3) was diluted in optiMEM media (Cat. #31985070) and then combined in equal ratio and incubated at room temperature for 5 min. The siRNA and lipofectamine complex were then added to the media onto the cells and incubated for 12–16 h before treating the cells with Dox for 48 h.
2.4. MTT assay for cell viability
MTT assay was performed to assess the cell viability after different treatments. For this hiPSC-CMs were seeded in a 96 well plate and at the end of the final Dox incubation of 48 h, 0.5 mg/ml of MTT solution (Cat. #V13154) was directly added to cell culture media and incubated for 3 h. Later, the media was discarded, and the formazan crystals were dissolved with 100 μl of DMSO. The spectral readings were recorded at 570 nm (Infinite® M Plex, multimode plate reader, Tecan, Switzerland). The assay was performed in quadruplicate (n = 4) and the data obtained was analyzed on GraphPad Prism 10.
2.5. Lactate dehydrogenase (LDH) assay to assess cytotoxicity
To measure the cytotoxicity of different conditions on hiPSC-CMs, LDH assay was performed using the in vitro toxicology assay kit (Cat. #TOX7-1KT, Millipore Sigma, Milwaukee, WI, United States). The culture media was collected from hiPSC-CMs cultured from different conditions at 48 h time point and LDH release assay was performed according to the manufacturer’s protocols. The background and primary absorbance of the plate were measured on a spectrophotometer at 690 and 490 nm, respectively. The assay was performed in quadruplicate (n = 4) and data obtained was analyzed on GraphPad prism10.
2.6. Multi-electrode array (MEA) system to assess cardiomyocyte function in vitro
The functional activity of hiPSC-CMs under different treatment conditions was measured using an MEA system (Maestro Edge multiwell Axion Biosystems, USA). For this, hiPSC-CMs were directly cultured on 24-well MEA plates (M384-tMEA-24 W, Axion Biosystems, USA) that have 16 microelectrodes per well. The wells were coated with 50μg/ml of fibronectin (Cat. # 33016–015) before plating ~40,000 cells per well. Before taking the recordings, the plate was equilibrated in the MEA system (Maestro Edge, Axion Biosystems, Atlanta, GA, USA) for 30 min in 5 % CO2 with a humidified atmosphere at 37 °C. The baseline was recorded for each well for 5 min before treatments. AxIS Navigator was used for data recording, while the CiPA™ analysis tool (Axion Biosystems, USA) was used for data analysis. The beat period, field potential duration (FPD), spike amplitude, and incidences of arrhythmias were calculated at different time points. The experiment was performed in triplicates (n = 3) and the data obtained was analyzed on GraphPad prism 10.
2.7. Immunostaining
For immunocytochemical analysis, cells were cultured on glass coverslips and treated as described above. The cells were fixed with 4 % paraformaldehyde for 15 min at RT and permeabilized with 0.25 % Triton X-100 for 10 min at RT. Non-specific antibody binding was blocked by incubating the cells in the blocking buffer containing 1 % bovine serum albumin (BSA) in PBS for 1 h at RT. The cells were then incubated with primary antibodies diluted in the blocking solution at 4 °C, overnight with gentle shaking. The following day, the cells were washed thrice in PBS and incubated with the corresponding secondary antibody diluted in blocking buffer for 1 h at RT in the dark. The cell nuclei were counterstained with DAPI for 15 min, at RT in the dark and the cytoplasm was stained with either Actin green 488 (Cat. #R37110) or α-Sarcomeric actinin (Cat. #AB137346) antibodies (Ab). Prolong Gold Antifade was used to mount the coverslips onto the glass slides. Anti-TOP2B Ab (Cat. #MA5–24310, 1:250, Invitrogen), goat anti-mouse AlexaFluor™ 647(1:1000, Invitrogen) antibodies were used. The experiment was performed in triplicates (n = 3) and all the images obtained were analyzed in ImageJ and quantification was plotted in GraphPad prism 10.
2.8. Total RNA isolation and qRT-PCR analysis
Total RNA from the hiPSC-CMs from different conditions was purified using RNeasy mini kit (Cat.# 74,104). Cleaned-up RNA (1 μg) was reverse transcribed with Omniscript Reverse Transcription kit (Cat. # 205113) using Random hexamer primers in a 50 μl reaction volume. Real-time PCR was performed using SYBR™ Green master mix (Cat. # A25742). The cDNA was diluted in 1:10 dilution factor and 2 μl of cDNA was used in a total of 16 μl reaction volume for the genes in Table 1. The thermal cycling conditions included an initial denaturation at 95 °C for 10 min, and 40 cycles of 95 °C for 10 s, 60 °C for 20 s, and 72 °C for 20 s. All samples were run in triplicates. The fold change in expression was calculated by normalizing to β-actin control and plotted in GraphPad prism 10.
Table 1.
List of primers used for qRT-PCR.
| Gene | Forward primer | Reverse primer |
|---|---|---|
| TOP2B | GCT AAT GAT GCT GGT GGT AAA C | TCT CGT CCA ATC ACA CCT AAT C |
| β-Actin | GCCGCCAGCTCACCA | CTCGTCGCCCACATAGGAAT |
| CASP3 | GCT GCC TGT AAC TTG AGA GTA G | GTA TGG AGA AAT GGG CTG TAG G |
| CASP9 | GAG GAA GAG GGA CAG ATG AAT G | CAT GTC AGT AGT GCA GAG GTT |
| cTnT | GAATGAGCGGGAGAAGGAGC | TCCGCTCTGTCTTCTGGATG |
| P16 | GCA CAT TCA TGT GGG CAT TT | GAC TCA AGA GAA GCC AGT AAC C |
| P21 | CGG AAC AAG GAG TCA GAC ATT | AGT GCC AGG AAA GAC AAC TAC |
| P53 | GGA AAT TTG CGT GTG GAG TAT TT | GTT GTA GTG GAT GGT GGT ACA G |
| Bax | GCGTCCACCAAGAAGCTGA | CTCGGAAAAAGACCTCTCGGG |
| BCL-2 | GGATGACTGAGTACCTGAACCG | TACAGTTCCACAAAGGCATCCCAG |
2.9. Western blot analysis
hiPSC-CMs were preincubated with 200 μM Dex and TOP2B specific siRNA and further incubated with 1 μM Dox for 48 h. For the total protein, cells were lysed with RIPA buffer (Cat.# 89,901, Thermo Scientific) containing protease inhibitor and phosphatase inhibitors for 10 min on ice. The samples were centrifuged at 10,000 ×g for 5 min, and the supernatants were collected as lysates. The protein concentrations were determined using the BCA protein Assay kit (Millipore) per the manufacturer’s instructions. Proteins were separated using 4–20 % SDS-PAGE and transferred onto nitrocellulose membranes as previously described [31]. The membranes were blocked with 5 % Milk (in 1× Tris-buffered saline containing Tween-20; TBST) for 1h at room temperature, followed by overnight incubation with anti-TOP2B Ab (Cat. #MA5–24310, Thermo Fisher Scientific). Membranes were washed thrice with 1× TBST and incubated with 0.01 μg/mL HRP-conjugated secondary Ab (goat anti-mouse IgG) for 60min at room temperature. After extensive washing, membranes were developed using the Immobilon® UltraPlus Western HRP Substrate (EMD Millipore) per the manufacturer’s instructions and visualized using Bio-Rad ChemiDoc MP. Total protein loaded in each well was determined by staining the blots with Ponceau S stain. The image intensity was quantified using the ImageJ software and TOP2B expression in the samples were normalized to the total protein.
2.10. TUNEL assay to assess apoptosis
To measure apoptosis, a deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay kit (Thermo Scientific; C10618) was used. Briefly, hiPSC-CMs were cultured on 0.1 % gelatin coated coverslips in a 24-well plate. The cells were pretreated with 200 μM Dex and TOP2B siRNA for 12–16 h followed by incubation with 1 μM Dox for 48 h. After 48 h the cells were fixed with 4 % (v/v) PFA for 10 min, permeabilized with 0.25 % (v/v) Triton-X-100 for 10 min, and apoptotic nuclei were stained using a TUNEL assay kit as described by the manufacturer’s protocol. For the positive control, hiPSC-CMs (without any treatment) after fixing and permeabilization were treated with 1 unit of DNase I (Thermo Scientific; 18068-015) in DNase I reaction buffer for 30 min at RT and then stained as described. Fluorescent images were captured using confocal microscope (Nikon AXR, Japan) and the TUNEL positive cells were counted in ImageJ.
2.11. Assessment of calcium cycling
Intracellular calcium transients were assessed in the hiPSC-CMs 48 h after treatment with Dox, as previously described [31]. Briefly, the hiPSC-CMs were stained with Fluo-4-AM in DMEM for 1 h, 37 °C. The stained cells were washed thrice and imaged in the iCell Maintenance medium using the Nixon AXR microscope. Line scan images were analyzed using ImageJ to measure the transient duration, time to peak, decay time and amplitude. Cells with a standard error >10 % between consecutive peaks were considered to have irregular contractility.
2.12. Mitochondrial ROS analysis
To assess the mitochondrial changes, the hiPSC-CMs were pretreated with 200 μM Dex and TOP2B siRNA and further treated with 1 μM Dox for 48 h. After 48 h, the cells were washed once with PBS and incubated with 50 nM Mitotracker green (Cat. #M7514, Invitrogen) diluted in hiPSC-CMs maintenance media and incubated in a humidified chamber with 5 % CO2 for 30 mins and 5 μM MitoSOX Red (Cat. # M36008, Invitrogen) for 10 min. The cells were further counterstained with DAPI and imaged using EVOS M7000 Imaging System (Invitrogen, USA). All the images were analyzed using ImageJ.
2.13. TEM imaging
For Transmission Electron microscopy, approximately 40,000–50,000 hiPSC-CM were plated on Permanox chamber slides. After 48 h of plating the cells were pretreated with 200 μM Dex and TOP2B siRNA for 12–16 h, followed by treatment with 1 μM Dox for an additional 48 h. After this period the cells were fixed with 2.5 % glutaraldehyde and processed as per the published reports [26]. The imaging was performed using FEI Tecnai G2 Biotwin TEM.
2.14. Statistical analysis
Data acquired is expressed as mean ± SEM. Statistical significance was determined using the one-way ANOVA method. A value p < 0.05 was considered statistically significant. All the data was analyzed and plotted in GraphPad prism10.
3. Results
3.1. siRNA-induced TOP2B-KD leads to decreased protein expression
To assess the effect of TOP2B-KD on the expression of TOP2B in hiPSC-CMs, hiPSC-CMs were transfected with TOP2B specific siRNA and pretreated with 200 μM Dex, followed by incubation with 1 μM Dox for an additional 48 h. Immunostaining and western blot analysis (Fig. 1) was performed to visualize TOP2B expression, and qRT-PCR was conducted to evaluate TOP2B mRNA levels. Immunostaining revealed a significant reduction in TOP2B protein expression across all treatment groups. The most pronounced reduction was observed in cells treated with TOP2B-specific siRNA, both alone and in combination with Dox (Fig. 1A-B). The siRNA-treated groups displayed the low levels of TOP2B protein levels both with immunostaining and western blot (Fig. 1A-E). While Dex alone and the combination of Dex + Dox significantly decreased TOP2B expression, the most significant decrease was again noted in the TOP2B-KD. Specifically, the TOP2B-KD and Dox + TOP2B-KD group exhibited the lowest TOP2B mRNA levels, confirming the efficiency of siRNA-mediated knockdown. These findings suggest that both Dex and TOP2B-specific siRNA effectively decrease TOP2B expression at the mRNA and protein levels, with siRNA exerting the strong effect.
Fig. 1.

Assessment of TOP2B expression. (A) Fluorescence images of hiPSC-CMs treated with Dox-1 μM, Dex-200 μM and TOP2B siRNA, probed with anti-TOP2B Ab and Goat anti-mouse AF-647 secondary Ab. Scale bar: 50 μm. (B) TOP2B expression (nuclei) quantified via fluorescence intensity normalized to cell number. (C) mRNA expression levels of TOP2B represented as fold change normalized to β-Actin. (D) TOP2B protein expression by western blot along with ponceau stained whole blot. (E) Quantification of TOP2B protein expression using western blot images normalized to control and the total protein with ponceau stained whole blot. N = 3/group; p-values: ****≦0.0001; ***≦0.001; **≦0.01; *≦0.05.
3.2. siRNA-mediated TOP2B-KD alleviates toxicity and enhances viability in dox-treated hiPSC-CMs
To determine the optimal concentrations of Dox and Dex for subsequent experiments, hiPSC-CMs were exposed to varying concentrations of both drugs and the cell viability and toxicity were assessed using the MTT and lactate dehydrogenase (LDH) release assays, respectively. Based on these preliminary assays, 200 μM of Dex and 1 μM of Dox were selected as the final concentrations for further studies. MTT assay was performed to evaluate cellular viability under different treatment conditions. As expected, Dox treatment led to a significant decrease in hiPSC-CMs viability. However, cells pretreated with Dex or subjected to TOP2B-KD exhibited improved survival relative to the Dox treated group. Notably, TOP2B-KD resulted in significantly greater cell viability compared to Dex treatment, suggesting a cardioprotective effect (Fig. 2A). Simultaneously, LDH release assay was used to quantify cellular toxicity. Dox treated cells exhibited a marked increase in LDH release, indicating substantial cytotoxicity. Both Dex and TOP2B-KD significantly decreased LDH release, reflecting mitigated cell damage in these groups. Importantly, cells with TOP2B-KD demonstrated a comparable reduction in LDH release to those treated with Dex, indicating that TOP2B inhibition provides effective cardioprotection (Fig. 2B). The brightfield images showing the cell density of hiPSC-CMs after 48 h of treatment is provided as Supplementary Fig. 2.
Fig. 2.

Assessment of cytotoxicity in hiPSC-CMs. (A) Percentage cell viability determined by MTT assay, normalized to control. (B) Fold-change (FC) in LDH release in media normalized to control. N = 3/group; p-values: ****≦0.0001; ***≦0.001; **≦0.01; *≦0.05.
3.3. TOP2B-KD by siRNA confers apoptosis resistance in Dox-treated hiPSC-CMs
To assess DNA damage and apoptosis, the terminal deoxynucleotidyl transferase dUTP nick-end labelling (TUNEL) assay was performed following 48 h of Dox treatment. Approximately 80 % of cells in the Dox treatment group were TUNEL positive, indicating extensive DNA fragmentation, in contrast to the control group. Interestingly, Dex treatment did not lead to a significant reduction in TUNEL-positive cells, whereas TOP2B-KD resulted in a marked decrease in the number of TUNEL-positive cells, suggesting a protective effect against Dox-induced DNA damage (Fig. 3A-B).
Fig. 3.

Assessment of Apoptosis in hiPSC-CMs. (A) Confocal images depicting TUNEL-positive cells with different treatments. Scale bar: 50 μm. (B) Quantification of TUNEL-positive cells normalized to cell number. (C) Bax-BCL2 ratio evaluated by qPCR normalized to β-Actin. N = 3–4/group; p-values: ****≦0.0001; ***≦0.001; **≦0.01; *≦0.05.
To further characterize the apoptotic response, we quantified the ratio of Bax to BCL-2 (the key regulators of the apoptotic pathway) using qRT-PCR. An increased Bax/BCL-2 ratio demonstrates increased apoptosis, while a lower ratio signifies resistance to cell death [32-37]. Dox treatment significantly elevated the Bax/BCL-2 ratio, indicating enhanced susceptibility to apoptosis. However, both Dex and TOP2B-KD treatments substantially decreased the Bax/BCL-2 ratio (Fig. 3C).
3.4. Electrophysiological response to Dox and other treatments using multi-electrode array (MEA) system
To investigate the electrophysiological impact of Dox on hiPSC-CMs and evaluate the protective effects of Dex and TOP2B-KD, we performed MEA analysis using the Axion Biosystem platform. MEA enables real-time measurement of extracellular electrical activity in excitable cells, providing key electrophysiological parameters such as spike amplitude, field potential duration (FPD), beat rate, beat period, and conduction velocity. Dox treated hiPSC-CMs exhibited a significant increase in beat rate (Fig. 4A). The beat period was substantially decreased in the Dox group, indicating faster beating. In contrast, TOP2B-KD restored the beat period towards baseline levels, when compared to Dex treatment (Fig. 4B). Spike amplitude in Dox treated cells showed an initial increase followed by a sharp decline. In contrast, cells with TOP2B-KD maintained more stable spike amplitude, with a delayed decline observed only after 48 h (Fig. 4B). Regarding FPD, Dox treatment initially mitigated the FPD, followed by a progressive increase over the 48 h time course (Fig. 4B). Additionally, conduction velocity sharply declined after 12 h in Dox-treated cells. In TOP2B-KD cells, the decrease in conduction velocity occurred more gradually, suggesting an attenuated electrophysiological disruption (Fig. 4C). In contrast, TOP2B-KD maintained a steady decline in FPD, with values comparable to controls at the 48 h mark, a result not reflected in the Dex-treated group. QT-interval analysis revealed that the T-wave morphology in the Control, Dex, and TOP2B-KD groups remained comparable to the baseline throughout the experiment. However, in the Dox group, the QT interval was significantly shortened after 24 h. Dex and TOP2B-KD interventions partially restored the QT interval towards the baseline, with the latter showing superior normalization (Fig. 4D). When analysing the 50 consecutive beat patterns, Dox treated cardiomyocytes displayed frequent off-beat patterns. In the Dox + Dex group, the number of offbeats was higher compared to the Dox + TOP2B-KD group, which exhibited more regular beating patterns (Fig. 4E). Overall, hiPSC-CMs with TOP2B-KD demonstrated improved electrophysiological stability under Dox treatment compared to Dex intervention, highlighting the potential of TOP2B inhibition as a more effective cardioprotective strategy in preserving electrical function during ANT therapy.
Fig. 4.

Multielectrode array analysis of hiPSC-CMs. (A) Heat map of beat rate normalized to baseline at different time points. (B) Plots showing % fold change for mean Beat period, Spike Amplitude and Field Potential Duration (FPD), as normalized to baseline (BL). (C) Percent (%) change in conduction velocity from BL. (D) QT-interval curves across different time points for each treatment condition compared to BL. (E) Plot representing 50 consecutive beats for each treatment condition. N = 3–4/group; p-values: *≦0.05.
3.5. mRNA expression levels of apoptosis and cell cycle regulatory genes demonstrate that Dex pretreatment has more deleterious effect than TOP2B-KD in Dox treated hiPSC-CMs
To further investigate the molecular mechanisms underlying the protective effects of TOP2B-KD, we examined the expression of key apoptosis and cell cycle-related genes at the mRNA level. Total RNA was extracted, cDNA was synthesized, and qRT-PCR analysis was performed on hiPSC-CMs subjected to various treatments. In Dox treated hiPSC-CMs, we observed a significant upregulation of apoptotic markers such as Caspase-3 (CASP3) and Caspase-9 (CASP9) indicating the activation of apoptosis. Notably, Dex pretreatment further elevated the expression of these genes. In contrast, TOP2B-KD markedly decreased CASP3 and CASP9 expression, suggesting that TOP2B inhibition mitigates Dox-induced apoptosis (Fig. 5A-B). Additionally, we evaluated cardiac troponin (cTnT) levels, a critical marker of cardiomyocyte integrity. Dox treatment resulted in a significant reduction in cardiac troponin levels, consistent with cardiomyocyte damage. However, in the presence of TOP2B-KD, troponin levels were restored, indicating improved hiPSC-CMs survival compared to the Dex group (Fig. 5C). We also assessed the expression of key cell cycle regulators, including p53, p21, and p16. Dox treatment led to a pronounced increase in the expression of these genes (Fig. 5D-F). Dex pretreatment further exacerbated this upregulation. Conversely, TOP2B-KD restored p53, p21, and p16 expression levels to near-normal values, suggesting that TOP2B inhibition attenuates apoptosis and alleviates Dox-induced cell cycle disruption (Fig. 5D-F).
Fig. 5.

Measurement of mRNA levels (fold-change) by qRT-PCR following Dox/Dex/siRNA treatments. (A) CASP3, (B) CASP9, (C) cTnT, (D) p16, (E) p21, and (F) p53 mRNA levels were normalized to β-Actin with respect to control. N = 3/group; p-values: ****≦0.0001; ***≦0.001; **≦0.01.
3.6. Calcium transients’ analysis in hiPSC-CMs treated with Dox + Dex shows higher irregular contractility than Dox + TOP2B-KD group
We evaluated the effects of different treatments on intracellular calcium transients in hiPSC-CMs. Treatment with Dox, Dox + Dex, and Dox + TOP2B-KD resulted in a significant decrease in transient amplitude (Fig. 6A, D). While no changes were observed in transient duration and decay time following nh treatment with Dox or Dox + TOP2B-KD, a significant increase in these parameters was noted in the Dox + Dex treated hiPSC-CMs (Fig. 6B, C). Furthermore, the time to peak of the calcium transients was significantly reduced in the Dox + Dex and Dox + TOP2B-KD groups but not in the Dox treated hiPSC-CMs (Fig. 6E). A shorter time to peak may indicate enhanced calcium release kinetics, potentially due to changes in ryanodine receptor activity or sarcoplasmic reticulum function. However, the functional consequences of this change appear to differ between the groups, with Dox + Dex exhibiting additional adverse effects on calcium cycling. Consistent with the microelectrode array (MEA) data, Dox and Dox + Dex treatments resulted in irregular contractility in hiPSC-CMs. This reflects the detrimental impact of these treatments on excitation-contraction coupling and suggests that the observed calcium handling defects directly translate into functional impairment. Notably, no such irregularities were observed in the Dox + TOP2B-KD treated hiPSC-CMs, indicating that TOP2B knockdown mitigates the contractile dysfunction induced by Dox.
Fig. 6.

Assessment of calcium transients in hiPSC-CMs. (A) Representative traces and line scan images showing the calcium transients in Control, Dox, Dox + Dex, and Dox + TOP2B-KD hiPSC-CMs. (B–F) Quantitative assessment of (B) transient duration, (C) decay time, (D) amplitude, (E) time to peak, and (F) percentage of cells showing irregular calcium transients. N = 25–35 cells/group. ****: p < 0.0001.
3.7. TOP2B-KD decreases the mitochondrial ROS and preserve the mitochondrial and sarcomere structure in Dox-treated hiPSC-CMs
Fluorescent imaging of hiPSC-CMs stained for mitochondrial markers revealed significant differences in mitochondrial morphology and mitochondrial ROS levels among treatment groups. Mitotracker Green staining highlighted changes in mitochondrial structure, while MitoSOX Red detected mitochondrial ROS. Representative images (Fig. 7A) show a marked increase in mitochondrial ROS in Dox-treated hiPSC-CMs, which was reduced with Dex and TOP2B-KD interventions. Quantitative analysis revealed a higher percentage of cells positive for mitochondrial ROS staining in the Dox and Dox + Dex groups compared to untreated controls (Fig. 7B). Additionally, mitochondrial ROS intensity was significantly elevated in these groups (Fig. 7C). In contrast, treatment with Dox + TOP2B-KD significantly reduced mitochondrial ROS levels, both in terms of the percentage of positive cells and intensity. Transmission electron microscopy (TEM) analysis provided further insight into mitochondrial and sarcomere morphology. TEM images (Fig. 7D) indicated fragmented and swollen mitochondria with disrupted cristae in Dox treated hiPSC-CMs, along with irregular sarcomere alignment. These alterations were even more pronounced in the Dox + Dex group, suggesting additive detrimental effects on mitochondrial and sarcomere integrity. In contrast, Dox + TOP2B-KD treatment preserved mitochondrial morphology, with fewer fragmented mitochondria and more intact cristae. Sarcomere structure also appeared more organized in this group compared to the Dox and Dox + Dex groups.
Fig. 7.

Assessment of mitochondrial dynamics and sarcomere morphology by TEM imaging. (A) Fluorescent images depicting mitochondria and mitochondrial ROS with different treatments labeled with Mitotracker green (Mito-T) and MitoSOX red (Mito-ROS). Scale bar: 275 μm. (B) Percentage of cells positive for mitochondrial ROS stain MitoSOX Red. (C) Quantification of mitochondrial ROS with respect to intensity, Represented as percentage intensity. N = 3/group; p-values: **** ≤ 0.0001, *** ≤ 0.001, * ≤ 0.05. (D) TEM images showing changes in mitochondria (top panel) and sarcomere (bottom panel) as indicated by arrows in hiPSC-CMs treated with Dox (1 μM), Dox + Dex and Dox + TOP2B-KD groups.
These results collectively highlight that TOP2B-KD confers a dual protective effect in hiPSC-CMs by reducing apoptosis and normalizing cell cycle regulatory pathways, providing a more effective cardioprotective strategy than Dex.
4. Discussion
In this study, we demonstrate that siRNA-mediated knockdown of TOP2B in hiPSC-CMs protects these cells from Dox-induced cardiotoxicity. Previous studies have shown that Dox-induced toxicity occurs via TOP2B, the predominant isoform in cardiomyocytes [10]. Dex, the only FDA-approved drug for this purpose is known to reduce Dox-induced cardiotoxicity through TOP2B [19]. However, Dex has two major limitations: first, it’s not specific to TOP2B and also targets TOP2A [22], which can lead to resistance in tumor cells against chemotherapeutic agents like Dox [38]. Second, the prolonged use of Dex is linked to long-term side effects [39]. Lyu et al. demonstrated that TOP2B-deficient mouse embryonic fibroblasts were protected from Dox-induced cytotoxicity [16]. Additionally, TOP2B knockout studies in cardiomyocytes have shown cardiac dysfunction, making them difficult for translational applications [17,40]. Therefore, in this study, we specifically targeted TOP2B through siRNA to achieve cardio protection in vitro in hiPSC-CMs comparable to the effects of Dex [16,19]. The significant reduction in TOP2B expression observed following siRNA transfection, particularly in conjunction with Dox treatment, emphasizes the pivotal role of TOP2B in mediating Dox-induced DNA damage and subsequent cardiomyocyte apoptosis. This aligns with the mechanistic understanding that TOP2B facilitates Dox-induced double-strand breaks in cardiomyocytes, leading to cardiotoxicity [14].
Our functional assays further corroborate these molecular findings. siRNA-mediated TOP2B-KD resulted in a marked increase in cell viability and a concomitant reduction in cytotoxicity, as evidenced by MTT and LDH assays, respectively. Notably, these protective effects surpassed those provided by Dex, a clinically approved cardioprotective drug that functions by inhibiting TOP2B. This suggests that direct gene silencing of TOP2B through an RNAi approach may provide a more robust mechanism for mitigating Dox-induced cytotoxicity, potentially offering superior cardio protection relative to the catalytic inhibition conferred by Dex. Analysis of apoptosis using the TUNEL assay further substantiates the protective role of TOP2B-KD. Remarkably, siRNA-mediated knockdown of TOP2B significantly decreased the proportion of TUNEL-positive cells, whereas Dex failed to demonstrate a comparable effect. Moreover, the Bax/BCL-2 ratio, a well-established determinant of apoptotic susceptibility [32,33], was significantly attenuated in TOP2B-KD cells, suggesting a shift towards enhanced resistance to apoptosis. These findings align with the observed downregulation of key apoptotic mediators, including CASP3 and CASP9, in TOP2B-KD cells, in contrast to the upregulation seen in both Dox and Dox + Dex cells. The variation in the upregulation of these genes may lead to different cell fates, such as senescence [41-43]. The increased expression of CASP3 and CASP9 does not necessarily indicate apoptosis, as alternative cell fates can arise under extreme stress conditions, depending on the lethal and sublethal thresholds of these proteins [44-46]. This helps explain the observed increase in CASP3 and CASP9 expression in our data, despite the lack of significant cell death. While this study provides insights into the potential senescence-related effects of Dex and Dox treatment, further experiments are required to validate this hypothesis. Collectively, our results indicate that TOP2B-KD exerts anti-apoptotic effects, thereby preserving hiPSC-CMs viability under Dox-induced stress.
At the functional level, TOP2B-KD conferred notable protective effects on the electrophysiological activity of hiPSC-CMs, as demonstrated by multielectrode array (MEA) analysis. Our results corroborate previous studies showing that Dox treatment in cardiomyocytes decreases spike amplitude, increases beat rate, shortens FPD and decreases beat period [28]. In addition to this, we also observed a decline in conduction velocity and abnormal beating patterns, which are hallmarks of cardiotoxicity and arrhythmogenic potential. Strikingly, siRNA-mediated TOP2B-KD ameliorated these disruptions, with cells exhibiting more physiologically relevant beat periods, improved conduction velocity, and stable field potential duration (FPD) profiles that approached those of untreated control cells. The QT intervals and T-wave curves exhibited greater normalization following the TOP2B-KD compared to the treatment with Dex. These results highlight the potential of TOP2B-KD to restore electrophysiological homeostasis in Dox-exposed hiPSC-CMs, providing superior protection compared to Dex. Given the increased irregularity in beating observed in the MEA data, we evaluated the effects of the different treatments on intracellular calcium transients. Our findings demonstrate that Dox treatment significantly impairs calcium signaling in hiPSC-CMs, as evidenced by a reduction in transient amplitude. This reduction may reflect compromised calcium cycling, a hallmark of Dox-induced cardiotoxicity. The Dox + Dex treatment exacerbated calcium handling dysfunction by increasing transient duration and decay time, which could indicate slower calcium reuptake or prolonged calcium exposure in the cytosol. Such changes may contribute to the heightened stress on cellular calcium homeostasis observed in this group. Interestingly, despite the reductions in transient amplitude across all treatment groups, Dox + TOP2B-KD treatment mitigated irregular contractility and preserved normal calcium transient duration and decay time. This suggests that TOP2B knockdown provides a protective effect against Dox-induced cardiotoxicity. The reduction in time to peak in the Dox + TOP2B-KD and Dox + Dex groups could indicate alterations in calcium release kinetics. However, the irregular contractility seen in the Dox + Dex group, but not in Dox + TOP2B-KD treated cells, underscores the potential protective role of TOP2B inhibition in stabilizing excitation-contraction coupling. At the molecular level, we observed that the knockdown of TOP2B normalized the expression of key stress and cell cycle regulators, including p53, p21, and p16, which were elevated in response to Dox-induced genotoxic stress. In contrast, Dex pretreatment exacerbated the upregulation of these genes, suggesting the limitation for the use of Dex. Additionally, we also observed some restoration of cardiac troponin levels, which was downregulated by Dox treatment, following TOP2B-KD, suggesting the preservation of hiPSC-CMs structural integrity. This further supports the protective role of TOP2B inhibition in the context of Dox exposure.
To our knowledge, this is the first study to explore TOP2B silencing using siRNA to mitigate Dox-induced cardiotoxicity in hiPSC-CMs. Previous reports indicate that mitochondrial changes during Dox treatment are also dependent on TOP2B, and knockout of TOP2B protects mice against ROS and cardiotoxicity [17]. Several studies have also highlighted the role of oxidative stress and inflammation in Dox-induced cardiotoxicity [47,48]. Our study demonstrates that Dox treatment induces significant mitochondrial dysfunction in hiPSC-CMs. This was evidenced by an increase in MitoSOX Red staining, indicating enhanced ROS production, alongside disrupted mitochondrial morphology observed through TEM imaging. These findings suggest that Dox treatment leads to oxidative stress and mitochondrial damage, which are key contributors to the cardiotoxic effects associated with Dox treatment. Moreover, the addition of Dex to Dox treatment further exacerbated ROS generation and mitochondrial fragmentation, as observed in fluorescent image analysis. While Dex has been explored as a cardioprotective agent, its combination with Dox may worsen mitochondrial stress under certain conditions. Interestingly, the knockdown of TOP2B (Dox + TOP2B-KD) mitigated these effects, significantly reducing mitochondrial ROS levels and preserving mitochondrial structure. This highlights the potential role of TOP2B in mediating Dox-induced mitochondrial dysfunction, possibly by reducing Dox-TOP2B interactions that trigger oxidative stress and mitochondrial damage. TEM analysis also revealed improved sarcomere organization in the Dox + TOP2B-KD group, suggesting that TOP2B knockdown not only protects mitochondrial integrity but also maintains structural stability in hiPSC-CMs. This dual protective effect underscores the therapeutic potential of targeting TOP2B in reducing Dox-induced cardiotoxicity.
5. Conclusion
Overall, our study investigated the cardioprotective potential of TOP2B-KD using siRNA in Doxorubicin (Dox)-induced cardiotoxicity. However, long-term in vivo studies in animal models are necessary to fully explore the efficacy of siRNA-mediated TOP2B-KD as a strategy against Dox-induced cardiotoxicity for translational applications. Recent research has shown that Dox-related cardiotoxicity is linked to TOP2B, while Dex alleviates this cardiotoxicity by binding to the ATPase domain of TOP2, thereby depleting it [19,49]. Our study provides additional evidence that Dox-induced cardiotoxicity occurs via TOP2B and demonstrates that siRNA-mediated knockdown of TOP2B protects hiPSC-CMs from Dox-induced damage.
Supplementary Material
Supplementary data to this article can be found online at https://doi.org/10.1016/j.lfs.2025.123595.
Acknowledgements
We acknowledge resources from the Campus Microscopy and Imaging Facility (CMIF), and the OSU Comprehensive Cancer Center (OSUCCC) Microscopy Shared Resources (MSR), The Ohio State University (RRID:SCR_025078). This facility is supported in part by grant P30 CA016058, National Cancer Institute, Bethesda, MD. We acknowledge Muhamad Mergaye for all the technical and logistics support.
Funding
Dr. Khan is funded and supported by the National Heart, Lung, and Blood Institute Grants (R01-HL-157453 to MK) & National Institute of Arthritis and Musculoskeletal and Skin Diseases (R01-AR-080946 to MK) and OSU-COM Start-up funds to MK. Dr. Singla is funded by the National Cancer Institute Grant (R01-CA-221813 to DKS) and by the Endowed Chair Advent Health (DKS).
Declaration of competing interest
The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: Mahmood Khan reports financial support was provided by National Heart, Lung, and Blood Institute. Mahmood Khan reports financial support was provided by National Institute of Arthritis and Musculoskeletal and Skin Diseases. Mahmood Khan reports financial support was provided by The Ohio State University. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Abbreviations:
- ANTs
anthracyclines
- Dox
doxorubicin
- Dex
dexrazoxane
- TOP2
type II topoisomerases
- TOP2B
topoisomerase-2 beta
- TOP2A
topoisomerase-2 alpha
- hiPSC-CMs
human induced pluripotent stem cell derived cardiomyocytes
- siRNA
short interfering RNA
- KD
knockdown
- MTT
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide
- LDH
lactate dehydrogenase
- qRT-PCR
quantitative real-time PCR
- MEA
multielectrode array
- TUNEL
deoxynucleotidyl transferase dUTP nick end labeling
- RT
room temperature
- BSA
bovine serum albumin
- ROS
reactive oxygen species
- h
hour(s)
Footnotes
CRediT authorship contribution statement
Neha Saroj: Writing – original draft, Methodology, Investigation, Formal analysis. Pankaj Singh Dholaniya: Writing – review & editing, Writing – original draft, Supervision, Methodology, Investigation, Formal analysis, Conceptualization. Syed Baseeruddin Alvi: Writing – original draft, Methodology, Formal analysis. Divya Sridharan: Writing – original draft, Methodology, Formal analysis. Navisha Soni: Methodology, Formal analysis. Syed Abdullah Ashraf: Formal analysis. Ayza Choudhry: Methodology, Formal analysis. Yusuf Ali Ashraf: Formal analysis. Sarah Kathleen Mikula: Methodology. Dinender Kumar Singla: Writing – review & editing. Mahmood Khan: Writing – review & editing, Supervision, Resources, Project administration, Funding acquisition, Conceptualization.
Data availability
Data will be made available on request.
References
- [1].Volkova M, Russell R 3rd, Anthracycline cardiotoxicity: prevalence, pathogenesis and treatment, Curr, Cardiol. Rev 7 (2011) 214–220, 10.2174/157340311799960645. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [2].McGowan JV, Chung R, Maulik A, Piotrowska I, Walker JM, Yellon DM, Anthracycline chemotherapy and cardiotoxicity, Cardiovasc. Drugs Ther 31 (2017) 63–75, 10.1007/s10557-016-6711-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [3].Vavrova A, Jansova H, Mackova E, Machacek M, Haskova P, Tichotova L, Sterba M, Simunek T, Catalytic inhibitors of topoisomerase II differently modulate the toxicity of anthracyclines in cardiac and cancer cells, PLoS One 8 (2013) e76676, 10.1371/journal.pone.0076676. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [4].Morelli MB, Bongiovanni C, Da Pra S, Miano C, Sacchi F, Lauriola M, D’Uva G, Cardiotoxicity of anticancer drugs: molecular mechanisms and strategies for cardioprotection, Front Cardiovasc Med. 9 (2022) 847012, 10.3389/fcvm.2022.847012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [5].Yeh ET, Bickford CL, Cardiovascular complications of cancer therapy: incidence, pathogenesis, diagnosis, and management, J. Am. Coll. Cardiol 53 (2009) 2231–2247, 10.1016/j.jacc.2009.02.050. [DOI] [PubMed] [Google Scholar]
- [6].Mackay B, Ewer MS, Carrasco CH, Benjamin RS, Assessment of anthracycline cardiomyopathy by endomyocardial biopsy, Ultrastruct. Pathol 18 (1994) 203–211, 10.3109/01913129409016291. [DOI] [PubMed] [Google Scholar]
- [7].Drake FH, Zimmerman JP, McCabe FL, Bartus HF, Per SR, Sullivan DM, Ross WE, Mattern MR, Johnson RK, Crooke ST, et al. , Purification of topoisomerase II from amsacrine-resistant P388 leukemia cells, Evidence for two forms of the enzyme, J Biol Chem. 262 (1987) 16739–16747. [PubMed] [Google Scholar]
- [8].Sutormin DA, Galivondzhyan AK, Polkhovskiy AV, Kamalyan SO, Severinov KV, Dubiley SA, Diversity and functions of type II topoisomerases, Acta Nat. 13 (2021) 59–75, 10.32607/actanaturae.11058. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [9].Austin CA, Lee KC, Swan RL, Khazeem MM, Manville CM, Cridland P, Treumann A, Porter A, Morris NJ, Cowell IG, TOP2B: the first thirty years, Int. J. Mol. Sci 19 (2018), 10.3390/ijms19092765. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [10].Uuskula-Reimand L, Wilson MD, Untangling the roles of TOP2A and TOP2B in transcription and cancer, Sci. Adv 8 (2022) eadd4920, 10.1126/sciadv.add4920. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [11].Henriksen PA, Anthracycline cardiotoxicity: an update on mechanisms, monitoring and prevention, Heart 104 (2018) 971–977, 10.1136/heartjnl-2017-312103. [DOI] [PubMed] [Google Scholar]
- [12].Marinello J, Delcuratolo M, Capranico G, Anthracyclines as topoisomerase II poisons: from early studies to new perspectives, Int. J. Mol. Sci 19 (2018), 10.3390/ijms19113480. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [13].Pommier Y, Schwartz RE, Kohn KW, Zwelling LA, Formation and rejoining of deoxyribonucleic acid double-strand breaks induced in isolated cell nuclei by antineoplastic intercalating agents, Biochemistry 23 (1984) 3194–3201, 10.1021/bi00309a013. [DOI] [PubMed] [Google Scholar]
- [14].Tewey KM, Rowe TC, Yang L, Halligan BD, Liu LF, Adriamycin-induced DNA damage mediated by mammalian DNA topoisomerase II, Science 226 (1984) 466–468, 10.1126/science.6093249. [DOI] [PubMed] [Google Scholar]
- [15].Suryani LK, Jensen GD, Psychiatrist, traditional healer and culture integrated in clinical practice in Bali, Med. Anthropol 13 (1992) 301–314, 10.1080/01459740.1992.9966054. [DOI] [PubMed] [Google Scholar]
- [16].Lyu YL, Kerrigan JE, Lin CP, Azarova AM, Tsai YC, Ban Y, Liu LF, Topoisomerase IIbeta mediated DNA double-strand breaks: implications in doxorubicin cardiotoxicity and prevention by dexrazoxane, Cancer Res. 67 (2007) 8839–8846, 10.1158/0008-5472.CAN-07-1649. [DOI] [PubMed] [Google Scholar]
- [17].Zhang S, Liu X, Bawa-Khalfe T, Lu LS, Lyu YL, Liu LF, Yeh ET, Identification of the molecular basis of doxorubicin-induced cardiotoxicity, Nat. Med 18 (2012) 1639–1642, 10.1038/nm.2919. [DOI] [PubMed] [Google Scholar]
- [18].Hasinoff BB, Herman EH, Dexrazoxane: how it works in cardiac and tumor cells. Is it a prodrug or is it a drug? Cardiovasc. Toxicol 7 (2007) 140–144, 10.1007/s12012-007-0023-3. [DOI] [PubMed] [Google Scholar]
- [19].Jirkovsky E, Jirkovska A, Bavlovic-Piskackova H, Skalicka V, Pokorna Z, Karabanovich G, Kollarova-Brazdova P, Kubes J, Lencova-Popelova O, Mazurova Y, Adamcova M, Lyon AR, Roh J, Simunek T, Sterbova-Kovarikova P, Sterba M, Clinically translatable prevention of anthracycline cardiotoxicity by dexrazoxane is mediated by topoisomerase II beta and not metal chelation, Circ. Heart Fail 14 (2021) e008209, 10.1161/CIRCHEARTFAILURE.120.008209. [DOI] [PubMed] [Google Scholar]
- [20].Roca J, Ishida R, Berger JM, Andoh T, Wang JC, Antitumor bisdioxopiperazines inhibit yeast DNA topoisomerase II by trapping the enzyme in the form of a closed protein clamp, Proc. Natl. Acad. Sci. USA 91 (1994) 1781–1785, 10.1073/pnas.91.5.1781. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [21].Classen S, Olland S, Berger JM, Structure of the topoisomerase II ATPase region and its mechanism of inhibition by the chemotherapeutic agent ICRF-187, Proc. Natl. Acad. Sci. USA 100 (2003) 10629–10634, 10.1073/pnas.1832879100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [22].Deng S, Yan T, Jendrny C, Nemecek A, Vincetic M, Godtel-Armbrust U, Wojnowski L, Dexrazoxane may prevent doxorubicin-induced DNA damage via depleting both topoisomerase II isoforms, BMC Cancer 14 (2014) 842, 10.1186/1471-2407-14-842. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [23].Friedrich M, Aigner A, Therapeutic siRNA: state-of-the-art and future perspectives, BioDrugs 36 (2022) 549–571, 10.1007/s40259-022-00549-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [24].Citro L, Naidu S, Hassan F, Kuppusamy ML, Kuppusamy P, Angelos MG, Khan M, Comparison of human induced pluripotent stem-cell derived cardiomyocytes with human mesenchymal stem cells following acute myocardial infarction, PLoS One 9 (2014) e116281, 10.1371/journal.pone.0116281. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [25].Khan M, Xu Y, Hua S, Johnson J, Belevych A, Janssen PM, Gyorke S, Guan J, Angelos MG, Evaluation of changes in morphology and function of human induced pluripotent stem cell derived cardiomyocytes (HiPSC-CMs) cultured on an aligned-nanofiber cardiac patch, PLoS One 10 (2015) e0126338, 10.1371/journal.pone.0126338. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [26].Alvi SB, Sridharan D, Shalaan MT, Sanghvi SK, Mergaye M, Ahmed U, Mikula SK, Singh H, Khan M, Modulation of mitochondrial bioenergetics by polydopamine nanoparticles in human iPSC-derived cardiomyocytes, ACS Appl. Mater. Interfaces 14 (2022) 53451–53461, 10.1021/acsami.2c12575. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [27].Kumar N, Sridharan D, Palaniappan A, Dougherty JA, Czirok A, Isai DG, Mergaye M, Angelos MG, Powell HM, Khan M, Scalable biomimetic coaxial aligned nanofiber cardiac patch: a potential model for “clinical trials in a dish”, Front. Bioeng. Biotechnol 8 (2020) 567842 10.3389/fbioe.2020.567842. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [28].Maillet A, Tan K, Chai X, Sadananda SN, Mehta A, Ooi J, Hayden MR, Pouladi MA, Ghosh S, Shim W, Brunham LR, Modeling doxorubicin-induced cardiotoxicity in human pluripotent stem cell derived-cardiomyocytes, Sci. Rep 6 (2016) 25333, 10.1038/srep25333. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [29].Zhang X, Zhu JX, Ma ZG, Wu HM, Xu SC, Song P, Kong CY, Yuan YP, Deng W, Tang QZ, Rosmarinic acid alleviates cardiomyocyte apoptosis via cardiac fibroblast in doxorubicin-induced cardiotoxicity, Int. J. Biol. Sci 15 (2019) 556–567, 10.7150/ijbs.29907. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [30].Zhang X, Hu C, Kong CY, Song P, Wu HM, Xu SC, Yuan YP, Deng W, Ma ZG, Tang QZ, FNDC5 alleviates oxidative stress and cardiomyocyte apoptosis in doxorubicin-induced cardiotoxicity via activating AKT, Cell Death Differ. 27 (2020) 540–555, 10.1038/s41418-019-0372-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [31].Sridharan D, Dougherty JA, Ahmed U, Sanghvi SK, Alvi SB, Park KH, Islam H, Knoblaugh SE, Singh H, Kirby ED, Khan M, Bioorthogonal non-canonical amino acid tagging to track transplanted human induced pluripotent stem cell-specific proteome, Stem Cell Res Ther 15 (2024) 186, 10.1186/s13287-024-03792-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [32].Vaskivuo TE, Stenback F, Tapanainen JS, Apoptosis and apoptosis-related factors Bcl-2, Bax, tumor necrosis factor-alpha, and NF-kappaB in human endometrial hyperplasia and carcinoma, Cancer 95 (2002) 1463–1471, 10.1002/cncr.10876. [DOI] [PubMed] [Google Scholar]
- [33].Gao C, Wang AY, Significance of increased apoptosis and Bax expression in human small intestinal adenocarcinoma, J. Histochem. Cytochem 57 (2009) 1139–1148, 10.1369/jhc.2009.954446. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [34].Golestani Eimani B, Sanati MH, Houshmand M, Ataei M, Akbarian F, Shakhssalim N, Expression and prognostic significance of bcl-2 and bax in the progression and clinical outcome of transitional bladder cell carcinoma, Cell J. 15 (2014) 356–363. [PMC free article] [PubMed] [Google Scholar]
- [35].Azimian H, Dayyani M, Toossi MTB, Mahmoudi M, Bax/Bcl-2 expression ratio in prediction of response to breast cancer radiotherapy, Iran J Basic, Med. Sci 21 (2018) 325–332, 10.22038/ijbms.2018.26179.6429. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [36].Karaliotas GI, Mavridis K, Scorilas A, Babis GC, Quantitative analysis of the mRNA expression levels of BCL2 and BAX genes in human osteoarthritis and normal articular cartilage: an investigation into their differential expression, Mol. Med. Rep 12 (2015) 4514–4521, 10.3892/mmr.2015.3939. [DOI] [PubMed] [Google Scholar]
- [37].Paul-Samojedny M, Kokocińska D, Samojedny A, Mazurek U, Partyka R, Lorenz Z, Wilczok T, Expression of cell survival/death genes: Bcl-2 and Bax at the rate of colon cancer prognosis, Biochim. Biophys. Acta 1741 (2005) 25–29, 10.1016/j.bbadis.2004.11.021. [DOI] [PubMed] [Google Scholar]
- [38].Hasinoff BB, Yalowich JC, Ling Y, Buss JL, The effect of dexrazoxane (ICRF-187) on doxorubicin- and daunorubicin-mediated growth inhibition of Chinese hamster ovary cells, Anti-Cancer Drugs 7 (1996) 558–567, 10.1097/00001813-199607000-00011. [DOI] [PubMed] [Google Scholar]
- [39].Eneh C, Lekkala MR, Dexrazoxane, in: StatPearls, (Treasure Island (FL)). [Google Scholar]
- [40].Moudgil R, Samra G, Ko KA, Vu HT, Thomas TN, Luo W, Chang J, Reddy AK, Fujiwara K, Abe JI, Topoisomerase 2B decrease results in diastolic dysfunction via p53 and Akt: a novel pathway, Front Cardiovasc Med. 7 (2020) 594123, 10.3389/fcvm.2020.594123. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [41].Eskandari E, Eaves CJ, Paradoxical roles of caspase-3 in regulating cell survival, proliferation, and tumorigenesis, J. Cell Biol 221 (2022), 10.1083/jcb.202201159. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [42].Zhang JH, Zhang Y, Herman B, Caspases, apoptosis and aging, Ageing Res. Rev 2 (2003) 357–366, 10.1016/s1568-1637(03)00026-6. [DOI] [PubMed] [Google Scholar]
- [43].Zhang Y, Chong E, Herman B, Age-associated increases in the activity of multiple caspases in Fisher 344 rat organs, Exp. Gerontol 37 (2002) 777–789, 10.1016/s0531-5565(02)00013-x. [DOI] [PubMed] [Google Scholar]
- [44].Baena-Lopez LA, Arthurton L, Xu DC, Galasso A, Non-apoptotic Caspase regulation of stem cell properties, Semin. Cell Dev. Biol 82 (2018) 118–126, 10.1016/j.semcdb.2017.10.034. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [45].Haimovici A, Rupp V, Amer T, Moeed A, Weber A, Hacker G, The caspase-activated DNase promotes cellular senescence, EMBO J. 43 (2024) 3523–3544, 10.1038/s44318-024-00163-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [46].Ichim G, Lopez J, Ahmed SU, Muthalagu N, Giampazolias E, Delgado ME, Haller M, Riley JS, Mason SM, Athineos D, Parsons MJ, van de Kooij B, Bouchier-Hayes L, Chalmers AJ, Rooswinkel RW, Oberst A, Blyth K, Rehm M, Murphy DJ, Tait SWG, Limited mitochondrial permeabilization causes DNA damage and genomic instability in the absence of cell death, Mol. Cell 57 (2015) 860–872, 10.1016/j.molcel.2015.01.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [47].Hu C, Zhang X, Song P, Yuan YP, Kong CY, Wu HM, Xu SC, Ma ZG, Tang QZ, Meteorin-like protein attenuates doxorubicin-induced cardiotoxicity via activating cAMP/PKA/SIRT1 pathway, Redox Biol. 37 (2020) 101747, 10.1016/j.redox.2020.101747. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [48].Hu M, Zhang X, Hu C, Ma ZG, Wang SS, Teng T, Zeng XF, Tang QZ, Isthmin-1 alleviates cardiac ischaemia/reperfusion injury through cGMP-PKG signalling pathway, Cardiovasc. Res 120 (2024) 1051–1064, 10.1093/cvr/cvae077. [DOI] [PubMed] [Google Scholar]
- [49].Kerestes V, Kubes J, Applova L, Kollarova P, Lencova-Popelova O, Melnikova I, Karabanovich G, Khazeem MM, Bavlovic-Piskackova H, Sterbova-Kovarikova P, Austin CA, Roh J, Sterba M, Simunek T, Jirkovska A, Exploring the effects of topoisomerase II inhibitor XK469 on anthracycline cardiotoxicity and DNA damage, Toxicol. Sci 198 (2024) 288–302, 10.1093/toxsci/kfae008. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Data will be made available on request.
