Abstract
Objective
To assess the prevalence of the GJB2 c.35delG mutation among Moroccan patients with nonsyndromic sensorineural hearing loss (NSHL) and compare it with frequencies reported in other North African populations.
Study Design
Retrospective cohort study.
Setting
Multidisciplinary tertiary care hearing loss genetics clinic.
Methods
A total of 304 unrelated Moroccan patients with prelingual bilateral (NSHL), recruited between May 2022 and June 2025, were included. Genomic Deoxyribonucleic Acid (DNA) was extracted from peripheral blood samples, and the c.35delG mutation was detected via PCR amplification and Sanger sequencing. Demographic and clinical data, including age at diagnosis, sex, and family history, were systematically collected.
Results
The c.35delG mutation contributed to 18% of (NSHL) cases in this cohort, with homozygosity being the most frequent genotype. The mutation was especially prevalent in patients from consanguineous families. Clinically, hearing loss was early‐onset, bilateral, and mostly profound, demonstrating a strong genotype‐phenotype correlation. The observed frequency aligns with regional data from other North African populations, reflecting a shared genetic background.
Conclusion
The c.35delG mutation is a major cause of (NSHL) in Morocco, though slightly less frequent than reported in previous national studies. These findings support incorporating GJB2 genetic screening into early diagnostics, genetic counseling, and targeted prevention programs, particularly in populations with high consanguinity rates.
Keywords: c.35delG Mutation, Gap Junction Beta‐2 (GJB2), molecular epidemiology, Moroccan Population, Non‐Syndromic Hearing Loss (NSHL)
Hearing loss is the most common sensory impairment in the world, affecting more than 466 million people, including 34 million children, according to the World Health Organization (WHO). Its prevalence varies, but it is estimated that approximately 1 in 1000 newborns has severe to profound congenital hearing loss. 1 This global health and social burden highlight the importance of early screening and etiological investigations to optimize patient care. 2
It is now well established that more than (50% of cases) of congenital hearing loss are genetic in origin, of which approximately 70% are nonsyndromic hearing loss (NSHL). 3 , 4 Nonsyndromic hearing loss can follow different inheritance patterns: autosomal recessive transmission 80%, autosomal dominant transmission 15% to 20%, X‐linked transmission, and mitochondrial transmission (less than 5%). 1
Among the genes involved in autosomal recessive non‐syndromic hearing loss (ARNSHL), the GJB2 gene, which encodes for connexin 26, plays a major role. This gene, located on the DFNB1 locus (13q12), is responsible for nearly 50% of familial cases and 15% to 30% of sporadic cases of congenital sensorineural hearing loss in several populations. 5 , 6 Mutations in the GJB2 gene alter the channels of intercellular gap junctions, which are essential for cochlear ion homeostasis. 7
The c.35delG mutation in the GJB2 gene, which causes a frameshift mutation and the production of a truncated, nonfunctional protein, is particularly common in European and Mediterranean populations. 8 It is considered a founder mutation, with a carrier frequency of 2% to 4% in Southern Europe and the Mediterranean basin. 6 , 9 Its high prevalence suggests a common ancestral origin and a strong founder effect.
In the Maghreb region, several studies have confirmed the prevalence of the c.35delG mutation. In Algeria, it accounts for approximately (26.2% of cases) of nonsyndromic hearing loss. 10 In Tunisia, its frequency is estimated at approximately 21.5%, 11 while in Mauritania, it reaches 5.6%. 12 These data highlight both the heterogeneous geographic distribution and the major etiological role of this mutation throughout the region.
In Morocco, several studies have demonstrated the significant contribution of the GJB2 gene. In a cohort of multiplex families, the c.35delG mutation was identified in 33.6% of cases. 13 Other studies have reported frequencies of approximately 21.7% in targeted cohorts. 14 , 15 However, most Moroccan research has focused on familial cases or relatively small cohorts, resulting in a lack of representative data in the general population with nonsyndromic hearing loss (NSHL). Given this heterogeneity, there is a need for reliable and representative data for Morocco. This study, conducted in a large cohort of unrelated Moroccan patients with nonsyndromic sensorineural hearing loss (NSHL), aims to estimate the true frequency of the c.35delG mutation and assess its epidemiological significance. The findings provide new insights into the genetic landscape of hearing loss in the region and have direct implications for molecular screening, genetic counseling, and public health strategies in North African.
Methods
Study Population
This study, conducted between May 2022 and June 2025, included 304 unrelated Moroccan patients with prelingual, bilateral hearing loss and no clinical signs suggestive of an associated syndrome. This study was conducted in accordance with the ethical principles of the Declaration of Helsinki. Peripheral blood samples and clinical data were collected as part of routine diagnostic procedures for patients with suspected genetic hearing loss. Written informed consent was obtained from all participants or from their legal guardians prior to genetic analysis. According to institutional policies, the use of anonymized samples collected during routine diagnostic testing did not require formal approval from an institutional review board. All patient data were anonymized to ensure confidentiality.
Clinical Exploration
Each patient underwent a detailed clinical evaluation, which included the collection of information on the presence of consanguinity, age of onset of hearing loss, type and progression of hearing loss, and laterality. Audiological assessments included pure‐tone audiometry, and imaging studies such as computed tomography (CT) and magnetic resonance imaging (MRI) of the petrous bones were performed.
Molecular Analysis
Genomic DNA was extracted from whole blood using the PureLink® Genomic DNA Mini Kit (Invitrogen). The concentration and purity of the extracted DNA were assessed using a NanoVue Plus UV‐Vis Spectrophotometer (GE Healthcare) and a Qubit™ 4 Fluorometer (Thermo Fisher Scientific).
Exon 2 of the GJB2 gene was amplified by conventional PCR using 100 ng of genomic DNA per reaction. The primers used were: Forward (5′‐GCAAACCGCCCAGAGTAGAAG‐3′) and Reverse (5′‐GGACACGAAGATCAGCTGCAG‐3′). The PCR protocol consisted of an initial denaturation at 96°C for 5 minutes, followed by 40 cycles of denaturation at 96°C for 30 seconds, annealing at 63°C for 30 seconds, and extension at 72°C for 30 seconds, with a final extension at 72°C for 5 minutes.
Amplicon presence was confirmed by electrophoresis on a 2% agarose gel. PCR products were then purified using the ExoSAP‐IT™ PCR Product Cleanup Reagent Kit (Thermo Fisher Scientific). Sequencing reactions were performed using the dGTP BigDye™ Terminator v3.0 Ready Reaction Cycle Sequencing Kit, followed by purification with the BigDye XTerminator™ Purification Kit.
Capillary electrophoresis was carried out on an ABI 3500 Genetic Analyzer (Applied Biosystems; 8‐capillary Array), and electropherograms were analyzed using SeqA software.
Results
Demographic and Clinical Features
This study analyzed a cohort of 304 individuals, showing an almost equal sex distribution: 51% male and 49% female. The majority of patients 53.9% were diagnosed between the ages of 5 and 10 years, while 32.6% were older than 10 years and 12.8% were younger than 5 years Table 1.
Table 1.
Demographic, Clinical, and Inheritance Characteristics of the Study Cohort
| Characteristic | Number | Percentage (%) |
|---|---|---|
| Sex | ||
| Male | 155 | 51.0 |
| Female | 149 | 49.0 |
| Age when ordered (years) | ||
| Age <5 | 39 | 12.8 |
| Age 5‐10 | 164 | 53.9 |
| Age >10 | 99 | 32.6 |
| NP | 2 | 0.7 |
| Family history | ||
| Familial cases | 106 | 34.9 |
| Sporadic cases | 195 | 64.1 |
| NP | 3 | 1.0 |
| Consanguinity | ||
| Consanguineous cases | 147 | 48.3 |
| Non‐Consanguineous cases | 153 | 50.4 |
| NP | 4 | 1.3 |
Abbreviation: NP, not reported.
Family History and Consanguinity
Familial cases accounted for 34.9% of the cohort, while sporadic cases were more frequent, comprising 64.1%. A consanguinity rate of 48.3% was observed among patients, whereas 50.4% were born to unrelated parents Table 1, underscoring the significant contribution of consanguineous unions in this study population.
Genotype Frequencies
The (c.35delG−/c.35delG−) wild genotype was the most common, observed in 81.2% of the cohort (247 individuals). The c.35delG homozygous mutated genotype (c.35delG+/c.35delG+) was present in 16.5% (50 individuals), and the heterozygous genotype (c.35delG+/c.35delG‐) was found in 2.3% (7 individuals) Figure 1 and Table 2.
Figure 1.
Electropherograms illustrating the c.35delG mutation in the GJB2 gene.
Table 2.
Genotype Frequencies within the Study Cohort
| Genotype | Number | Percentage (%) |
|---|---|---|
| c.35delG−/c.35delG− | 247 | 81.2 |
| c.35delG+/c.35delG− | 7 | 2.3 |
| c.35delG+/c.35delG+ | 50 | 16.5 |
Genotype Distribution
In familial cases, the wild genotype (c.35delG−/c.35delG−) accounted for 77.4%, while in sporadic cases, it was observed in 83.1%. The mutated homozygous genotype (c.35delG+/c.35delG+) was identified in 18.9% of familial cases and 15.4% of sporadic cases. The heterozygous genotype (c.35delG+/c.35delG−) was less common, accounting for 3.7% of familial cases and 1.5% of sporadic cases Figure 2.
Figure 2.
Distribution of genotypes (Familial vs. Sporadic Cases). (A) Wild‐type genotype. (B) Homozygous mutant genotype. (C) Heterozygous genotype.
Allele Frequencies
The frequency of the normal allele (c.35delG−) was 82%, while that of the mutant allele (c.35delG+) was 18%.
Geographical Distribution
The majority of cases 73.3% originated from the Marrakech‐Safi region, followed by Drâa‐Tafilalet 9.5% and Béni Mellal‐Khénifra 7.2%. Other regions accounted for smaller proportions, with Fez‐Meknes having the lowest representation at 0.3% Figure 3.
Figure 3.
Geographic distribution of cases by region in Morocco.
Clinical and Audiometric Profile of c.35delG Mutation Carriers
In the studied Moroccan cohort, the clinical and audiometric characteristics of patients with the c.35delG mutation in the GJB2 gene revealed several consistent patterns. The majority of patients 47.4% were diagnosed with hearing loss between 1 and 2 years of age, with a significant portion 35.1% diagnosed between 2 and 4 years. Referrals were primarily due to speech and language delay 70.2% and a lack of auditory responsiveness 29.8%. The hearing loss was predominantly nonprogressive 89.5% and bilateral symmetric 94.7%. A striking 94.8% of these patients experienced profound hearing loss, while only a small minority had moderate 1.7% or severe 3.5% forms. Furthermore, over half of the patients 56.1% had undergone cochlear implantation. These findings collectively highlight the early onset, severe, and stable nature of hearing loss associated with the c.35delG mutation in this population, often necessitating early intervention through cochlear implants Table 3.
Table 3.
Clinical and Audiometric Characteristics of Patients Carrying the c.35delG Mutation in the GJB2 Gene Included in the Present Study
| Clinical and audiometric Characteristic | Number | Percentage (%) |
|---|---|---|
| Age at diagnosis | ||
| 6‐12 months | 9 | 15.8 |
| 1‐2 years | 27 | 47.4 |
| 2‐4 years | 20 | 35.1 |
| NP | 1 | 1.7 |
| Reason for referral | ||
| Lack of auditory responsiveness | 17 | 29.8 |
| Speech and language delay | 40 | 70.2 |
| Course of hearing loss | ||
| Progressive | 6 | 10.5 |
| Nonprogressive | 51 | 89.5 |
| Laterality | ||
| Bilateral symmetric | 54 | 94.7 |
| Bilateral asymmetric | 3 | 5.3 |
| Unilateral | 0 | 0 |
| Severity of hearing loss | ||
| Moderate | 1 | 1.7 |
| Severe | 2 | 3.5 |
| Profound | 54 | 94.8 |
| Cochlear implantation status | ||
| Implanted | 32 | 56.1 |
| NP | 25 | 43.9 |
Audiometric Profile of c.35delG Homozygous Patients
Figure 4 illustrates the audiometric profile of a patient identified as homozygous for the c.35delG mutation in the GJB2 gene. Panels A and B present the preimplantation audiograms for the right and left ears, respectively, revealing a notable gap between the air‐conduction (AC) and bone‐conduction (BC) thresholds. This observation suggests the presence of a mixed hearing loss component, which could be attributed to variations in ossicular transmission or subtle cochlear adaptations associated with the c.35delG mutation, despite the primary sensorineural nature of the condition. Figure 5 displays the free‐field audiometric thresholds measured after cochlear implantation, demonstrating a significant improvement in auditory perception. These postimplantation results indicate the efficacy of cochlear implants in patients with this specific mutation, consistent with the preservation of cochlear pathophysiology and the absence of ossicular malformations.
Figure 4.
Preimplantation audiograms profile of a patient homozygous for the c.35delG mutation in the GJB2 gene. (A) Left ear audiogram. (B) Right ear audiogram.
Figure 5.
Free‐field audiometric thresholds after cochlear implantation.
Discussion
This study of 304 Moroccan patients with NSHL highlights the High prevalence of the c.35delG mutation in the GJB2 gene, particularly among homozygous individuals. The high frequency of this mutation, which is associated with a significant proportion of consanguineous cases 48.3%, emphasizes the substantial influence of consanguineous marriages on the transmission of this mutation in the North Africa region, reflecting trends observed worldwide. The demographic profile reveals an equal distribution between male and female, indicating no gender bias in the occurrence of this mutation. Furthermore, the average age at diagnosis, primarily between 1 and 2 years (47.4% of cases), underscores the critical importance of early screening strategies to optimize care and auditory rehabilitation.
A phenotype‐genotype analysis of the data in Table 3 and Figure 4 shows that most patients with the c.35delG mutation have symmetrical, non‐progressive, profound bilateral hearing loss. Preoperative audiometric thresholds generally ranged from 70 to 110 dB across all tested frequencies, indicating severe cochlear conduction impairment. Notably, the near‐complete absence of wave V at 100 dB suggests significant alterations in synaptic transmission at the spiral ganglion and auditory brainstem levels, consistent with the pathophysiology of hearing loss associated with GJB2 gene mutations. These observations corroborate the findings of (Del Castillo et al) 6 , 16 , who demonstrated that the c.35delG mutation results in the loss of function of connexin 26. This disrupts potassium circulation in the cochlea, but does not affect bone or vestibular structures. This is consistent with the absence of abnormalities detected by (CT) and (MRI) scans of the petrous bones. A normal temporal bone was observed in 99% of the patients included in this study, further supporting the absence of structural inner ear abnormalities associated with the c.35delG mutation.
A notable feature of the preoperative audiograms (A) and (B) in Figure 4 is the observed shift between the AC and BC curves. In typical sensorineural hearing loss, these curves usually overlap, indicating normal mechanical transmission in the middle ear. The discrepancy observed in some of our patients suggests the presence of a mixed component, which could result from variations in ossicular transmission or slight cochlear adaptations related to the c.35delG mutation. Although modest, this discrepancy could account for certain differences in thresholds prior to implantation, as has been reported in other studies of GJB2 patients. 17 The postoperative section in Figure 5 demonstrates the effectiveness of cochlear implantation, showing a significant improvement in hearing thresholds of generally between 20 and 40 dB. These results confirm that patients with the c.35delG mutation respond favorably to cochlear implants. 18 This is consistent with preserved cochlear pathophysiology and an absence of ossicular malformations. Furthermore, the lack of significant hearing loss progression over time emphasizes the importance of early intervention and reinforces the value of neonatal screening and targeted auditory rehabilitation in this genetically defined group.
The frequency of the c.35delG mutation in the GJB2 gene shows notable variation across North African populations. In Morocco, this mutation is found in approximately 36% of patients with nonsyndromic congenital hearing loss, making it the most common mutation in this population. 13 , 19 This frequency is comparable to that observed in Algeria 26.2%, 10 where the c.35delG mutation is also one of the main causes of nonsyndromic congenital hearing loss, although the available estimates remain limited by the size of the cohorts studied. In Tunisia, a slightly lower frequency has been reported, at around 22.5%. 11 In Egypt, Mohammed M Sayed‐Ahmed et al reported a comparable prevalence of approximately 10.8% among patients with nonsyndromic hearing loss. 20 Furthermore, recent data from Mauritania indicate a significantly lower prevalence, with only 5.6% of cases attributed to this mutation. 16 However, no precise data are available for Libya, highlighting a lack of information in this neighboring country. The inclusion of the Libyan population in future genetic studies would be essential to complete the regional epidemiological map. This inter‐country variation within the North Africa highlights both regional genetic heterogeneity and the likely influence of demographic factors, including differences in consanguineous practices and diversity of ethnic origins Table 4.
Table 4.
Allele Frequencies of the c.35delG Mutation in the GJB2 Gene Across the Countries of the North African
| Country | Number of patients | Mutation frequency (%) | References |
|---|---|---|---|
| Present study | 304 | 18% | — |
| Morocco (previous study) | 152 | 36.8% | 13 |
| Algeria | 80 | 26.2% | 10 |
| Tunisia | 102 | 22.5% | 11 |
| Mauritania | 53 | 5.6% | 16 |
| Egypt | 13 | 10.8% | 20 |
In our study, the frequency of the c.35delG mutation in the GJB2 gene reached 18%, confirming its predominant role in NSHL in Morocco. Although this frequency is slightly lower than those reported in other Moroccan studies, it remains epidemiologically significant. Indeed, Adadey et al reported a frequency of 31.5% in familial cases and 20.5% in sporadic cases. 21 While Bakhchane et al found an even higher proportion 33.5%, in a cohort of multiplex families. 13 These variations can be explained by sample size, the nature of the cohorts studied (familial vs sporadic), and regional differences related to the prevalence of consanguinity. Thus, despite a lower frequency than that observed in other Moroccan series, our results, based on a large and representative cohort, reinforce the relevance of this mutation as a priority target for the molecular diagnosis of nonsyndromic hearing loss in Morocco. The presence of the c.35delG mutation in nearly 1 in 5 patients underscores its clinical relevance and public health significance, particularly in informing early screening and genetic counseling strategies in populations with high rates of consanguinity.
These data suggest a common Mediterranean origin for the c.35delG mutation, likely associated with ancient migratory events in the region. Studies estimate that the mutation emerged in the Mediterranean region around 10,000 to 14,000 years ago, before spreading to Europe and Asia via Neolithic migrations. The presence of the mutation in Mediterranean populations, particularly in Southern Europe, and its high frequency in North African populations reinforce this hypothesis. 22 These observations underscore the importance of a regional approach to genetic screening for nonsyndromic congenital hearing loss. Given the mutation's high prevalence in these countries, targeted screening could enable early detection of cases, facilitating appropriate care and improving patients audiological and developmental outcomes.
To date, this study constitutes the largest Moroccan cohort investigated for the c.35delG mutation and provides the most comprehensive dataset currently available on the epidemiological and genetic landscape of NSHL in Morocco. These findings offer robust and population‐representative evidence that significantly advances the understanding of hereditary hearing loss within this setting.
Importantly, this work establishes a solid framework for future cohort expansion, which will be essential to increase statistical power, refine genotype‐phenotype correlations, and uncover additional genes contributing to genetic hearing loss across the North African region. Systematic sequencing of the entire GJB2 gene, together with the exploration of other relevant deafness‐associated genes, is expected to further elucidate disease‐causing molecular mechanisms and substantially enhance the precision of genetic diagnosis.
Collectively, these results underscore the urgent need to integrate molecular diagnostics into the standard clinical management of congenital hearing loss in Morocco. Beyond reaffirming the pivotal role of the c.35delG mutation, this study positions early genetic screening as a key pillar for improving patient outcomes, enabling timely interventions, and shaping future research and public health strategies.
Conclusion
In this cohort of 304 Moroccan patients with NSHL, we confirm the high prevalence of the c.35delG mutation in the GJB2 gene and its strong association with consanguinity, highlighting the major role of autosomal recessive inheritance in this population. Affected individuals predominantly exhibited symmetrical, non‐progressive, profound bilateral hearing loss without inner ear malformations, consistent with GJB2‐related deafness.
The frequency of the c.35delG mutation, comparable to that reported in other North African and Mediterranean populations, supports a shared ancestral origin and underscores the need for population‐adapted genetic screening strategies. These findings strongly support the integration of early genetic testing, ideally within neonatal hearing screening programs, to enable timely diagnosis, appropriate genetic counseling, and improved clinical outcomes.
Author Contributions
El Mostafa Salman, conduct, analysis, writing, editing, presentation of research; Meriem El Qabli, conduct, analysis, editing, revision; Loubna Soufian, genetic consulting, conduct, analysis, revision; Maria Mansouri, genetic consulting, analysis, revision; Fatima Zahrae Bouzid, genetic consulting, analysis, revision; Omar Oulghoul, ENT consulting, revision; Mohamed Chehbouni, ENT consulting, revision; Youssef Lakhdar, ENT consulting, revision; Youssef Rochdi, ENT consulting, revision; Abdelaziz Raji, participation in the study design, editing, analysis, revision; Nisrine Aboussair, design, analysis, writing, editing, revision, presentation of research.
Disclosures
Competing interests
None.
Funding source
This study was supported by the operating budget of the Genetics Department, Clinical Research Center, Mohammed VI University Hospital, Marrakech.
Acknowledgments
The author's express their sincere gratitude to the participants and to the technical team of the Departments of Genetics and Otorhinolaryngology for their invaluable support and collaboration throughout this study.
Contributor Information
El Mostafa Salman, Email: e.salman.ced@uca.ac.ma.
Nisrine Aboussair, Email: nisrine.aboussair@uca.ac.ma.
References
- 1. Morton CC, Nance WE. Newborn hearing screening—a silent revolution. N Engl J Med. 2006;354(20):2151‐2164. 10.1056/NEJMra050700 [DOI] [PubMed] [Google Scholar]
- 2. Fortnum HM, Summerfield AQ, Marshall DH, Davis AC, Bamford JM. Prevalence of permanent childhood hearing impairment in the United Kingdom and implications for universal neonatal hearing screening: questionnaire based ascertainment study. BMJ (Clinical research ed.). 2001;323(7312):536‐540. 10.1136/bmj.323.7312.536 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Smith RJ, Bale JF, White KR. Sensorineural hearing loss in children. Lancet. 2005;365(9462):879‐890. 10.1016/S0140-6736(05)71047-3 [DOI] [PubMed] [Google Scholar]
- 4. Angeli S, Lin X, Liu XZ. Genetics of hearing and deafness. Anat Rec. 2012;295(11):1812‐1829. 10.1002/ar.22579 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Kelsell DP, Dunlop J, Stevens HP, et al. Connexin 26 mutations in hereditary non‐syndromic sensorineural deafness. Nature. 1997;387(6628):80‐83. 10.1038/387080a0 [DOI] [PubMed] [Google Scholar]
- 6. Snoeckx RL, Huygen PLM, Feldmann D, et al. Gjb2 mutations and degree of hearing loss: a multicenter study. Am J Hum Genet. 2005;77(6):945‐957. 10.1086/497996 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Hibino H, Nin F, Tsuzuki C, Kurachi Y. How is the highly positive endocochlear potential formed? The specific architecture of the stria vascularis and the roles of the ion‐transport apparatus. Pflügers Archiv ‐ Eur J Physiol. 2010;459(4):521‐533. 10.1007/s00424-009-0754-z [DOI] [PubMed] [Google Scholar]
- 8. Gasparini P, Rabionet R, Barbujani G, et al. High carrier frequency of the 35delG deafness mutation in European populations. Eur J Hum Genet. 2000;8(1):19‐23. 10.1038/sj.ejhg.5200406 [DOI] [PubMed] [Google Scholar]
- 9. Estivill X, Fortina P, Surrey S, et al. Connexin‐26 mutations in sporadic and inherited sensorineural deafness. Lancet. 1998;351(9100):394‐398. 10.1016/S0140-6736(97)11124-2 [DOI] [PubMed] [Google Scholar]
- 10. Talbi S, Bonnet C, Riahi Z, et al. Genetic heterogeneity of congenital hearing impairment in Algerians from the Ghardaïa province. Int J Pediatr Otorhinolaryngol. 2018;112:1‐5. 10.1016/j.ijporl.2018.06.012 [DOI] [PubMed] [Google Scholar]
- 11. Belguith H, Tlili A, Dhouib H, et al. Mutation in gap and tight junctions in patients with non‐syndromic hearing loss. Biochem Biophys Res Commun. 2009;385(1):1‐5. 10.1016/j.bbrc.2009.02.125 [DOI] [PubMed] [Google Scholar]
- 12. Moctar ECM, Riahi Z, El Hachmi H, et al. Etiology and associated GJB2 mutations in Mauritanian children with non‐syndromic hearing loss. Eur Arch Otrhinolaryngol. 2016;273(11):3693‐3698. 10.1007/s00405-016-4036-z [DOI] [PubMed] [Google Scholar]
- 13. Bakhchane A, Bousfiha A, Charoute H, et al. Update of the spectrum of GJB2 gene mutations in 152 Moroccan families with autosomal recessive nonsyndromic hearing loss. Eur J Med Genet. 2016;59(6‐7):325‐329. 10.1016/j.ejmg.2016.05.002 [DOI] [PubMed] [Google Scholar]
- 14. Gazzaz B, Weil D, Raïs L, Akhyat O, Azeddoug H, Nadifi S. Autosomal recessive and sporadic deafness in Morocco: High frequency of the 35delG GJB2 mutation and absence of the 342‐kb GJB6 variant. Hear Res. 2005;210(1‐2):80‐84. 10.1016/j.heares.2005.08.001 [DOI] [PubMed] [Google Scholar]
- 15. El Fizazi K, Abbassi M, Nmer S, et al. Unraveling the diversity of GJB2 mutations in nonsyndromic hearing loss: a comprehensive study in the Moroccan population. Audiol Neurotol. 2024;29(3):216‐223. 10.1159/000535346 [DOI] [PubMed] [Google Scholar]
- 16. Del Castillo I, Villamar M, Moreno‐Pelayo MA, et al. A deletion involving the connexin 30 gene in nonsyndromic hearing impairment. N Engl J Med. 2002;346(4):243‐249. 10.1056/NEJMoa012052 [DOI] [PubMed] [Google Scholar]
- 17. Riahi Z, Zainine R, Mellouli Y, et al. Compound heterozygosity for dominant and recessive GJB2 mutations in a Tunisian family and association with successful cochlear implant outcome. Int J Pediatr Otorhinolaryngol. 2013;77(9):1481‐1484. 10.1016/j.ijporl.2013.06.013 [DOI] [PubMed] [Google Scholar]
- 18. Kim SH, Nepali R, Yoo MH, Lee KS, Chung JW. Long term speech perception outcomes of cochlear implantation in gap junction protein beta 2 related hearing loss. J Audiol Otol. 2017;21(2):95‐102. 10.7874/jao.2017.21.2.95 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Ratbi I, Hajji S, Ouldim K, Aboussair N, Feldmann D, Sefiani A. La mutation 35delG du gène de la connexine 26, une cause fréquente des surdités non syndromiques autosomiques récessives au Maroc. Archives de Pédiatrie. 2007;14(5):450‐453. 10.1016/j.arcped.2006.12.004 [DOI] [PubMed] [Google Scholar]
- 20. Sayed‐Ahmed MM, El‐Bassyouni HT, Afifi HH, et al. Molecular and clinical characterization of a cohort of autosomal recessive sensorineural hearing loss in egyptian patients. J Mol Neurosci. 2024;74(4):102. 10.1007/s12031-024-02279-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Adadey SM, Wonkam‐Tingang E, Aboagye ET, Quaye O, Awandare GA, Wonkam A. Hearing loss in Africa: current genetic profile. Hum Genet. 2022;141(3‐4):505‐517. 10.1007/s00439-021-02376-y [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Abidi O, Boulouiz R, Nahili H, et al. The analysis of three markers flanking GJB2 gene suggests a single origin of the most common 35delG mutation in the Moroccan population. Biochem Biophys Res Commun. 2008;377(3):971‐974. 10.1016/j.bbrc.2008.10.086 [DOI] [PubMed] [Google Scholar]