Skip to main content
Open Veterinary Journal logoLink to Open Veterinary Journal
. 2026 May 31;16(5):2979–2986. doi: 10.5455/OVJ.2026.v16.i5.41

Osteopontin distribution and expression in the vas deferens and male accessory glands of camels (Camelus dromedarius) during the rutting season

Abdulkarem Al-Shabebi 1, Abdelrahman M A Elseory 1,*, Khalid M Al Khodair 1, Saeed Y Al-Ramadan 1, Thnaian A Al-Thnaian 1
PMCID: PMC13314261  PMID: 42375433

Abstract

Background:

The extracellular matrix glycoprotein osteopontin (OPN) is highly phosphorylated.

Aim:

This study investigates the expression and localization of OPN in the vas deferens, prostate, and bulbourethral glands throughout the rutting season to better understand its role in dromedary camels.

Methods:

Tissue samples were collected from the vas deferens (beginning, middle, and ampullary sections), prostate (corpus and disseminated regions), and bulbourethral glands of 12 adult male camels. Immunohistochemistry (IHC) and quantitative real-time polymerase chain reaction (qRT-PCR) were used to determine the distribution and expression levels of OPN protein and mRNA.

Results:

IHC revealed strong OPN expression in the epithelial cells of the ampullary part of the vas deferens and the disseminated prostate. Moderate immunoreactivity was observed in the corpus prostate and the vas deferens’ beginning and middle sections. Among all examined regions, the bulbourethral gland exhibited the lowest expression levels. The qRT-PCR results showed that OPN mRNA expression was significantly higher (p < 0.05) in the ampullary part of the vas deferens and the disseminated prostate than in other sections of the vas deferens and the compact prostate gland. The lowest mRNA expression was detected in the bulbourethral gland.

Conclusion:

OPN expression in the vas deferens and male accessory glands of the dromedary camel may facilitate sperm immigration through these organs. Additionally, the secretion of OPN into the seminal fluid by the accessory glands may influence sperm function within the female reproductive tract. Therefore, OPN could serve as a potential breeding selection marker.

Keywords: Accessory glands, Immunohistochemistry, OPN, qRT-PCR, Vas deferens

Introduction

Osteopontin (OPN) is an extensively phosphorylated glycoprotein of the extracellular matrix, initially identified in the mineralized matrix of cows’ diaphysial bones (Franzén and Heinegård, 1985). OPN has been detected in various tissues and body fluids, including milk and urine, through immunohistochemistry (IHC) and mRNA analyses (Senger et al., 1989; Cancel et al., 1999; Xie et al., 2001; Shin et al., 2005; Erikson et al., 2007; Fok et al., 2014; Dudemaine et al., 2014; Zhang et al., 2016; Si et al., 2020). OPN participates in tissue remodeling and cell-cell interactions by binding to integrins via its conserved Arg-Gly-Asp sequence (Brito-Nery et al., 2014; Aquino-Cortez et al., 2017; Wang et al., 2020; Sørensen and Christensen, 2023).

OPN has been detected in several mammalian male reproductive organs and animal sperm, including camels (Siiteri et al., 1995; Rodríguez et al., 2000; Wilson et al., 2005; Lin et al., 2006; Kim and Shin, 2007; Souza et al., 2009; Kang et al., 2014; Alkhodair and Ali, 2022; Tekin et al., 2023; Yoelinda et al., 2023). OPN plays multiple roles within these tissues, including regulation of spermatogenesis, stabilization of sperm plasma membranes, enhancement of motility, facilitation of capacitation, and potential involvement in inflammatory processes, including prostate cancer (Rodríguez et al., 2000; Erikson et al., 2007; Souza et al., 2009; Zhang et al., 2016; Abedin et al., 2021; Yu et al., 2021).

Spermatozoa are transported from the epididymis to the urethra via the tubular vas deferens (Mahmud et al., 2015). Recent evidence suggests that the vas deferens may also contribute to the modification of sperm proteins in dromedary camels (Al Khodair et al., 2023; Al-Thnaian, 2023; Al-Shabebi et al., 2024; Elseory, 2024). Similarly, the accessory sex glands are crucial to the reproductive process. Their fluid components enhance the motility and vitality of sperm, suggesting that they improve the capacity to reach the fertilization site by attaching to the membrane during ejaculation (Chughtai et al., 2005; Fernandez-Fuertes, 2023).

In dromedary camels, the rutting season extends from late October to April and is characterized by increased sexual activity (Tibary and El Allali, 2020). Our previous work demonstrated the presence of OPN in the testis, epididymis, and spermatozoa of dromedary camels, indicating a role in spermatogenesis and sperm function (Alkhodair and Ali, 2022). However, no information is available on OPN expression in this species’ vas deferens or male accessory glands. Therefore, quantitative real-time polymerase chain reaction (qPCR) and IHC were used to clarify its expression and localization in the vas deferens and male accessory glands of the dromedary during the rutting season.

Materials and Methods

Sampling

All animal sample procedures were conducted in accordance with the animal protocol approved by King Faisal University's ethical committee, KFU-REC-2025-DEC–ETHICS3826. Fresh samples of the vas deferens and male accessory glands were collected from 12 clinically healthy adult camels (aged 4≥ years or older) slaughtered at the Al-Omran abattoir in Al-Ahsa, Saudi Arabia, during the mid-rutting period (December and January). Specimens were taken from the vas deferens (beginning, middle, and ampullary sections), compact and disseminated prostate, and bulbourethral glands. Subsequently, they were kept in 10% buffered formalin until they were used in the immunohistochemical technique (IHC). For qRT-PCR analysis, corresponding tissues were collected, frozen in a nitrogen solution for 10 minutes, and then stored at −80°C.

Immunohistochemistry

Specimens were fixed in 10% buffered formalin, dehydrated using a graded ethanol series, cleared in xylene, and embedded in paraffin wax. Sections of 5 mµ thickness were prepared using a rotary microtome and mounted on Superfrost slides. The slides were dewaxed, rehydrated, and stained using the avidin-biotin-peroxidase complex technique described by Adeghate et al. (2001). The antigen was extracted in a microwave oven using 0.01 M phosphate-buffered saline (PBS) (pH 7.4) for 15 minutes. The pieces were washed with PBS and chilled to 25°C. Endogenous peroxidase was inhibited for 30 minutes with 3% hydrogen peroxide. To minimize nonspecific responses, goat serum (10%) was used for 20 minutes following three rounds of washing in PBS. The material was placed in a wet chamber overnight after the primary antibody, polyclonal rabbit anti-OPN (Abcam, Inc., ab8448, dilution 1:100, Cambridge, Cambridgeshire, UK), was applied. Biotin-labeled secondary antibodies and avidin-horseradish peroxidase were applied to the sections. Dibutyl phthalate polystyrene xylene was used to determine the positive staining. Hematoxylin stain was used for counterstaining the sections. Except for the omission of the primary antibody, the negative control sections adhere to the same methodology. Immunohistological examinations were performed using a light microscope (Leica DM6000 B, Germany) equipped with a digital camera (Leica DFC420, Germany), and images were captured accordingly.

Quantitative real-time polymerase chain reaction

A 50 mg tissue sample was processed using a Bead Ruptor Homogenizer (OMNI International, Kennesaw GA). Following the manufacturer’s instructions, complete RNA extraction was performed using TRIzol reagent (Invitrogen, Carlsbad, CA). The RNA was extracted with isopropanol and chloroform and reconstituted with ultrapure diethylpyrocarbonate-treated RNase-free water (Invitrogen, USA). The purity and concentration of the extracted RNA were then assessed using a BioTek Synergy HTX reader (BioTek, USA). Subsequently, the RNA was converted into cDNA using the iScript cDNA Synthesis Kit (BioRad, Hercules, CA) via a 20 μl reaction mixture consisting of 4 μl iScript® Reaction Mix, 1 μl iScript® Reverse Transcriptase, and nuclease-free water. The reaction required incubation at 25°C for 5 minutes, 46°C for 20 minutes, and 95°C for approximately 60 seconds to inactivate the reverse transcriptase. The CFX96® Touch Real-time PCR System (BioRad, USA) and SsoAdvanced SYBR Green Supermix dye (BioRad) were used for qPCR. Gene-specific primers for glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and the dromedary camel OPN gene were used (Table 1). The 20 μl qPCR reaction mixture consisted of 10 μl of master mix, 2 μl of each forward and reverse primer (pm/μl), 2 μl of cDNA specimen, and 4 μl of nuclease-free water. The thermal cycling program consisted of an initial step at 95°C for 30 seconds, followed by 40 cycles at 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 10 seconds. Fluorescence data were collected in duplicate for each cDNA template. The corresponding levels of OPN gene expression were calculated using the CFX ManagerTM software version 3.1 (Bio-Rad, Hercules, CA), along with the housekeeping GAPDH gene.

Table 1. The primer sequences used in the qRT–PCR investigation of OPN protein.

Target gene Gene bank identification Primers sequence Product size(bp)
OPN XM_010983105.1 FP:AAGACACACAAGATGGCCGA 187
RP: TGGCTGTTCCAGTCAGAAGC
GAPDH XM_010990867.2 FP: CCTGGAGAAACCTGCCAAATA 207
RP: TCGTTGTCGTACCAGGAAATG

Statistical analysis

Relative OPN mRNA expression data are presented as mean ± SEM. One-way analysis of variance was used to compare differences among the tissue groups (DI, DM, DA, PC, PD, and BU), followed by Tukey’s post hoc test. Differences were considered statistically significant at p < 0.05.

Ethical approval

All animal sample procedures were conducted in accordance with the animal protocol approved by King Faisal University's ethical committee, KFU-REC-2025-DEC–ETHICS3826.

Results

Immunohistochemistry

OPN immunoreactive staining was observed in all dromedary camel ductus deferens and male accessory gland regions, with varying staining intensities during the rutting season (Table 2).

Table 2. Distribution of OPN immunostaining in the camel’s vas deferens and male accessory glands.

Organ DI DM DA PC PD BU
OPN ++ ++ +++ ++ +++ +

Positive immunostaining strength was graded as +++strong, ++ moderate, and + weak. The abbreviations for the vas deferens initial part (DI), middle part (DM), ampulla (DA), prostate compact (PC), prostate diffused (PD), and bulbourethral gland (BU) are used.

Moderate OPN antibody immunostaining was observed in the basal and tall columnar cells that form the pseudostratified epithelium in both the initial and middle sections of the vas deferens (Fig. 1A and B). Moving to the ampullary region, this enlarged terminal portion of the vas deferens exhibited a stronger immunoreaction in the epithelial cells and luminal contents, indicating a higher concentration of OPN protein (Fig. 1C).

Fig. 1. OPN immunoreactive staining for the vas deferens of the dromedary camel. Both tall columnar cells (1) and basal cells (2) of the pseudostratified epithelium in the initial (A) and middle parts (B) show moderate immunostaining for OPN antibodies. The epithelium (1) and luminal contents (2) in the ampulla (C) exhibited significant OPN immunostaining. 40×. (a), (b), and (c) are negative controls. 20×.

Fig. 1.

Similarly, both compact and disseminated regions of the prostate exhibited OPN immunostaining. Secretory epithelial cells in the compact prostate showed moderate OPN expression (Fig. 2A). In contrast, these cells showed a stronger immunostaining reaction in the disseminated prostate, indicating elevated OPN levels (Fig. 2B).

Fig. 2. OPN immunoreactive staining of the camel prostate gland. The compact (A) and disseminated (B) prostates show moderate and strong immunostaining of OPN in secretory epithelial cells (1), respectively. 40×. 2, lumen. 20×. (a) and (b) negative control 20×.

Fig. 2.

The bulbourethral gland of the camel exhibited a modest immunoreactive signal for OPN in its secretory epithelial cells (Fig. 3A).

Fig. 3. OPN immunostaining in the bulbourethral gland of the camel shows weak immune-reactive staining in the secretory epithelial cells (1). 2, lumen. 20×. (a) negative control 20×.

Fig. 3.

Quantitative real-time polymerase chain reaction

Table 3 shows OPN mRNA expression levels in the vas deferens, prostate, and bulbourethral glands of dromedary camels.

Table 3. Relative amounts of OPN mRNA expression in the ductus deferens, prostate, and bulbourethral glands of dromedary camels.

Gene DI DM DA PC PD BU
OPN 1.7 ± 0.25 1.67 ± 0.10 3.01 ± 0.74 1.02 ± 0.30 3.32 ± 0.49 0.61 ± 0.08

Expression of OPN mRNA values is presented as means ± standard errors. DI, vas deferens initial part; DM, vas deferens median part; DA, ampulla; PC, compact prostate; PD, disseminated prostate; and BU, bulbourethral gland.

The vas deferens ampullary region exhibited significantly higher OPN mRNA expression (p < 0.05) compared with the initial and middle segments, which showed lower levels. Among male accessory glands, the disseminated prostate exhibited the highest OPN mRNA expression (p < 0.05). The compact prostate had a moderate density. The bulbourethral gland showed the lowest OPN mRNA expression (Fig. 4).

Fig. 4. OPN mRNA expression in the vas deferens and male accessory glands of dromedary camels. When OPN mRNA expression levels were compared, DA and PD showed significantly higher expression levels, whereas BU and PC showed lower expression levels. Data are presented as mean ± SEM. Bars with different letters (a–c) indicate statistically significant differences among groups (p < 0.05). Initial, DI; middle, DM; and ampullary parts, DA of the vas deferens, compact, PC; and disseminated part, PD of the PG and BU.

Fig. 4.

Discussion

For the first time, this study investigates OPN expression in the vas deferens and male accessory glands of the dromedary camel during the rutting season.

IHC revealed that OPN was strongly expressed in the epithelial cells of the vas deferens ampulla and the disseminated prostate. The remaining parts, including the initial and middle vas deferens and corpus prostate, exhibited moderate immunoreactivity. The bulbourethral gland showed weakened expression among these parts.

Earlier research validated the current findings. OPN has been detected in the vas deferens ampulla, seminal vesicles, and associated fluids of bulls and rams (Cancel et al., 1999; Rodríguez et al., 2000; Zhang et al., 2016; Baruah et al., 2017; Popovics et al., 2020). In male bulls, OPN is believed to be secreted primarily by the seminal vesicles and the ampulla (Cancel et al., 1999; Rodríguez et al., 2000; Boccia et al., 2013).

The ampulla and the accessory gland constitute 60%–90% of semen volume (Dukes, 2005). Our findings for OPN, particularly in the male accessory glands, supported the presence of OPN in the dromedary camel sperm and seminal plasma (Waheed et al., 2015; Alkhodair and Ali, 2022).

OPN’s activity emphasizes the role of this protein in removing calcium from the lumen of the reproductive canal. It helps maintain sperm motility by preventing calcium buildup (Luedtke et al., 2002; Tekin et al., 2023). The detection of OPN in the vas deferens and prostate gland of the camel confirms this functional hypothesis and reveals a potential link between OPN expression and sperm quality.

The qRT–PCR results obtained in this study were consistent with the IHC data. OPN mRNA expression was significantly higher in the ductus deferens’ ampullary region than in the beginning and middle sections. Similarly, among the accessory glands, the disseminated prostate showed the highest OPN mRNA expression, whereas the compact prostate had a moderate level, and the bulbourethral gland had the lowest.

Few studies have investigated OPN mRNA transcripts in the male reproductive system of domestic animals. However, the presence of OPN in accessory gland fluids and its identification as a major protein in seminal plasma have been previously reported (Moura et al., 2006). According to the findings mentioned earlier in this study, the expression of OPN may suggest that the accessory gland components enhanced the sperm’s ability to reach the fertilization site and attach to their membrane during ejaculation, as proposed by Moura et al. (2006) and Fernandez-Fuertes (2023).

In camels, the prostate gland consists of an external dorsal part, dorsal to the neck of the bladder, and a disseminated prostate with channels that open along the proximal portion of the urethra at the bladder neck. Thus, the higher OPN expression in the disseminated prostate than in the compact prostate may reflect functional differences between these regions and contributes more to the secretion of seminal plasma, possibly explaining the increased OPN expression. Similarly, strong OPN expression in the vas deferens ampulla may be related to its role in final sperm storage and modification before ejaculation. At this stage, OPN may help maintain sperm motility and regulate calcium balance, both of which are important for sperm function (Luedtke et al., 2002; Soliman et al., 2010; Moura et al., 2018; Aidoudi et al., 2024).

OPN expression may be affected by seasonal hormonal shifts, as this study was conducted during the rutting season, when the accessory gland production and reproductive activity of male camels increase (Ibrahim, 2017).

Conclusion

In conclusion, the presence and distribution of OPN in the vas deferens and male accessory glands of the dromedary camel suggest that this protein contributes to the enrichment of seminal fluid and may play a vital role in supporting key sperm functions within the female reproductive tract. In addition, OPN expression in these organs may influence sperm motility as it travels through the male reproductive system toward the female genitalia. Therefore, OPN could serve as a potential biomarker for the identification of camels with superior fertility.

Acknowledgments

None.

Conflict of interest

The authors declare that they have no conflict of interest.

Funding

This work was supported by the Deanship of Scientific Research, Vice Presidency for Graduate Studies and Scientific Research, King Faisal University, Saudi Arabia (Grant No. KFU260361).

Authors’ contributions

A.A.: investigation and methodology E.A.: investigation, methodology, data curation, software, and writing original draft. A.K.: investigation and data curation. A.S. review and editing. A.T.: review and editing and supervision. All authors have read and approved the published version of the manuscript.

Data availability

The data used to support the findings of this study are included in the article and will be made available on request.

References

  1. Abedin S.N, Leela V, Devendran P, Suganya G, Rangasamy S, Loganathasamy K. Seminal plasma osteopontin: a marker for potential fertility in dogs. Indian J. Anim. Res. 2021;55(7):758–762. doi: 10.1016/j.ijar.2021.01.07. [DOI] [Google Scholar]
  2. Adeghate E, Ponery A.S, Pallot D.J, Singh J. Distribution of vasoactive intestinal polypeptide, neuropeptide-Y and substance P and their effects on insulin secretion from the in vitro pancreas of normal and diabetic rats. Peptides. 2001;22(1):99–107. doi: 10.1016/s0196-9781(00)00361-2. [DOI] [PubMed] [Google Scholar]
  3. Aidoudi H, Rahmoun D.E, Khenenou T. Histological structure of the prostate gland during ante and postnatal period of ontogenesis in dromedary camel in Algeria. J. Camel Pract. Res. 2024;31:171–177. doi: 10.5958/2277-8934.2024.00035.5. [DOI] [Google Scholar]
  4. Al Khodair K.M, Moqbel M.S, Elseory A.M.A, Elsebaei M.G, Al‐Thnaian T.A, Elhassan M.M.O. Immunolocalization and expression of Siglec5 protein in the male reproductive tract of dromedary camel during rutting season. Anat. Histol. Embryol. 2023;52(6):874–881. doi: 10.1016/j.ahb.2018.02.007. [DOI] [PubMed] [Google Scholar]
  5. Alkhodair K, Ali A.M. Spatial expression of osteopontin in testis, epididymis and spermatozoa in dromedary camel. J. Camel Pract. Res. 2022;29(2):111–116. doi: 10.5958/2277-8934.2022.00015.7. [DOI] [Google Scholar]
  6. Al-Shabebi A, Al-Thnaian T.A, Ali A.M, Dalab A, Elseory A.M. ADAM2 localization and expression in the ductus deferens and male accessory glands of rutting camels (Camelus dromedarius. J. Adv. Vet. Res. 2024;14(6):1012–1015. [Google Scholar]
  7. Al-Thnaian T.A. Morphological and molecular investigations of aquaporin-7 (AQP-7) in male Camelus dromedarius reproductive organs. Animals. 2023;13(7):13. doi: 10.3390/ani13071158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Aquino-Cortez A, Pinheiro B.Q, Lima D.B.C, Silva H.V.R, Mota-Filho A.C, Martins J.A.M, Rodriguez-Villamil P, Moura A.A, Silva L.D.M. Proteomic characterization of canine seminal plasma. Theriogenology. 2017;95:178–186. doi: 10.1016/j.theriogenology.2017.03.016. [DOI] [PubMed] [Google Scholar]
  9. Baruah K.K, Dhali A, Bora B, Mech A, Mondal M. Detection of osteopontin transcript in seminal plasma and its association with post-freeze-thaw quality of cryopreserved spermatozoa in mithun (Bos frontalis. Indian J. Anim. Res. 2017;51(4):648–653. doi: 10.1016/j.ijar.2017.01.013. [DOI] [Google Scholar]
  10. Boccia L, Di Francesco S, Neglia G, De Blasi M, Longobardi V, Campanile G, Gasparrini B. Osteopontin improves sperm capacitation and In vitro fertilization efficiency in buffalo (Bubalus bubalis. Theriogenology. 2013;80(3):212–217. doi: 10.1016/j.theriogenology.2013.04.017. [DOI] [PubMed] [Google Scholar]
  11. Brito-Nery L, Tilburg M.V, Menezes E, Machado V, Moura A, Oliveira E. Protein patterns of canine seminal plasma. Publisher Not Provided. 2014;38(2):110–115. [Google Scholar]
  12. Cancel A.M, Chapman D.A, Killian G.J. Osteopontin localization in the Holstein bull reproductive tract. Biol. Reprod. 1999;60(2):454–460. doi: 10.1095/biolreprod60.2.454. [DOI] [PubMed] [Google Scholar]
  13. Chughtai B, Sawas A, O'Malley R.L, Naik R.R, Ali Khan S, Pentyala S. A neglected gland: a review of Cowper's gland. Int. J. Androl. 2005;28(2):74–77. doi: 10.1111/j.1365-2605.2005.00499.x. [DOI] [PubMed] [Google Scholar]
  14. Dudemaine P.L, Thibault C, Alain K, Bissonnette N. Genetic variations in the SPP1 promoter affect gene expression and the level of osteopontin secretion into bovine milk. Anim. Genet. 2014;45(5):629–640. doi: 10.1111/age.12176. [DOI] [PubMed] [Google Scholar]
  15. Elseory A.M.A. Localisation of aquaporin1 in the vas deferens and prostate gland of the dromedary camel (Camelus dromedarius) during rutting and non-rutting season. J. Camel Pract. Res. 2024;31(1):35–42. [Google Scholar]
  16. Erikson D.W, Way A.L, Chapman D.A, Killian G.J. Detection of osteopontin on Holstein bull spermatozoa, in cauda epididymal fluid and testis homogenates, and its potential role in bovine fertilization. Reproduction. 2007;133(5):909–917. doi: 10.1530/REP-06-0228. [DOI] [PubMed] [Google Scholar]
  17. Fernandez-Fuertes B. Review: the role of male reproductive tract secretions in ruminant fertility. Animal. 2023;17(Suppl 1) doi: 10.1016/j.animal.2023.100773. [DOI] [PubMed] [Google Scholar]
  18. Fok T.C, Lapointe H, Tuck A.B, Chambers A.F, Jackson-Boeters L, Daley T.D, Darling M.R. Expression and localization of osteopontin, homing cell adhesion molecule/CD44, and integrin αvβ3 in mucoepidermoid carcinoma and acinic cell adenocarcinoma of salivary gland origin. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. 2014;118(3):320–329. doi: 10.1016/j.oooo.2014.05.004. [DOI] [PubMed] [Google Scholar]
  19. Franzén A, Heinegård D. Isolation and characterization of two sialoproteins present only in bone calcified matrix. Biochem. J. 1985;232(3):715–724. doi: 10.1042/bj2320715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Ibrahim N.S. Comparative study of some hormones during rutting season in dromedary camel. AL-Qadisiyah J. Vet. Med. Sci. 2017;16(1) [Google Scholar]
  21. Kang Y.J, Forbes K, Carver J, Aplin J.D. The role of the osteopontin–integrin αvβ3 interaction at implantation: functional analysis using three different in vitro models. Hum. Reprod. 2014;29(4):739–749. doi: 10.1093/humrep/det433. [DOI] [PubMed] [Google Scholar]
  22. Kim S, Shin T. Immunohistochemical study of osteopontin in boar testis. J. Vet. Sci. 2007;8(2):107–110. doi: 10.4142/jvs.2007.8.2.107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Luedtke C.C, Mckee M.D, Cyr D.G, Gregory M, Kaartinen M.T, Mui J, Hermo L. Osteopontin expression and regulation in the testis, efferent ducts, and epididymis of rats during postnatal development through to adulthood. Biol. Reprod. 2002;66(5):1437–1448. doi: 10.1095/biolreprod66.5.1437. [DOI] [PubMed] [Google Scholar]
  24. Mahmud M.A, Onu J, Shehu S.A, Umaru A, Danmaigoro A, Atabo M.S. Morphological studies on epididymis and vas deferens of one-humped camel bull (Camelus dromedarius), Uda ram and Red Sokoto buck. Am. J. Biosci. Bioeng. 2015;3(5):65–71. doi: 10.1007/s0020-014-0298-3. [DOI] [Google Scholar]
  25. Moura A.A, Koc H, Chapman D.A, Killian G.J. Identification of proteins in the accessory sex gland fluid associated with fertility indexes of dairy bulls: a proteomic approach. J. Androl. 2006;27(2):201–211. doi: 10.2164/jandrol.05089. [DOI] [PubMed] [Google Scholar]
  26. Moura A.A, Memili E, Portela A.M.R, Viana A.G, Velho A.L.C, Bezerra M.J.B, Vasconselos F.R. Seminal plasma proteins and metabolites: effects on sperm function and potential as fertility markers. Anim. Reprod. 2018;15(Suppl 1):691–702. doi: 10.21451/1984-3143-AR2018-0029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Popovics P, Awadallah W.N, Kohrt S.E, Case T.C, Miller N.L, Ricke E.A, Grabowska M.M. Prostatic osteopontin expression is associated with symptomatic benign prostatic hyperplasia. Prostate. 2020;80(10):731–741. doi: 10.1002/pros.23986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Rodríguez C.M, Day J.R, Killian G.J. Osteopontin gene expression in the Holstein bull reproductive tract. J. Androl. 2000;21(3):414––420. [PubMed] [Google Scholar]
  29. Senger D.R, Perruzzi C.A, Papadopoulos A, and Tenen, D.G. Purification of a human milk protein closely similar to tumor-secreted phosphoproteins and osteopontin. Biochim. Biophys. Acta. Protein. Struct. Mol. Enzymol. 1989;996(1–2):43–48. doi: 10.1016/0167-4838(89)90092-7. [DOI] [PubMed] [Google Scholar]
  30. Shin T, Ahn M, Kim H, Moon C, Kang T.Y, Lee J.M, Sim K.B, Hyun J.W. Temporal expression of osteopontin and CD44 in rat brains with experimental cryolesions. Brain. Res. 2005;1041(1):95–101. doi: 10.1016/j.brainres.2005.02.019. [DOI] [PubMed] [Google Scholar]
  31. Si J, Wang C, Zhang D, Wang B, Hou W, Zhou Y. Osteopontin in bone metabolism and bone diseases. Med. Sci. Monitor. 2020;26:e919159. doi: 10.12659/msm.919159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Siiteri J.E, Ensrud K.M, Moore A, Hamilton D.W. Identification of osteopontin (OPN) mRNA and protein in the rat testis and epididymis, and on sperm. Mol. Reprod. Develop. 1995;40(1):16–28. doi: 10.1002/mrd.1080400104. [DOI] [PubMed] [Google Scholar]
  33. Soliman S.M, Mazher K.M, Abdelrazek A.H. Light and electron microscopic studies of the prostate gland of adult one humped camel (Camelus dromedarius. J. Vet. Med. Res. 2010;20(1):44–51. [Google Scholar]
  34. Sørensen E.S, Christensen B. Milk osteopontin and human health. Nutrients. 2023;15(11):2423. doi: 10.3390/nu15112423. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Souza F, Chirinéa V, Martins M, Lopes M. Osteopontin in seminal plasma and sperm membrane of dogs. Reprod. Domestic Animals. 2009;44(Suppl 2):283–286. doi: 10.1111/j.1439-0531.2009.01447.x. [DOI] [PubMed] [Google Scholar]
  36. Tekin K, Kurtdede E, Salmanoğlu B, Uysal O, Stelletta C. Osteopontin concentration in prostate fractions: a novel marker of sperm quality in dogs. Vet. Sci. 2023;10(11):99–105. doi: 10.3390/vetsci10110646. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Tibary A, El Allali K. Dromedary camel: a model of heat resistant livestock animal. Theriogenology. 2020;154:203–211. doi: 10.1016/j.theriogenology.2020.05.046. [DOI] [PubMed] [Google Scholar]
  38. Waheed M.M, Ghoneim I.M, Alhaider A.K. Seminal plasma and serum fertility biomarkers in dromedary camels (Camelus dromedarius. Theriogenology. 2015;83(4):650–654. doi: 10.1016/j.theriogenology.2014.10.033. [DOI] [PubMed] [Google Scholar]
  39. Wilson M.J, Liaw L, Koopman P. Osteopontin and related SIBLING glycoprotein genes are expressed by Sertoli cells during mouse testis development. Develop. Dyn. 2005;233(4):1488–1495. doi: 10.1002/dvdy.20456. [DOI] [PubMed] [Google Scholar]
  40. Xie Y, Sakatsume M, Nishi S, Narita I, Arakawa M, Gejyo F. Expression, roles, receptors, and regulation of osteopontin in the kidney. Kidney. Int. 2001;60(5):1645–1657. doi: 10.1046/j.1523-1755.2001.00032.x. [DOI] [PubMed] [Google Scholar]
  41. Yoelinda V.T, Arifiantini R.I, Solihin D.D, Agil M, Setiadi D.R, Maulana T, Purwantara B, Hastuti Y.T, Manansang J, Sajuthi D. Correlation between post-thaw spermatozoa quality of the endangered Javan banteng with OPN gene expression. Vet. Med. Int. 2023;2023:1–10. doi: 10.1155/2023/9982422. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Yu J, Yang Y, Li S, Meng P. Salinomycin triggers prostate cancer cell apoptosis by inducing oxidative and endoplasmic reticulum stress via suppressing Nrf2 signaling. Exp. Therapeutic. Med. 2021;22(3):946. doi: 10.3892/etm.2021.10378. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  43. Zhang G.M, Lan S, Jia R.X, Yan G.Y, Wang L.Z, Nie H.T, Lei Z.H, Wang F. Age-associated and tissue-specific expression of osteopontin in male Hu sheep reproductive tract. Tissue Cell. 2016;48(5):496–502. doi: 10.1016/j.tice.2016.07.003. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data used to support the findings of this study are included in the article and will be made available on request.


Articles from Open Veterinary Journal are provided here courtesy of Faculty of Veterinary Medicine, University of Tripoli

RESOURCES