Deletion of phosphatidylethanolamine methyltransferase promotes the spontaneous development of hepatic steatosis, inflammation, and fibrosis in young mice

Abstract

Phosphatidylethanolamine N-methyltransferase (PEMT) catalyzes the transfer of methyl groups to phosphatidylethanolamine to generate phosphatidylcholine (PC). PC produced de novo through this pathway is preferentially used for very-low-density lipoprotein assembly and is essential for its normal hepatic secretion as well as for bile acid detoxification. While human PEMT loss-of-function polymorphisms are linked to increased metabolic dysfunction-associated steatotic liver disease risk, the enzyme’s role as a primary driver of progressive liver disease remains underexplored. We utilized PEMT knockout (PEMT KO) mice on a standard chow diet to model this deficiency. Histopathological analysis showed that while 2-month-old PEMT KO mice were protected, 6-month-old KOs of both sexes spontaneously developed extensive micro- and macrovesicular steatosis, parenchymal inflammation, and granulomatous inclusions. This severe, age-dependent pathology was confirmed by elevated hepatic triglyceride levels, bile acids, impaired methylation potential, and a cascade of secondary injuries, including increased oxidative stress, impaired proteasomal function, and the induction of cellular senescence markers. This bile acid toxicity and oxidative stress activated the central innate immune sensor, the NLRP3 inflammasome, driving pronounced macrophage infiltration and chronic inflammation. Picrosirius red staining and protein analysis confirmed the progression to severe pericellular fibrosis. Our study establishes that PEMT deficiency is sufficient to initiate and drive the complete progression from steatosis to advanced liver fibrosis, identifying PEMT as a critical metabolic checkpoint and a potent therapeutic target for mitigating progressive liver disease.

Introduction

Chronic liver disease (CLD) is a major global public health issue [1]. The causes of chronic liver injury include viruses, metabolic dysfunction, autoimmune diseases, and alcohol use disorder, all of which can lead to liver fibrosis [2,3]. Liver fibrosis can develop in patients with any type of CLD, including alcohol-associated liver disease (ALD), metabolic dysfunction-associated steatotic liver disease (MASLD), hepatitis C, hepatitis B, and autoimmune hepatitis [2]. Fibrosis, the most notable characteristic of CLD, involves both quantitative and qualitative alterations in the extracellular matrix, primarily the deposition of collagen. These changes can eventually lead to the complete disarray of liver architecture, resulting in cirrhosis and hepatocellular carcinoma development [1]. Historically, liver fibrosis was believed to be irreversible. However, extensive research has demonstrated that both fibrosis and cirrhosis can improve, especially when the root cause of liver injury is treated [4].

Phosphatidylethanolamine N-methyltransferase (PEMT), a transferase enzyme (EC 2.1.1.17) catalyzes the de novo synthesis of phosphatidylcholine (PC) in the liver [5–8]. This 22.3 kDa integral transmembrane protein is localized to the endoplasmic reticulum and mitochondria associated membranes of liver [9]. In mammals, PEMT catalyzes the three sequential transfers of methyl groups to phosphatidylethanolamine (PE) using S-adenosylmethionine (SAM) as the methyl donor to generate PC moieties [10–12], which are more diverse and composed of significantly longer chain, polyunsaturated fatty acids [8]. Further studies revealed that pharmacologic inhibition of PE methylation or deletion of PEMT impaired normal biogenesis and secretion of very-low-density lipoprotein (VLDL) by hepatocytes in vitro [13,14]. Conversely, stable expression of PEMT has been shown to enhance this secretion [14]. As the liver exports triglycerides and cholesterol only as constituents of VLDL particles, any impairment in either the synthesis or export of VLDL particles could lead to fat accumulation within the hepatocyte.

The PEMT-mediated catalysis is closely dependent on the availability of SAM, the methyl donor, and the ratio of SAM to S-adenosylhomocysteine (SAH) that provides a key index of the methylation potential [15]. Our laboratory has previously reported that alcohol-induced methylation defects (i.e. lower SAM:SAH ratio) impair PEMT activity to inhibit VLDL secretion, thereby contributing to hepatic steatosis development [16,17].

A recent study in aged mice (22–24-month-old) PEMT knockout (PEMT KO) fed a standard chow revealed no aging-related changes in the liver metabolome compared to the young (>2-months-old) KOs [18]. There were however increased levels of metabolites (adenosine monophosphate, histidine, inosine, acetate acid, propionate, glutathione) and decreased phosphorylcholine and choline levels in the young KOs compared to their age-matched wildtypes (WT) that persisted with aging of the KOs [18]. These studies did not particularly evaluate liver injury in depth nor looked at a relatively younger age of 6 months.

In humans, common PEMT genetic variants impair PC synthesis, and are associated with increased risk of developing MASLD [19,20]. Further, patients diagnosed with metabolic dysfunction-associated steatohepatitis (MASH) exhibit lower hepatic PEMT expression compared to those with simple steatosis that significantly correlated with platelet counts, which typically decline with advanced fibrosis [21]. Given that common genetic loss-of-function polymorphisms in the human PEMT gene predispose individuals to MASLD [19], we proposed that mice lacking PEMT would exhibit a progressive age-related liver damage at a relatively young age even when maintained on a normal diet.

Materials and methods

Animal handling and diet

PEMT KO mice were originally generated in Dr. Dennis Vance’s laboratory by targeted disruption of the Pemt gene through homologous recombination in embryonic stem cells, as described [22]. This strategy removed exons essential for PEMT enzymatic activity, resulting in complete loss of hepatic PEMT function. The line was backcrossed onto a C57BL/6 background and generously provided by Dr. René L. Jacobs (University of Alberta, Edmonton, Alberta, Canada).

Mice were housed and bred in the AAALAC-accredited Omaha Veterans Affairs Medical Center Veterinary Medical Unit under controlled environmental conditions (12-h light/12-h dark cycle, 20°C–25°C, 40%–60% relative humidity) with ad libitum access to standard chow and water. All procedures involving animals were approved by the Omaha Veterans Affairs Medical Center Institutional Animal Care and Use Committee (IACUC; IRBNet #1576244 and #1583585) and were conducted in accordance with institutional and federal guidelines.

For the present study, 2- and 6-months-old male and female C57BL/6 PEMT KO mice and their age- and sex-matched WT controls were euthanized under isoflurane anesthesia (5% to obtain anesthesia, 1%–2% to maintain anesthetized state), and blood was collected from the vena cava. The chest was opened, and death occurred from a combination of exsanguination and pneumothorax. These methods are consistent with the recommendations of the Panel on Euthanasia of the American Veterinary Association and were approved by the Omaha VA Animal Research Subcommittee. Organs were collected from each mouse. Serum was prepared by centrifuging whole blood in serum separator tubes at 13,000 × g for 5 min. Portions of each liver were immediately fixed in formalin for histologic analyses or processed for the preparation of a deproteinized extract using perchloric acid for SAM and SAH analyses, as detailed [23]. The remainder of each liver was freeze-clamped and stored at −70°C for subsequent biochemical assays.

Hepatic histopathological analysis

Formalin-fixed liver tissues were processed, embedded in paraffin, sectioned, and stained with hematoxylin and eosin (H&E) for histopathological evaluation. A board-certified pathologist (K.W.F.) examined and graded the liver sections according to the Kleiner Criteria [24] that categorize the severity of hepatic steatosis on a scale from Grade 1 (mild) to Grade 3 (severe).

To assess fibrosis, deparaffinized sections were stained with picrosirius red staining (Cat# SSC1216-250, Cancer Diagnostics, Durham, NC, USA) for 60 min at room temperature. The slides were then incubated in 0.5% glacial acetic acid (Fisher chemicals) for 2 min and washed with water, followed by dehydration steps and mounted. For each independent experiment, all slides used for staining were processed at the same time to minimize variation in staining intensity. Digital images were acquired using a Keyence BZ-X810 microscope (Plano, TX, USA).

Hepatic SAM, SAH, triglyceride, bile acids, and serum alanine aminotransferase levels

We subjected liver perchloric acid extracts to high-performance liquid chromatography (HPLC) to quantify SAM and SAH levels, as detailed [23,25]. The triglyceride levels in liver lipid extracts [26] were quantified using the diagnostics kit (Cat# TR22421, Thermo Fisher Scientific, Middleton, VA, USA) using the manufacturer’s instructions, as detailed previously [23].

Since maintaining hepatic PC is critical for biliary secretion [27], we also measured hepatic bile acids using bile acid assay kit (Cat# STA-631, Cell Biolabs Inc., San Diego, CA, USA).

Serum levels of alanine aminotransferase (ALT) were measured at the clinical laboratory at VA Nebraska Western Iowa Health Care System.

Hepatic betaine and betaine–homocysteine methyltransferase activity

The betaine–homocysteine methyltransferase (BHMT) enzyme activity in the liver samples was measured following the method of Ericson and Harper and expressed as mg methionine formed [28]. Liver betaine levels were measured by liquid chromatography–electrospray ionization-isotope dilution mass spectrometry as previously described [29].

Reactive oxygen species and thiobarbituric acid-reactive substances

Liver reactive oxygen species (ROS) were measured using 2′7′-dichlorodihydrofluorescein diacetate as detailed [30]. Formation of the oxidized fluorescent derivative, dichlorofluorescein, was monitored at 485 nm (excitation) and 530 nm (emission). Data are expressed as fluorescence units normalized for protein concentration, which was measured by the Bradford dye-binding assay [31]. We measured hepatic lipid peroxidation by thiobarbituric acid-reactive substances (TBARS) assay, as detailed [32] using purified malondialdehyde (MDA) as the standard.

Proteasome activity

Liver homogenates were used to assay the trypsin- and chymotrypsin-like activity of the proteasome using appropriate fluorometric substrates and buffers according to established procedure as previously described [33–35]. Data are expressed as fluorescence units per hour normalized for protein concentration [31].

Lysosomal hydrolases

We determined the catalytic activities of three major hepatic lysosomal hydrolases, cathepsin B, cathepsin L and the lysosomal acid lipase (LAL), in the homogenates using the appropriate fluorometric 4-methylcoumaryl-amide substrates and buffers according to established procedures [36,37].

Gene expression

RNA was isolated with a PureLink™ RNA minikit (Cat# 12183018A, Invitrogen, Waltham, MA, USA) following the manufacturer’s instructions. RNA was quantified spectrophotometry (NanoDrop Technologies, Wilmington, DE, USA), and 200 ng of RNA was reverse transcribed to cDNA using a high-capacity reverse-transcription kit (Cat# 4368813, Applied Biosystems, Waltham, MA, USA). For quantitative PCR, synthesized cDNA was amplified by real-time PCR (7500 Fast Real-Time PCR system, Applied Biosystems, Waltham, MA, USA) using iTaq Universal SYBR Green Supermix (Cat# A25742, Applied Biosystems, Waltham, MA, USA). The relative quantity of each RNA transcript was calculated by its threshold cycle after subtracting that of the reference cDNA (β-actin). Data are expressed as the relative quantity of each transcript. Detailed information on the primers is presented in Table 1.

Table 1. Primers sequences used for determining mRNA expression.

Gene name	Sequence (5′-3′)	Accession #
Cyp7a1	Forward: GGGCAGGCTTGGGAATTTTG Reverse: AACGCTCAGCAGTCGTTACA	NM_007824.3
Cyp8b1	Forward: TTGCAAATGCTGCCTCAACC Reverse: TAACAGTCGCACACATGGCT	NM_010012.3
β-actin	Forward: ATGCCCTGAGGCTCTTTTCC Reverse: CAGCTCAGTAACAGTCCGCC	NM_007393.5

Immunofluorescence staining

Immunofluorescence staining was performed as previously described [38]. Briefly, paraffin-embedded liver sections were deparaffinized in xylene and rehydrated through a graded ethanol series. Following deparaffinization, slides were subjected to antigen retrieval using 10 mmol/l sodium citrate buffer (pH 6.0) at 95°C for 15 min. Nonspecific binding was blocked by incubation with Super Block (Cat# AA999, ScyTek Laboratories, Logan, UT, USA) for 1 h at room temperature. Sections were then incubated overnight at 4°C with primary antibodies against F4/80, MDA, or 4-hydroxynonenal (HNE). After thorough washing with PBS, sections were incubated with ImmPRESS^®-AP Horse Anti-Rabbit IgG Polymer Reagent, Alkaline Phosphatase (Cat# MP-5401, Vector Laboratories Inc., Newark, CA, USA) according to the manufacturer’s instructions followed by exposure to Vector Red Substrate Kit, Alkaline Phosphatase (Cat# SK-5100, Vector Laboratories Inc., Newark, CA, USA) for signal development. Nuclei were counterstained by incubating the sections with 4′,6-diamidino-2-phenylindole (DAPI; 1 μg/ml) for 1 min and the slides were imaged using a Keyence BZ-X810 microscope. Antibody details are provided in Table 2.

Table 2. List of primary and secondary antibodies used in experiments.

Primary antibody	Host	Cat. no.	Manufacturer
β-actin	Mouse	66009-1-Ig	Protein Tech
MDA	Mouse	MA5-27560	Invitrogen
4-Hydroxynonenal (4-HNE)	Mouse	MA5-27570	Invitrogen
p53/TRP53	Mouse	MA5-12453	Invitrogen
p21/CDKN1A	Rabbit	14-6715-81	Invitrogen
Nucleotide-binding domain, leucine-rich repeat, and pyrin domain-containing protein 3 (NLRP3)	Mouse	68102-1-Ig	Protein Tech
Interleukin-1β (IL-1β)	Mouse	1242S	Cell signaling technology (CST)
Cluster of differentiation 68 (CD68)	Rabbit	Ab125212	Abcam
F4/80	Rabbit	70076	CST
Transforming growth factor β (TGF-β)	Mouse	sc-130348	Santa Cruz
Tissue inhibitors of metalloproteinases 2 (TIMP2)	Rabbit	ab180630	Abcam
Smooth muscle actin-α (α-SMA)	Mouse	A2547	Sigma
Collagen II	Mouse	NB600-488	Novus

Secondary antibody	Host	Cat. No.	Manufacturer
Peroxidase AffiniPure Goat Anti-Rabbit IgG	Goat	111-035-144	Jackson ImmunoResearch laboratories
Peroxidase AffiniPure Goat Anti-Mouse IgG	Goat	115-035-166	Jackson ImmunoResearch laboratories

Western blotting

Liver homogenates were subjected to Western blot analysis using primary antibodies directed against MDA, HNE, cyclin-dependent kinase Inhibitor (p21), tumor protein 53 (p53), CD68, NLRP3, IL-1β, TGF-β, TIMP2, or β-actin as we previously described [20,23,39]. The same β-actin blot was used as a loading control for multiple targets (MDA, HNE, p53, p21, CD68, IL-1β, and NLRP3), as all corresponding Western blots were performed using the same lysate and processed concurrently. Table 2 provides detailed information on all antibodies used in the present study. Immunoreactive proteins were visualized using an enhanced chemiluminescence substrate (Cat# 170-15060; Bio-Rad Laboratories, Hercules, CA, USA) on a ChemiDoc MP imaging system (Bio-Rad Laboratories), and band intensities were quantified using ImageJ software (version 1.54g).

Statistical analysis

Data were analyzed by ANOVA followed by Tukey post-hoc test for comparisons among groups and results considered statistically different at a probability P-value ≤0.05.

Results

PEMT deficiency promotes hepatic steatosis, liver injury, and altered bile acid metabolism in 6-month-old mice

Body weight, liver weight, liver histology, and hepatic triglyceride levels were comparable between 2-month-old male and female PEMT KO mice and their respective sex- and age-matched WT controls (Supplementary Figure S1). Therefore, all subsequent analyses were conducted in 6-month-old mice. At this age, PEMT KO mice of both sexes displayed significantly higher body, liver weights and serum AST levels compared with their corresponding WT groups (Figure 1A–C). Histopathological examination showed normal hepatic architecture in WT mice, whereas PEMT KO mice exhibited pronounced vacuolated regions consistent with lipid accumulation in hepatocytes surrounding the central vein (Figure 1D). Further biochemical quantification corroborated our histological results as we observed elevated hepatic triglyceride levels in livers of 6-month-old PEMT KO mice when compared to their respective age- and sex-matched WT mice (Figure 1E). Notably, although the representative images of male and female PEMT KO mice appear to differ in lipid droplet size or distribution, quantitative analysis of hepatic triglyceride levels showed no statistically significant differences between the two groups, although female KOs exhibited slightly higher numerical values (Figure 1D). Steatosis scoring of H&E-stained liver tissues following Kleiner Criteria [24] did not reveal any difference in the grading, or percentage of micro- and macrosteatosis between the male and female KOs (Table 3).

Figure 1. PEMT deficiency promotes spontaneous development of hepatic steatosis, liver injury and bile acid accumulation.

(A) Body weight, (B) liver weight, (C) serum ALT levels, (D) representative images of H&E-stained liver sections (scale bar: 50 μm), (E) hepatic triglycerides, (F) bile acids, and (G) mRNA expression encoding for cytochrome P450 family 8 subfamily B member 1 (CYP8B1) in 6-month-old male and female PEMT KO (KOM and KOF, respectively) compared with their respective age- and sex-matched wildtype (WTM and WTF) mice. Data are presented as the mean ± SEM (n = 4–6); values not sharing a common letter significantly differ from each other at P≤0.05.

Table 3. Hepatic steatosis grading.

	Male		Female
	WT	PEMT KO	WT	PEMT KO
Steatosis score	0a	1.13 ± 0.18b	0a	1.43 ± 0.20b
Microsteatosis (%)	0a	12.31 ± 0.03b	0a	10.00 ± 0.03b
Macrosteatosis (%)	0a	20.50 ± 0.06b	0a	21.43 ± 0.03b

Values are mean ± SEM (n = 6); values not sharing a common letter significantly differ from each other at P≤0.05.

In addition, PEMT KO mice of both sexes exhibited increased hepatic bile acid levels compared to their respective WTs (Figure 1F). While the mRNA expression encoding for the first and rate limiting step in bile acid synthesis, cholesterol 7-alpha-monooxygenase (CYP7A1), remained unchanged between PEMT KO and sex- and age-matched WT mice (data not shown), significantly elevated mRNA expression encoding for sterol 12-α-hydroxylase also known as CYP8B1, an enzyme that catalyzes a key step in the conversion of cholesterol to cholic acid, one of the primary bile acids (Figure 1G).

PEMT deficiency alters parameters related to methionine metabolic pathway

HPLC analysis of liver tissues revealed significantly lower hepatic SAM levels and SAM:SAH ratios in PEMT KO mice compared with their matched WT controls (Figure 2A,C). SAH levels were unchanged in males (Figure 2B), whereas female KOs exhibited moderately but significantly elevated SAH levels relative to the other groups. There was also a decrease in hepatic betaine levels in PEMT KO of both sexes compared to their counterpart WTs (Figure 2D) while there was minimal change in the activity of the enzyme, BHMT, that utilizes betaine (Figure 2E) to regenerate SAM.

Figure 2. PEMT deficiency impairs hepatic methylation potential (SAM:SAH ratio) and betaine levels without affecting BHMT activity.

Hepatic (A), SAM, (B) SAH, (C) SAM:SAH ratio, (D) betaine levels, and (E) BHMT enzyme activity (expressed as methionine formed) in male and female wildtype (WTM and WTF) and PEMT KO (KOM and KOF) mice. Data are presented as means ± SEM (n = 5–8); values not sharing a common letter are statistically different, P≤0.05.

PEMT deficiency modulates proteasome and lysosomal hydrolases activities

Alteration of lipid metabolism and cellular stress in PEMT KO mice increased the proteasomal degradation activities as evident from chymotrypsin-like proteosome activities in these mice compared to WT mice (Figure 3A). In contrast, the trypsin-like proteasome (Figure 3B) as well as lysosomal hydrolase activities that play important roles in cellular homeostasis, tissue remodeling and disease progression showed a significant decrease in the KOs. We observed a significant reduction in hepatic cathepsin B and cathepsin L activities in PEMT KOs ice compared to age-matched WT mice (Figure 3C,D). LAL activity is a crucial element, whose impairment leads to the accumulation of triglycerides in the liver [40]. PEMT deficiency resulted in a significant reduction in LAL activity in both male and female mice. Specifically, LAL activity was reduced by approximately 3.7-fold in PEMT KO males and ∼4.9-fold in PEMT KO females relative to their WT controls (Figure 3E).

Figure 3. PEMT deficiency alters proteasomal and lysosomal hydrolases activities.

(A) Proteasomal chymotrypsin-like, (B) proteasomal trypsin-like, (C) lysosomal cathepsin (B,D) cathepsin L, and (E) LAL activities in the livers of 6-month-old male and female wildtype (WTM and WTF) and PEMT KO (KOM and KOF) mice. Data are presented as the mean ± SEM (n = 5–8); values not sharing a common letter significantly differ from each other at P≤0.05.

PEMT deficiency increases ROS production and lipid peroxidation

PEMT deletion contributes to disrupted lipid metabolism and increased cellular oxidative stress. We observed significant elevations in both ROS and TBARS levels in PEMT KO mice compared with WT mice (Figure 4A,B). In addition, both Western blot and immunofluorescence analyses revealed marked increases in MDA- and HNE-modified protein adducts in PEMT KO mice of both sexes compared with WT counterparts (Figure 4C–H).

Figure 4. PEMT deficiency increases oxidative stress.

Levels of (A) ROS, (B) TBARS in the liver of 6-month-old male and female wildtype (WTM and WTF) and PEMT KO (KOM and KOF) mice. (C) Representative Western blot of liver lysates showing the formation of proteins adducts with lipid peroxidation products, MDA or 4-HNE and (D) with band intensities quantified using ImageJ and normalized to the β-actin loading control. (E,F) Representative fluorescent images (scale bar: 100 μm) of liver sections immunostained for MDA or HNE (red) with DAPI nuclear counterstain (blue). (G,H) Quantification of fluorescent intensity showing levels of MDA- and HNE-protein adducts in male and female PEMT KO mice relative to sex-matched WT. Data are presented as the mean ± SEM (n = 4–6); values not sharing a common letter significantly differ from each other at P≤0.05.

PEMT deficiency promotes hepatic senescence and inflammation

Deletion of PEMT not only disrupted hepatic lipid metabolism but also contributed to enhanced senescence and inflammation as evident from increases in markers of senescence (p53 and p21) and inflammation (CD68, NLRP3, IL-1β) in livers of PEMT KO mice when compared to age- and sex-matched WT mice (Figure 5A,B). Further, we found increased F4/80 staining in livers of PEMT KO mice compared to WT mice (Figure 6A,B).

Figure 5. PEMT deficiency promotes hepatic senescence and inflammation.

(A) Western blot showing increases in cyclin-dependent kinase inhibitor (p21), tumor protein 53 (p53), CD68, NLRP3, and IL-1β in representative liver lysates of 6-month-old wildtype (WTM and WTF) and PEMT KO (KOM and KOF) mice and (B) with band intensities quantified using ImageJ and normalized to the β-actin loading control. Data are presented as the mean ± SEM (n = 4); values not sharing a common letter significantly differ from each other at P≤0.05.

Figure 6. PEMT deficiency activates Kupffer cells.

(A) Representative fluorescent images (scale: 100 μm) of liver sections from male and female WT (WTM and WTF) and PEMT KO (KOM and KOF) mice immunostained with F4/80 (red) and counterstained with DAPI (blue). (B) Quantification of F4/80 fluorescent intensity relative to WT males. Values represent means ± SEM from four randomly selected fields per section, with data pooled from individual animals (n = 4); values not sharing a common letter significantly differ from each other at P≤0.05.

PEMT deficiency accelerates the development of liver fibrosis

Picrosirius red staining revealed significantly increased hepatic fibrosis in PEMT KO mice compared with age-matched WT controls. Liver sections from PEMT KO mice exhibited a marked accumulation of collagen bundles relative to WT mice (Figure 7A). These histological findings were further supported by elevated protein expression levels of fibrotic markers, including TGF-β, α-SMA, collagen II, and TIMP2, in PEMT KO mice compared with age- and sex-matched WT mice (Figure 7B,C).

Figure 7. PEMT deficiency accelerates the development of liver fibrosis.

(A) Picrosirius red staining of representative liver sections of 6-month-old male and female wildtype (WTM and WTF) and PEMT KO (KOM and KOF) showing collagen bundles (scale: 50 μm). (B) Western blots showing increases in TGF-β1, α-SMA, collagen II, TIMP2, β-actin in representative liver lysates and (C) with band intensities quantified using ImageJ and normalized to the β-actin loading control. Values are mean ± SEM (n = 4); values not sharing a common letter significantly differ from each other at P≤0.05.

Discussion

PEMT is a key enzyme in one-carbon metabolism that catalyzes the conversion of PE to PC using SAM as a methyl donor. Previous studies have demonstrated that reduced hepatic SAM levels or PEMT deficiency decreases PE methylation-mediated PC synthesis, thereby impairing VLDL secretion and promoting lipid accumulation in hepatocytes [14,17,23,41,42]. The liver primarily stores lipids as triglycerides, an inert and noncytotoxic form of lipid [43]. However, excessive lipid accumulation in hepatocytes is a major driver of oxidative stress, which can accelerate the progression of inflammation and fibrosis [44].

Our findings demonstrate that PEMT KO mice, irrespective of sex, develop spontaneous hepatic lipid accumulation characterized by increased lipid droplet number and elevated triglyceride levels compared with age- and sex-matched WT mice. While no significant differences in hepatic triglyceride levels were observed between 2-month-old PEMT KO and WT mice, triglyceride levels increased approximately 3–4-fold in PEMT KO mice by 6 months of age. Impaired hepatic triglyceride export via VLDL, resulting from deficient PEMT-mediated PC synthesis, appears to be the primary mechanism underlying intracellular lipid accumulation, spontaneous hepatic steatosis, and progressive liver injury. Consistent with this interpretation, hepatocellular damage was reflected by elevated ALT levels in PEMT KO mice compared with WT controls.

In addition to steatosis, PEMT KO mice displayed increased hepatic bile acid levels, suggesting either enhanced bile acid synthesis or impaired biliary secretion [45,46]. Because intracellular bile acid accumulation can activate immune cells and promote inflammation and fibrosis [27,47], the elevated bile acids likely contribute to the heightened inflammatory and fibrotic responses observed in the KO mice. This increase in hepatic bile acids is most consistent with impaired bile acid export, as PC synthesized through the PEMT pathway is essential for the function of the bile salt export machinery. PC is co-secreted with bile acids to form mixed micelles that neutralize their detergent properties. Biliary PC constitutes ∼40% of the organic fraction of bile and is critical for protecting hepatocytes and the biliary epithelium from bile acid-induced cytotoxicity. By converting bile acids from monomers and simple micelles into less-toxic mixed micelles, PC preserves membrane integrity and intestinal mucosal protection [45,48]. Thus, reduced PC availability in PEMT-deficient livers likely contributes to bile acid retention and the progression of liver injury. To further define the mechanisms underlying bile acid accumulation, we examined the expression of enzymes involved in bile acid synthesis. Although the rate-limiting enzyme CYP7A1 was unchanged between KO and sex-matched WT mice, CYP8B1 expression was significantly increased in PEMT-KO animals. Elevated CYP8B1 favors the synthesis of cholic acid, producing a more hydrophobic and detergent-rich bile acid pool that can exacerbate hepatocyte stress and bile acid toxicity. Together, these findings suggest that altered bile acid composition, specifically increased cholic acid synthesis, combined with impaired PC-dependent bile acid export drives the progressive liver injury associated with PEMT deficiency, rather than impaired secretion alone.

Furthermore, the development of steatotic liver disease in 6-month-old PEMT KO mice was associated with a significant reduction in the hepatic SAM:SAH ratio compared with age-matched WT mice. This finding was unexpected, given that PEMT is a major consumer of SAM [49]. We anticipated that PEMT deficiency would result in increased hepatic SAM levels and, consequently, an elevated SAM:SAH ratio. Instead, we observed the opposite effect, with a marked reduction in the SAM:SAH ratio in PEMT KO mice.

Previous studies from our laboratory have demonstrated that a reduced hepatocellular SAM:SAH ratio, with consequent impairment of multiple methylation reactions, represents a central pathophysiological mechanism underlying ALD [50,51]. A similar disruption in methylation potential is evident in PEMT KO mice. The decreased SAM:SAH ratio in these animals appears to primarily reflect impaired SAM regeneration due to reduced hepatic betaine availability. Betaine serves as the methyl donor for BHMT-mediated remethylation of homocysteine to sustain hepatic SAM levels; thus, its depletion severely limits methylation capacity. This mechanism closely parallels observations in ALD, where reduced betaine levels contribute to defects in hepatic methylation reactions [50–52]. In addition to diminished BHMT-mediated remethylation, secondary metabolic disturbances in PEMT-deficient livers may further exacerbate the decline in methylation potential. Increased oxidative stress is known to impair methionine synthase activity, the alternative remethylation pathway in one-carbon metabolism, thereby further limiting SAM regeneration and promoting SAH accumulation [53–55]. Collectively, these defects leading to a sustained reduction in the SAM:SAH ratio are likely key contributors to the progression of liver injury associated with PEMT deficiency.

Our previous studies have indicated an association between the reduction in the methylation potential and altered cellular degradation mechanisms. While proteasomal inhibition can result from a reduction in SAM:SAH ratio [34,56,57], in the present study we observed that while there was a decrease in the trypsin-like proteasomal activity, there was an increase in the chymotrypsin-like activity in the PEMT KOs compared to WT. This selective increase in the chymotrypsin-like activity of the proteasome is likely a compensatory response to the oxidative stress as reported [35] and an attempt to manage the growing load of irreversibly damaged cellular components, such as MDA- and HNE-protein adducts. Cathepsins are the most abundant lysosomal proteases that are mainly found in the acidic endo/lysosomal compartments where they play a vital role in intracellular protein degradation, energy metabolism, immune responses and cell survival [58]. We observed decreased activities of cathepsins B and L as well as LAL in PEMT KO mice when compared to WT mice. The loss of cathepsin and LAL activities are related to reduction in SAM:SAH ratio as treatment with betaine that normalizes SAM:SAH ratio also reverses the inhibition as recently reported [40]. Inhibition of the lysosomal enzyme activities could contribute to increased triglyceride accumulation in the KO mice via a reduction in LAL activity while a deficiency in cathepsin can cause toxic buildup resulting in cell stress, promote inflammation, cell death [59], and cellular senescence [60] as seen in the PEMT KOs.

The accumulation of lipids affects cellular function through different mechanisms including oxidative and endoplasmic reticulum stress, mitochondrial dysfunction, and induction of apoptosis [44]. In the present study, PEMT deletion contributed to hepatic fat accumulation and increased cellular oxidative stress as evident by increased TBARS, and levels of protein adducts with lipid peroxidation byproduct, MDA and HNE. These Western blot findings were further corroborated by immunofluorescence analysis, providing evidence for enhanced lipid peroxidation at the cellular level in PEMT-deficient livers. Binding of highly reactive lipid peroxidation byproducts to proteins and DNA disrupts the normal function of these macromolecules, leading to cellular dysfunction and, ultimately, cell death. Moreover, the formation of HNE- and MDA-protein adducts can elicit immune responses and contribute to disease pathogenesis [61,62].

Oxidative stress and chronic inflammation are well-established drivers of progressive liver injury, and substantial experimental and clinical evidence demonstrates that oxidative stress initiates inflammatory signaling and promotes its transition to fibrosis [63,64]. In the present study, the marked lipid accumulation in the livers of 6-month-old PEMT KO mice was accompanied by increased oxidative stress and a robust inflammatory response. This was evidenced by activation of Kupffer cells, enhanced macrophage infiltration, and elevated protein levels of key inflammatory mediators, including NLRP3 and IL-1β, compared with WT controls. We also observed a significant increase in the expression of the cell-cycle arrest markers p21 and p53 in PEMT-KO mice, consistent with hepatocellular stress and injury. Mechanistically, ROS and lysosomal damage are known activators of the NLRP3 inflammasome [65], which in turn drives the maturation and release of pro-inflammatory cytokines such as IL-1β [66]. In the present study, in line with increased levels of lipid peroxides and NLRP3 component, we have observed increased protein levels of IL-1β in PEMT KO mice. This cytokine perpetuates the inflammatory cycle by initiating cell death and recruiting peripheral immune cells. This dramatic increase in Kupffer cell activation, massive infiltration of CD68 positive macrophages coupled with enhanced NLRP3 signaling and cytokine release, collectively confirms that PEMT deficiency spontaneously drives the liver into a severe, self-sustaining inflammatory state, establishing the pathological bridge linking steatosis to the inevitable progression toward fibrosis.

Consistent with observed inflammation, picrosirius red staining revealed significant collagen bundles in the liver sections of PEMT KO mice of both sexes compared to their WT counterparts demonstrating hepatic fibrosis. This was further validated by the increased protein expression of fibrotic markers, including TGF-β, α-SMA, collagen II, and TIMP2. These findings confirm that the absence of PEMT promotes progressive liver fibrosis spontaneously in relatively young mice on a healthy chow diet without any external second insults such as alcohol, high-fat, or viral infection.

To summarize, we show that the absence of PEMT disrupts the SAM:SAH ratio in the liver that is accompanied by the spontaneous development of hepatic steatosis, inflammation, fibrosis at a relatively young age of 6 months compared to control mice. These effects arise from the loss of PEMT-mediated PC synthesis. We did not observe any significant differences in metabolic dysfunction between the female and male PEMT KO mice, except for higher levels of SAH, ROS, and TBARS in the females. These elevations may reflect sex hormone-dependent differences that increase female susceptibility to PEMT deficiency. Such sex dependent effects are biologically plausible, as estrogen normally enhances PEMT expression, influences SAM:SAH homeostasis, and modulates antioxidant defenses. In the absence of PEMT, these estrogen-regulated pathways may become dysregulated, contributing to the greater accumulation of methylation intermediates and oxidative stress observed in females.

Based on the findings in the present study, we propose that loss-of-function polymorphisms in PEMT may have similar consequences in humans as they age despite being on a balanced diet. These changes could also result in heightened vulnerability to second hits as has been reported by feeding these KOs a high-fat diet [67]. These insights underline the importance of PEMT in maintaining metabolic health and pave the way for future research into age-related liver dysfunctions.

Conclusions

Our research provides compelling evidence that PEMT deficiency promotes the spontaneous development of progressive liver disease at a relatively young age, despite being fed a standard diet. The present study underscores the role of PEMT-mediated PC production in preventing liver injury.

Clinical perspectives

• The enzyme PEMT is a vital enzyme in hepatic phospholipid metabolism, and human polymorphisms leading to its reduced function have been epidemiologically linked to an increased risk of MASLD.

• In the present study, deletion of PEMT in mice was sufficient to spontaneously induce a progressive liver pathology: from steatosis and reduced SAM:SAH ratio to chronic inflammation (MASH), bile acid accumulation, and severe hepatic fibrosis, even on a standard diet.

• These findings establish PEMT deficiency as a primary driver of advanced liver disease, highlighting its potential utility as a critical early risk predictor and a novel therapeutic target for preventing fibrotic progression in MASLD and CLD patients.

Abbreviations

α-SMA

smooth muscle actin-α

ALT

alanine aminotransferase

ALD

alcohol-associated liver disease

BHMT

betaine–homocysteine methyltransferase

CD68

cluster of differentiation 68

CLD

chronic liver disease

CYP7A1

cholesterol 7-alpha-monooxygenase

CYP8B1

cytochrome P450 family 8 subfamily B member 1

DAPI

4′,6-diamidino-2-phenylindole

H&E

hematoxylin and eosin

HNE

hydroxynonenal

HPLC

high-performance liquid chromatography

IL-1β

interleukin-1β

KO

knockout

LAL

lysosomal acid lipase

MASH

metabolic dysfunction-associated steatohepatitis

MASLD

metabolic dysfunction-associated steatotic liver disease

MDA

malondialdehyde

NLRP3

nucleotide-binding domain, leucine-rich repeat, and pyrin domain-containing protein 3

PC

phosphatidylcholine

PE

phosphatidylethanolamine

PEMT

phosphatidylethanolamine N-methyltransferase

ROS

reactive oxygen species

SAH

S-adenosylhomocysteine

SAM

S-adenosylmethionine

TBARS

thiobarbituric acid-reactive substances

TGF-β

transforming growth factor β

TIMP2

tissue inhibitors of metalloproteinases 2

VLDL

very-low-density lipoprotein

WT

wildtype

Data Availability

Data will be provided upon request.

Competing Interests

The authors declare that there are no competing interests associated with the manuscript.

Funding

This work was supported by the Department of Veterans Affairs, Veterans Health administration, Office of Research and Development Merit Review grant I01BX006064 (KKK) and Research Career Scientist award IK6RD001206-01 (KKK) and the National Institutes of Health/NIAAA grant P50AA030407-1531 (KKK).

Open Access

Open access for this article was enabled by the participation of the University of Nebraska Medical Center in an all-inclusive Read & Publish agreement with Portland Press and the Biochemical Society under an agreement with the Big Ten Alliance.

CRediT Author Contribution

Sathish Kumar Perumal: Investigation, Methodology, Validation, Writing—original draft. Ramachandran Rajamanickam: Investigation, Methodology, Validation. Madan Kumar Arumugam: Investigation, Methodology, Validation, Co—writing—original draft. Srinivas Chava: Investigation, Methodology, Validation. Ramesh Bellamkonda: Investigation, Methodology, Validation. Sundararajan Mahalingam: Investigation, Methodology, Validation. Natalia A. Osna: Writing—review & editing. Isis Trujillo-Gonzalez: Investigation, Methodology, Validation. Kurt W. Fisher: Methodology (Histological validation). Karuna Rasineni: Data curation, Validation, Writing—review & editing. Kusum K. Kharbanda: Conceptualization, Data curation, Formal analysis, Funding acquisition, Validation, Writing—review & editing.

Ethics Approval

The animal study protocol was approved by the Institutional Animal care and Use Committee of Omaha Veterans Affairs Medical Center (IRBnet# 1576244; approval date 12/14/2017).