Skip to main content
Frontiers in Allergy logoLink to Frontiers in Allergy
. 2026 Jun 16;7:1811482. doi: 10.3389/falgy.2026.1811482

Development, propagation and characterization of human somatic cell-derived bronchial organoids as model system for airway diseases – A practical guide

Laura Kühl 1,†, Ariana Carvalho 1,2,†, Nicole Löwer 1, Sarah Miethe 1, Kim Pauck 1, Katrin Roth 3, Nele von Daacke 1, Pauline Graichen 1, Eva Müßig 1, Emma Huy 1, Anne Mende 1, Annika Block 1, Melanie Bachl 1, Jan Henrik Pflugmacher 1, Paul Dechert 1, Daniel P Potaczek 1,4, Atefeh Sadeghi Shermeh 1,‡, Holger Garn 1,*,‡
PMCID: PMC13314865  PMID: 42382014

Abstract

Human bronchial organoids represent a highly advanced 3D cell culture model system that reflects complex features of the airway epithelium, including structure, developmental aspects, tissue-specific functions and heterogeneous cell-cell interactions. Thus, they serve as an ideal model to study physiological differentiation and activation processes of the bronchial epithelial cells, as well as pathophysiological mechanisms of lower airway diseases. We have established, refined and validated a series of protocols for the generation, perpetuation and characterization of human bronchial lung organoids based on somatic cells derived from surgical lung tissue samples as well as from primary bronchial epithelial cells which may be obtained from healthy and diseased donors. Such organoids are cultured in an extracellular matrix gel with a serum-free medium containing a precisely adjusted growth factor cocktail. This maintains the balance between the self-renewal and differentiation capacities of the local progenitor cells, allowing the long-term culture of organoids if specific splitting and dilution as well as freezing/thawing procedures are carried out regularly and appropriately. Here we provide these detailed protocols to enable researchers to apply the organoid technology and to generate highly comparable and complementary data. Furthermore, we present several examples for the detailed characterization and analysis of human bronchial organoids, such as gene-level expression analysis, covering single cell RNA sequencing, as well as imaging and metabolic activity-based assays.

Keywords: 3D cell culture model system, air-liquid interface (ALI) cultures, airway diseases, airway epithelium, bronchial organoids, human lung organoids, single cell RNA sequencing

1. Introduction

Organoids are highly advanced, complex, three-dimensional (3D) cell culture systems composed of various tissue- and organ-specific cell types with self-organizing and self-renewing properties (1). Due to their potential to bridge the methodological gap between simple in vitro cell cultures and complex in vivo animal model systems, human lung organoids are gaining increasing interest as a disease model system in translational research (2–6).

The human airway epithelium is a complex tissue that plays a fundamental role in the proper functionality of the respiratory system. Impairments on this tissue are involved in a variety of respiratory diseases. In order to understand the structural and functional complexity of human airways in both healthy and diseased conditions, suitable models of human airway biology are necessary. So far, several model systems with different levels of complexity have been in use, ranging from simple cell cultures to sophisticated in vivo animal models (7). The simplest experimental approach is the use of immortalized airway epithelial cell lines, such as BEAS-2B or 16HBE14o. The culture of these cells is easy, fast, and reproducible. However, it needs to be considered that they are modified and thus neither accurately represent natural airway cell biology nor the complex structure and function of the healthy or diseased airway epithelium. Alternatively, primary human bronchial epithelial cells (HBECs) can be used. However, their in vitro lifespan is limited, and they do not undergo mucociliary differentiation under submerged conditions (8). Therefore, to increase the complexity of in vitro cultures, more sophisticated methodologies have already been developed. A step into this direction was the establishment of air-liquid interface (ALI) culture systems, which are generated by polarization of primary HBECs. In this model, the basal side of the culture is in permanent contact with the nutritive medium, while the apical surface of the cell layer is exposed to air, resulting in the development of a pseudostratified mucociliary phenotype (9). Another, even more complex model is based on precision cut lung slices (PCLS), where viable organ specimens are sliced and cultivated ex vivo for a certain time (10, 11). This approach has the advantage of essentially containing all cell types present in the human lung in their original 3D architecture. However, PCLS cultures are time-limited and continuous degradation processes may interfere with experimental outcomes. Finally, in vivo experiments are performed on animal models, primarily using mice. Although these models represent the highest level of organization, they exhibit a variety of physiological, cellular, and molecular differences to humans. Indeed, the airways of mice and humans differ in many aspects. For example, human bronchioles are lined by a pseudostratified epithelium, whereas the small airways of mice only have a simple epithelium. Therefore, translation of insights obtained from mouse model systems into human airway function needs to be carried out with caution (12). Furthermore, ethical concerns may arise because in vivo experiments require the sacrifice of a large number of animals.

Lung organoids offer a comprehensive experimental approach representing the complexity of the entire airway epithelium in a virtually unlimited, continuous 3D cell culture system. They have the potential to reflect complex tissue/organ-specific functions and heterogeneous cell-cell interactions in vitro (13). Additionally, unlike in PCLS and ALI cultures, progenitor cell capacities of the basal cells are retained in human lung organoids, enabling their culture over longer periods of time. Distinct media compositions and specific culture protocols are required to achieve this quasi-immortality and promote the differentiation into multiple cell types present in the airway epithelium. This provides the significant advantage of generating a large stock of source material for long-term use through standardized passaging, freezing and thawing procedures.

It is important to note that, depending on the medium components used, lung-derived organoids may resemble either alveolar or bronchial lung structures, or a combination of both (14, 15). Human bronchial organoids are best suited to address scientific questions related to the pathogenesis of diseases that primarily affect the small airways, e.g., bronchial asthma, chronic obstructive pulmonary disease (COPD), viral or bacterial infectious diseases, and cystic fibrosis, as well as their clinical phenotypes and courses (4, 16). In general, bronchial organoids can be derived from induced pluripotent stem cells or from primary somatic epithelial cell preparations obtained from surgical lung samples, bronchial brushes, or from commercially available primary HBECs, provided that they contain a sufficient proportion of progenitors with stem cell-like capacities (17, 18).

Here, we provide detailed protocols for the generation, perpetuation and storage of human somatic cell-derived bronchial organoids. We also present example procedures for their thorough characterization using various molecular and cellular analyses, such as single cell RNA sequencing (scRNA-seq) and reverse transcription quantitative polymerase chain reaction (RT-qPCR), as well as imaging and viability assays.

2. Methods

2.1. scRNA-seq

Single cell data were generated using the BD Rhapsody system implementing the Single-Cell Capture and cDNA Synthesis with BD Rhapsody Single-Cell Analysis System Protocol (Doc ID: 23-22951(02)) and the BD Rhapsody System mRNA Whole Transcriptome Analysis (WTA) and Sample Tag Library Preparation Protocol (Doc ID: 23-24119(03)). Samples were individually hash-tagged with the BD Flex Single-Cell Multiplexing Kits (Cat. No. 633849-633852) and the respective protocol [Doc ID: 23-24311(01)], combined with a PE-labelled primary antibody against β2-microglobulin (Cat. No. 551337; all reagents from BD Biosciences, Heidelberg, Germany) at a 1:5 dilution. The libraries of ∼11,000 captured cells were sequenced on an Illumina Novaseq6000 Sequencer with 57,000 reads/cell at the Genomics and Bioinformatics Platform of the Institute of Lung Health, Justus Liebig University, Giessen, Germany. Raw data were processed using the standard settings on the BD Rhapsody Sequence Analysis Pipeline (Revision: 0) at sevenbridges.com. Processed data was filtered based on the following criteria: mitochondrial percentage <40%, nCount >300, nFeatures between 300 and 10,000 and log10GenesPerUMI > 0.8. One sample was found to dominate the analysis; therefore, it was randomly downsampled to 450 cells, resulting in a total of approximately 7,000 high-quality cells for further analysis.

2.2. Stimulation of organoids with poly(I:C)

To test the biological activity of organoids to an external stimulus, organoids cultured for four weeks after last splitting (Supplementary Protocol 3) were stimulated by addition of 5 µg/mL or 20 µg/mL of Poly(I:C) (polyinosinic:polycytidylic acid; Biozol, Hamburg, Germany) to the culture medium for 24 h. Subsequently, organoid cells were isolated and analyzed for inflammatory gene expression by RT-qPCR.

2.3. RT-qPCR

Organoid cells were isolated, total RNA was extracted using the RNeasy Mini Kit (Qiagen, Hilden, Germany), and the RNA concentration was determined using a Qubit 4 Fluorometer (Thermo Fisher Scientific, Waltham, MA, USA). Complementary DNA was synthesized using 100 ng of total RNA and the qScript™ Flex cDNA Synthesis Kit (Quantabio, Beverly, MA, USA). qPCR was performed on a Rotor-Gene Q cycler (Qiagen) using QuantiNova SYBR Green Master Mix (Qiagen). The relative expression of the genes of interest was normalized to the housekeeping genes PGK1 or RPLP0. Used primer sequences are provided in Table 1.

Table 1.

Primer sequences.

Target gene Forward primer Reverse primer
KRT5 GGGCGAGGAATGCAGACTCA CACTGCTACCTCCGGCAAGA
BCAM (CD239) CCGGGCTCAGTCTCCGC GGGTACAGACAAGCGCACCT
ITGA6 CTTCTCGCTGGCCATGCAC TTCTGACGTGGGGTCAGCATC
SCGB1A1 TGAAACTCGCTGTCACCCTCA CGCTGAAAGCTCGGGCAGAT
MUC5AC CAGTGTGAGAAGCACCAGGA CAGCAGCCGTCCTTGCT
CEACAM5 TGCCAGGCGCAGTGATTCAG GGTGGATTGCTGGAAAGTCCCAT
FOXJ1 TACTTCCGCCACGCAGATCC CCCTTGCCTGGTTCGTCCTT
TUBA1B TCGCCTTCGCCTCCTAATCC CACTTGGCATCTGGCCATCG
TNF GAGGCCAAGCCCTGGTATG CGGGCCGATTGATCTCAGC
IL1B AGCTTGGTGATGTCTGGTCC GCCCAAGGCCACAGGTATT
CXCL8 CAGCTCTGTGTGAAGGTGCAGTT TTTCCTTGGGGTCCAGACAGA
PGK1 GTTGACCGAATCACCGACCT AGCAGCCTTAATCCTCTGGTT
RPLP0 GCGTCCTCGTGGAAGTGACAT GCTTGGAGCCCACATTGTCTG

2.4. Live cell imaging of human bronchial organoids

New organoid cultures were set-up following splitting (Supplementary Protocol 3) and maintained in 12-well plates by changing the medium twice a week for two or five weeks. For the latter, the culture was diluted (Supplementary Protocol 4) three weeks after seeding. Live brightfield imaging of the cell culture plates was performed using the inverted microscope THUNDER Imager Cell (Leica Microsystems, Wetzlar, Germany) at 5× and 20× magnification. Furthermore, an organoid culture was maintained to develop a high level of differentiation and Supplementary Video S1 was recorded using the inverted microscope AE31E (Motic, Xiamen, China) at 4× magnification.

2.5. Live/dead cell staining

Human bronchial organoids grown for 14 days in TruLive 3D dishes (Luxendo/Bruker, Heidelberg, Germany), as described in Supplementary Protocol 11, were either exposed to 5% dimethyl sulfoxide (DMSO) in 3D Expansion Medium for 24 h or were left untreated. Afterwards, live and dead cells were labelled with 1:1,000 CellTracker Green CMFDA (ThermoFisher Scientific) and 12.5 μM propidium iodide (BD Biosciences), respectively, and nuclei of all cells were stained with 1:1,000 DAPI, according to Supplementary Protocol 11. The samples were imaged using the light sheet microscope TruLive 3D (Luxendo/Bruker) and a 31.25× water immersion objective. Original data were processed by a 2 × 2 binning (X-Y) and converted into Imaris files (Bitplane, Oxford instruments, Abingdon, UK).

2.6. Immunofluorescence assay (IFA)

Organoid samples were stained according to Supplementary Protocol 10. The Positive IFA sample was labelled with an anti-E-cadherin polyclonal antibody (1:40; R&D Systems, Minneapolis, MN, USA) and a secondary donkey anti-goat antibody Alexa Fluor 568 (1:1,000; Thermo Fisher Scientific), while the negative control was only incubated with the secondary antibody. Nuclei in both samples were stained with DRAQ5 (1:200; BD Biosciences) and organoids were then embedded in Matrigel (Cultrex Reduced Growth Factor Basement Membrane Extract; R&D Systems). Images and Supplementary Video S2 were captured with the multiphoton microscope FVMPE-RS (Olympus, Hachioji, Tokyo, Japan) and a 25× water immersion objective. The Insight DeepSee parameter was set to 1040 nm.

2.7. Metabolic/viability assay using organoid ring cultures

Both the endpoint and kinetic organoid metabolic assays were conducted according to Supplementary Protocol 12. For the endpoint assay, organoids were seeded as ring cultures at three different densities (300, 400 and 500 cells/µL Matrigel). Samples were grown for 10 days and exposed to 20% DMSO in 3D Expansion Medium for the final 72 h, or were left untreated (Medium). For the kinetic assay, organoids were plated at a seeding density of 250 cells/µL Matrigel and grown for two weeks before the metabolic activity of the cells in these organoid cultures started to be repeatedly assessed for two more weeks.

Images of the ring cultures were acquired using the inverted microscope AE31E (Motic) at 4× magnification. The organoid metabolic activity was assessed using the CellTiter-Blue Cell Viability Assay (Promega, Madison, WI, USA). For this, cultures were incubated with the CellTiter-Blue Reagent for four hours at 37 °C with 5% CO2 before fluorescence was measured using an Infinite 200 Pro plate reader (Tecan Austria, Grödig, Austria).

2.8. Statistics

Statistical analysis of quantitative data was performed using GraphPad Prism (version 10.2.3). Comparisons between two groups were conducted using Welch's t-test. Linear correlation analyses were done based on means.

3. Results

3.1. General procedures for the development and propagation of human bronchial organoids

Human bronchial organoids representing main structural and functional features of small human airways can be developed from finite epithelial sources, i.e., primary somatic airway cell preparations or from non-finite sources, such as induced pluripotent stem cells (iPSCs), or even cell lines developed from airway cells at early states of differentiation, like BEAS-2B (see Figure 1). Here, we will exclusively focus on methodologies dealing with somatic cell-derived organoids that can be developed using single cell preparations obtained from lung biopsies, surgical explants or bronchial brushings, either directly or from basal (i.e., progenitor) cells isolated thereof.

Figure 1.

Flowchart diagram illustrating finite versus non-finite epithelial sources and workflows for organoid cultures. Procedures include splitting, freezing, thawing, seeding, and culturing as ALI or ring cultures.

Schematic overview of steps and procedures for the generation and propagation of human bronchial organoids as a continuous culture system. iPSCs, induced pluripotent stem cells; HBECs, human bronchial epithelial cells; P, passage; D, dilution; ALI, air-liquid interface.

3.1.1. Establishment of bronchial organoid cultures

To generate organoids from the aforementioned source materials, the initial preparation should be provided as single cell suspension. In case of lung tissue, this can be prepared by initial tissue dissection with a razor blade followed by collagenase digestion and treatment with red blood cell lysis buffer. Single cells are seeded in a drop of a synthetic extracellular matrix, such as Matrigel (i.e., Cultrex Reduced Growth Factor Basement Membrane Extract), which is placed in a well of a cell culture plate. 3D Expansion Medium containing an optimized mixture of growth factors (see Supplementary Protocol 1) is then added to the well, which triggers stem cells with progenitor activity to proliferate and differentiate, thus growing into typical 3D-shaped organoids (for details, see Supplementary Protocol 2). The first small organoids with a lumen can usually be observed after three to five days of culture. Over time, microscopic morphology reveals spherical structures with a visible lumen, mucus production and motile cilia movement inside, corresponding to the apical side of the airway epithelium in vivo, as can be seen in Supplementary Video S1.

3.1.2. Propagation of bronchial organoids by splitting and dilution procedures

Long-term propagation and expansion of established organoid cultures over multiple passages can be achieved by a cyclic workflow consisting of two propagation procedures called organoid splitting and organoid dilution (see Figure 1), with the latter being facultative for this process. The term “splitting” describes the process of passaging organoids. In this procedure, the 3D structures of the organoids are disrupted by enzymatic and mechanical processes. The resulting single cell suspension is then seeded in a new drop of Matrigel and, due to the self-renewing and self-organizing capabilities of the present progenitor cells, a new passage of organoids can grow out and develop into new 3D organoid structures (see Supplementary Protocol 3). We recommend performing this procedure 1-2 times at the early stage of organoid development from primary tissue/cells (i.e., before organoids are used for intended experiments) to avoid integration of cells already finally differentiated at the initiation of the organoid cultures. Furthermore, organoid splitting should be applied when analyzing early differentiation mechanisms and the impact of endogenous (e.g., genetic variations, epigenetic alterations due to disease background, inflammatory mediators) or exogenous (e.g., environmental compounds, drugs) factors on these processes is intended.

If organoid cultures need to be expanded because the structures require more space to grow (e.g., due to increased size or number of organoids within the Matrigel drop), but the 3D structure must/should not be destroyed, proceeding with the “dilution” protocol is indicated. In this process, organoids are isolated by dissolving Matrigel at lower temperatures and the resulting suspension is seeded in one or more new drops of Matrigel at a lower organoid density and cultures are continued (see Supplementary Protocol 4). This procedure is recommended for investigating the effects of the above-mentioned impacts on fully differentiated structures with advanced cell composition and established cell-to-cell interactions. For these approaches, it needs to be considered that stimulation occurs from the basal side of the epithelium as this represents the outer layer of the organoids. Dilution of organoids may also be required when bigger organoid structures are to be analyzed or lower densities are advantageous (e.g., for imaging analyses).

The combination of the mentioned methodologies allows the expansion of organoids in both number and size (i.e., number of cells per organoid), enabling multiple experiments to be performed based on identical primary biological source material. It has been demonstrated that gene expression patterns of organoids remain relatively stable over time during culture (13, 19). In addition, for long-term storage, either single cell suspensions obtained following splitting or whole organoids with preserved 3D structure can be cryopreserved in liquid nitrogen and thawed for further use at later time points (see Supplementary Protocols 5-8).

Finally, single cell suspensions obtained by organoid splitting may be used not only to re-establish organoid cultures but also for the initiation of two-dimensional (2D) ALI cultures (see Supplementary Protocol 9) that exhibit very similar properties to those developed from primary human airway cells. In this regard, human bronchial organoids may serve as a continuous supply of human airway cells for ALI culture experiments, with the advantage of conserving the identical biological background for a series of consecutive experiments.

3.2. Characterization of human bronchial organoids

3.2.1. Composition and characteristics of human bronchial organoids at different stages of development

The bronchial epithelium consists of different major cell types, including basal cells, secretory cells (such as club cells and goblet cells) and ciliated cells (20, 21). Basal cells are the local progenitor cells of the airway epithelium that may proliferate and differentiate and thus are important for renewal and reparation of the bronchial epithelium. They have the potential to differentiate into all different airway epithelial cells via intermediate basal cell precursors. Different signaling pathways are activated for this purpose, e.g., involvement of the Notch pathway leads to the development of secretory cell lineages, while activation of the c-Myb pathway results in ciliated cell differentiation (22, 23). The underlying activities are regulated by the coordinated action of a number of specific growth factors. Due to a precise mixture of such factors added to the 3D Expansion Medium (for details see Supplementary Protocol 1), which provide balanced signals for proliferation and differentiation, basal cells present in the initial lung cell suspension are enabled to initiate organoid formation. Further differentiation processes, as well as the intermediate cell states, are also observed during organoid development and growth (see below).

3.2.2. Single cell analysis of bronchial organoids

scRNA-seq was employed to obtain an unbiased, high-resolution view of the cellular composition of bronchial organoids, enabling assessment of epithelial heterogeneity and differentiation states. To demonstrate kinetics and robustness of the organoid culture system, organoids from three independent biological replicates were maintained for two different periods of time, i.e., one week or eight weeks following last splitting, here called “early” and “late” organoids, respectively (Figure 2A). The results of a Uniform Manifold Approximation and Projection (UMAP) analysis of single cells derived from early and late culture conditions of bronchial organoids, based on scRNA-seq data, are shown in Figure 2B. Coloring by culture conditions reveals a separation between cells derived from early and late organoids. Early organoid cells are predominantly localized in the upper region of the UMAP, and late organoid cells are enriched in the lower part, indicating that distinct transcriptional states are associated with culture duration. Unbiased Phenograph-based clustering resulted in six main epithelial cell clusters (Figure 2C), which were annotated based on established reference annotations reported in previous publications (24, 25). Cell identities were inferred based on the relative enrichment and specificity of canonical marker genes across clusters, including proliferating basal cells (TOP2A, STMN1, MKI67), basal cells (TP63, KRT5), differentiating basal cells (KRT5, KRT13, KRT17, KRT19), secretory cells (SCGB1A1, SCGB3A1, RNASE1), transitional secretory cells (SOX4, CLDN4, SCGB1A1, STEAP4, CEACAM6), and ciliated cells (FOXJ1, TUBA1A, DNAH5, CCDC40) (Figure 2D). As shown in Figure 2E, organoids at one week of culture consist predominantly of basal cells at different levels of differentiation with about 50% of all cells being proliferating basal cells. This indicates the high (proliferative) activity of progenitor cells at early time points of organoid development. In contrast, more differentiated cells such as secretory, transitional secretory, and some ciliated cells represented a markedly larger fraction of total cells in late organoids at eight weeks of culture, indicating a progressive differentiation process in such organoids over longer time periods. Alveolar type 1 and type 2 cells could not be detected at any time point of analyses, which can be attributed to the specific composition of the culture medium and contained growth factors favoring the differentiation of progenitor cells into bronchial cell types and preventing differentiation into alveolar cells.

Figure 2.

Panel A shows a workflow diagram of single-cell RNA sequencing from three biological samples through culturing, cell hashing, pooling, BD Rhapsody analysis, and sequencing at two time points (early and late) of organoid development. Panel B is a UMAP plot of single-cell sequencing data colored by time point (early and late organoids). Panel C is a UMAP plot colored by cell type clusters, including proliferating basal, basal, differentiating basal, secretory, transitional secretory, and ciliated cells. Panel D displays a dot plot visualizing marker gene expression across cell clusters, with dot color indicating average expression level and dot size showing the percent of expressing cells. Panel E is a stacked bar chart comparing the proportions of cell clusters in early versus late organoids.

Comparative single cell RNA sequencing-based characterization of organoids at two time points of culture. (A) Schematic overview of the experimental workflow. Bronchial lung organoids derived from three independent biological samples were cultured for one week (early organoids) or eight weeks (late organoids) after last splitting. Organoids were dissociated into single cell suspensions which were individually hash-tagged, pooled, and processed for scRNA-seq using the BD Rhapsody platform. (B) UMAP visualization of single cells colored by culture condition. (C) UMAP representation of main epithelial cell populations annotated based on canonical marker gene expression. (D) Dot plot showing scaled, averaged expression of selected marker genes across annotated epithelial cell populations. (E) Stacked bar plot showing the relative proportion of cell clusters identified in (C) in organoid cells from the two culture conditions. scRNA-seq, single cell RNA sequencing; Prol. basal, proliferating basal; Diff. basal, differentiating basal; Trans. secretory, transitional secretory.

3.2.3. RT-qPCR characterization and functional validation of bronchial organoids

Transcript-level characterization of organoids can also be performed using simpler and more widely used methods, such as RT-qPCR. Here we show an example using a panel of primers identifying established epithelial markers to indicate the presence of basal cells (KRT5, BCAM, and ITGA6), secretory cells (SCGB1A1, MUC5AC, and CEACAM5), and ciliated cells (FOXJ1 and TUBA1B) in a human bronchial organoid culture at 12 weeks following seeding (see Figure 3A) (7, 20, 26, 27). The high expression of the basal and secretory lineage markers KRT5 and SCGB1A1 confirms the dominant presence of these cell types while the rather low expression of FOXJ1 and TUBA1B hints to a lower abundance of ciliated cells even at this later stage of organoid development. However, RT-qPCR analysis of lineage markers provides a rather qualitative characterization of epithelial identity. It does not allow for the direct quantification of epithelial subtype proportions due to gene-specific differences in expression levels (as for example indicated by the lower expression of BCAM or MUC5AC), differential expression in cell subtypes (e.g., resident secretory cells vs. activation-induced goblet cells), and/or concomitant expression of lineage-specific markers, e.g., in transitional cell states.

Figure 3.

Panel A contains three grouped bar charts showing relative gene expression (2^-ΔCt) for airway epithelial cell markers: KRT5, BCAM, ITGA6 (brown; basal cells); SCGB1A1, MUC5AC, CEACAM5 (blue; secretory cells); and FOXJ1, TUBA1B (pink; ciliated cells), each as mean + standard deviation. Panel B presents a grouped bar chart showing fold change in TNF, IL1B, and CXCL8 expression after treatment with five micrograms per milliliter (orange) and twenty micrograms per milliliter (red) Poly(I:C), as means + standard deviation with significant differences indicated by asterisks.

Human bronchial organoid characterization by gene expression analysis via RT-qPCR. (A) Baseline expression of selected marker genes for main epithelial cell subtypes assessed in a bronchial organoid culture at 12 weeks following last splitting. The three panels show marker gene expression profiles for basal (left), secretory (middle), and ciliated (right) cells. Data are shown as relative expression normalized to the housekeeping gene PGK1 (2−ΔCt). (B) Expression of pro-inflammatory cytokine genes analyzed in an organoid culture four weeks after the last splitting, following 24 h stimulation with two different concentrations of Poly(I:C), to assess the functional responsiveness of bronchial organoids. Relative expression levels of TNF, IL1B, and CXCL8 are shown in comparison to the mock control, after normalization to the housekeeping gene RPLP0. Shown are means + standard deviation of n = 2 replicates. Statistical testing was performed using delta Ct values and significant differences to the untreated controls are indicated by (*) for p-values < 0.05.

Furthermore, to demonstrate the functional responsiveness of organoids, the expression of pro-inflammatory cytokine genes was investigated following stimulation with the Toll-like receptor-3 agonist Poly(I:C), a synthetic analog of viral dsRNA (28). For this purpose, bronchial organoid cultures at four weeks following seeding were treated with Poly(I:C) at two different concentrations (5 µg/mL and 20 µg/mL) for 24 h. Subsequent RT-qPCR analysis revealed a dose-dependent up-regulation of the selected genes (TNF, IL1B, and CXCL8) in response to Poly(I:C) treatment compared to untreated control conditions (Figure 3B).

3.3. 2D and 3D imaging of bronchial organoids

In addition to the described molecular biology methods, imaging analyses may further contribute to organoid characterization. The dilution protocol (Supplementary Protocol 4), which may be repeatedly executed, enables the culture of human bronchial organoids for several weeks, which is particularly advantageous for achieving increased organoid complexity with higher levels of differentiation into all major airway epithelial cell types. This coincides with the development of the typical 3D-appearance of bronchial organoids, as shown in Figure 4A, demonstrating organoids with a well-defined lumen after five weeks in culture (right panel) in contrast to organoids that have been in culture for only two weeks (left panel).

Figure 4.

Panel A shows brightfield images of human bronchial organoids at two weeks and five weeks, with insets magnifying individual organoids to highlight an increased level of differentiation and organization over time. Panel B presents fluorescence microscopy of live cells in green, dead cells in red, and nuclei in blue for organoids cultured in standard medium versus five percent DMSO, as single-stained and merged images illustrating viability differences between conditions. Panel C displays immunofluorescence images showing nuclei in blue and E-cadherin in red, as single-stained and merged views for positive immune fluorescence staining and negative controls, revealing specific protein expression.

Examples for different imaging analyses of human bronchial organoids via three different techniques. (A) Live cell imaging using brightfield microscopy of cultures derived from the same organoid line at two (left) and five (right) weeks after seeding. The scale bars correspond to 500 µm and 100 µm (insets). (B) Live/dead cell staining imaged with light-sheet microscopy on two fixed samples, a medium control (upper panel) and a sample exposed to 5% DMSO for 24 h (lower panel). Live cells are marked with CellTracker Green CMFDA, dead cells with propidium iodide, and nuclei with DAPI. Right panels show merged images of the three fluorescence channels; scale bars correspond to 50 µm. (C) Fixed organoids positively stained for E-cadherin expression (upper panel) vs. negative control with primary antibody omitted (lower panel). Nuclei were stained with DRAQ5 and samples were imaged using multiphoton microscopy. Merged images of both fluorescence channels are shown in the right panel, scale bars correspond to 70 µm and 80 µm in Positive IFA and Negative Control, respectively. IFA, immunofluorescence assay; DMSO, dimethyl sulfoxide.

In addition to analyzing organoid morphology via brightfield microscopy, specific antigens (e.g., markers of different cell populations) can be visualized and analyzed using IFA in association with state-of-the-art microscopy techniques. This includes confocal laser scanning, multiphoton and light-sheet microscopy, which generate high-resolution images and 3D digital reconstructions. Organoids can be stained with histological dyes or labelled antibodies to further investigate their viability or architecture. As example of an organoid viability assay that can be conducted to visualize and count dead and live cells in 3D, Figure 4B shows human bronchial organoids cultured under standard conditions (upper panel) or in presence of 5% DMSO for 24 h as a toxic impact (lower panel). Using two dyes, CellTracker Green CMFDA and propidium iodide, live and dead cells were marked, respectively. Following fixation with 4% paraformaldehyde, the nuclei were stained with DAPI. The organoids under the toxic impact show disrupted structures with several cells having popped out. This negative impact on organoid viability is further supported by the observation that the majority of cells are labelled with the dead cell marker. By contrast, dead cells are almost entirely absent from the medium sample, which instead shows a stronger signal from the live cell marker. Additionally, this sample preserves the spherical shape with intact outer cell layer, which is associated with healthy appearance of human bronchial organoids.

Furthermore, immunofluorescence staining enables a more detailed investigation of the 3D structure, cellular composition and molecular characteristics of organoid samples, which might be of special interest when using them as disease model systems or drug screening platforms. As an example, Figure 4C shows human bronchial lung organoids labelled through indirect immunofluorescence (upper panel) in comparison to an unstained negative control (lower panel). Staining was performed with antibodies against E-cadherin, a marker of epithelial cells. The positive staining signal in this sample is clearly stronger than the background fluorescence observed in the negative control, which derives solely from Matrigel embedding after staining. Supplementary Video S2 represents the Positive IFA sample scanned throughout Z levels.

Importantly, when using technologies other than multiphoton microscopy, an additional clearing step may become required prior to imaging in order to clearly identify positive signals from the inner layers of the organoid 3D structures (29). In the human bronchial organoid model, clearing with an alkaline solution containing a combination of 2,2′-thiodiethanol, DMSO, D-sorbitol, and Tris proved to be the most effective approach (not shown) (30). This step should be conducted at the end of the staining protocol (see Supplementary Protocol 10).

3.4. Metabolic/viability assay using organoid ring cultures

All analytical procedures described above represent endpoint assays requiring the ultimate termination of the organoid cultures. Furthermore, standard procedures of organoid propagation in Matrigel drops prevent the conduct of simple microplate-based screening assays that would be helpful, e.g., for toxicity testing of pharmacological compounds. Here, we provide a methodology that overcomes these limitations by applying the widely used CellTiter-Blue Cell Viability Assay to 3D organoid cultures for endpoint and kinetic analyses. This allows high-throughput analyses of multiple conditions and automated measurements as known from standard cell culture approaches (31). For this methodology, organoids are seeded and grown as ring cultures in 96-well plates (see Supplementary Protocol 12), in which the growth of the organoids over time can also be visualized by microscopy (see Figures 5A,B). Test compounds may be applied to the culture medium at any timepoint of interest and the CellTiter-Blue reagent is added to monitor the metabolic activity/viability of the cultures. For kinetic assays, this procedure may be performed repeatedly.

Figure 5.

Panel A shows a schematic illustration of the laboratory workflow for an organoid metabolic assay. Panel B contains five brightfield microscope images of human bronchial organoids at different time points of culture thus showing, increasing organoid size and numbers over time. Panel C presents a scatter plot comparing fluorescence versus seeding density for two conditions, medium and DMSO, with linear regression curves, coefficients of determination and p values. Panel D displays six brightfield microscope images arranged by seeding density and culture condition, showing organoid morphology in the two treatment groups. Panel E shows a scatter plot of fluorescence versus time, revealing increased fluorescence over time in organoids kept at standard conditions, with linear regression curve, coefficient of determination and p value.

Metabolic activity/cell viability assessed in human bronchial organoid ring cultures as either an endpoint or a kinetic assay. (A) Schematic overview of the method. Split organoid cells were seeded in 96-well plates as a ring and cultured for certain periods of time. To assess metabolic activity, CellTiter-Blue reagent (resazurin) is added to the wells and incubated for four hours during which it is reduced to resorufin by metabolic cell activity. The resulting fluorescence signal is then quantified. (B) Brightfield images demonstrating growth of the organoids seeded as ring cultures over time. (C) Metabolic activity and (D) representative images of organoid cultures seeded at different cell densities and kept for 10 days in culture under standard conditions (Medium) or exposed to 20% DMSO for the last 72 h. Symbols represent two organoid lines, each analyzed in duplicate. (E) Kinetic analysis of the metabolic activity of organoid cultures, starting from the second week after seeding (250 cells/µL Matrigel). Organoid cultures were kept under standard conditions in triplicate. Metabolic activity was analyzed repeatedly over a period of 2 weeks. Lines in (C) and (E) represent linear regression, and coefficients of determination (R2) and p-values are provided. DMSO, dimethyl sulfoxide.

To exemplify an endpoint analysis, two different organoid lines were seeded at three different densities (300, 400, and 500 cells/µL Matrigel) and cultured for 10 days with or without 20% DMSO for the last 72 h before CellTiter-Blue reagent was added and fluorescence measurements were conducted. Expectedly, higher cell densities showed a clear trend to result in higher fluorescence signals which dropped drastically following DMSO treatment (Figure 5C). Microscopic imaging of the Matrigel rings corroborated these results (Figure 5D).

Finally, a kinetic assay was performed analyzing one organoid line in triplicates with a first measurement at 14 days after seeding of 250 cells/µL Matrigel. CellTiter-Blue reagent incubation and fluorescence measurements started at this time point and were repeated twice a week for the next two weeks. Fluorescence signals gradually increased over time due to the continuous growth of the organoid structures with a significant correlation between these parameters (Figure 5E).

4. Discussion

To fulfill its main function, i.e., gas exchange to supply the body with oxygen, the respiratory system is a complex organ composed of a variety of different cell types specialized in taking on specific tasks. Recent investigations using single cell sequencing technologies have shown that, in contrast to the distal alveoli, this is specifically true for the small airways, which are characterized by a high degree of heterogeneity in terms of cell types and their activation states (20, 21). This indicates that cells of the small airways perform a variety of different and specialized functions, altogether aimed at protecting the alveolar region from harmful environmental influences. Therefore, disturbances in this carefully balanced system may result in serious and chronic diseases like bronchial asthma or COPD (32, 33).

Appropriate models that reflect the structural and functional complexity of airway structures are required to analyze the dynamics of epithelial differentiation and activation processes under physiological and pathophysiological conditions in detail. Recent developments in biomedical research have shown that bronchial organoids in combination with state-of-the-art analytical methods are ideally suited to take on this role (4, 6, 34). Therefore, it is advised to develop and apply standardized protocols for generating, perpetuating and characterizing these complex structures. Following this concept, we here provide a set of well-established and practically proven protocols for the handling of bronchial organoids with the idea to enable the scientific community to generate highly comparable and complementary data.

We specifically focused on the generation of somatic cell-derived organoids from lung tissue source material. Such samples can either be obtained through biopsies taken from potential cancer patients—ideally from those where the existence of a tumor could be excluded—or by surgical removal of lung tumors. Tumor-surrounding, unaffected healthy tissue can be used to generate organoids (35); however, a potential impact of the existing comorbidity needs to be considered. On the other hand, these protocols can easily be adopted for primary cells obtained by bronchial brushings, the preparation of which has been described elsewhere (18). Given the higher ratio of epithelial to non-epithelial cells in bronchial brushings, a lower seeding number is sufficient compared to organoid generation from human lung tissue samples (8, 36, 37). This approach improves the feasibility of organoid generation from patients with obstructive airway diseases, such as bronchial asthma, COPD, bronchiolitis or cystic fibrosis, and healthy subjects, thus facilitating the direct investigation of disease-associated perturbations in epithelial differentiation and activation processes.

The protocols presented here are robust but, at the same time, comparatively short, since others often include harvesting solutions that require longer incubation times (38) or coating of the plates with Matrigel followed by an overnight incubation period (39). Further refinement of the initial steps is possible by starting procedures based on the isolation of progenitor basal cells, e.g., by flow cytometry sorting based on CD271/nerve growth factor receptor expression (40, 41).

As the described organoid approach is based on primary source material from human individuals, there is certainly a variability between organoid lines derived from different donors. While reproducibility and efficiency in the general development of organoids from different individuals is quite high (> 90% to our experience), growth and differentiation kinetics may differ. Thus, as for other studies based on primary human cell material, it is advised to perform experiments using at least three biological replicates (i.e., organoid lines from three different donors) to take the interindividual variability into account. Heterogeneity may be even higher when cells derived from patients suffering from airway diseases are used to develop organoids for subsequent mechanistic studies, due to differences in disease phenotype, progression or severity, treatment history, and comorbidities. Accordingly, we recommend conducting such studies based on source material from well-defined patients with similar characteristics regarding the above-mentioned confounding factors.

Like any model system, organoids present advantages and limitations. The absence of other cell types and the continuous regenerative capacity allow the focused investigation of epithelial differentiation processes and regeneration or repair mechanisms over long periods, with the prospect of future personalized medicine applications. However, the absence of additional cell types, such as immune and stromal cells, limits their physiological complexity. ALI cultures also exhibit epithelial differentiation, but, unlike organoids, they have a limited lifespan and exhibit a virtually synchronized aging process due to the gradual loss of progenitor cell activity (42). PCLS, in turn, preserve native lung architecture including vasculature, stromal and immune cells. Further, they may be subjected to mechanical forces mimicking breathing activity. However, their in vitro lifetime is even shorter, with distinct kinetics in viability and activity of different cell types (7, 11).

On the other hand, the complexity of organoid systems may be further enhanced by co-culture with certain types or mixtures of homologous immune cells, fibroblasts or tumor cells (43, 44). These modifications offer the opportunity to study complex cell-cell interactions of the aforementioned cell types with complex epithelial structures outside of a living organism. Moreover, while having the great advantage of generating a human-based complex in vitro system, it should be noted that the protocols provided here can also be used to develop organoids from mouse lungs. This offers the possibility to investigate mechanisms of epithelial differentiation in long-lived structures both from wildtype and genetically modified mice, which paves the way for significantly reducing the number of mice used in in vivo experiments.

Organoids are considered to reflect features of the normal or pathological state of their origin as they may maintain intrinsic gene expression programs during their cultivation for extended time periods, which has recently been demonstrated in intestinal and bronchial organoids (13, 18, 45). Taking this into account, bronchial organoids can be used not only to better understand the underlying pathophysiological mechanisms, but also to analyze and optimize personalized therapy strategies for patients suffering from diverse lung disorders, even beyond the above-mentioned obstructive airway diseases (16, 46, 47). That includes lung tumors, e.g., by testing the potential efficacy of alternative anti-tumor therapies, including immunotherapy approaches at an individualized level in vitro (48). Similarly, organoids generated from subjects suffering from genetically determined diseases may support the development of personalized treatment strategies for these patients. As an example, correction of mutated alleles of monogenic disorders using novel CRISPR/Cas9-mediated approaches has been successfully demonstrated to result in organoids with restored functionality (49). Therefore, somatic cell-derived organoids may specifically serve as an ideal model system for investigating underlying pathophysiological mechanisms of the mentioned diseases and for developing stratified prevention and treatment concepts for such disorders, e.g., as a part of personalized medicine approaches.

Taken together, human bronchial organoids represent a highly advanced structural and functional in vitro model of the human airway epithelium. Due to their very high level of organization and complexity, they reproduce the in vivo situation of human airways much better than most other cell culture technologies, under both healthy and diseased conditions. Hence, when applied in combination with the huge repertoire of available and applicable analytical methods, this sophisticated 3D model can ideally address a multiplicity of different scientific questions.

Acknowledgments

We are grateful to Drs. Helene Widowski and Tim Wolfs (Laboratory of Pediatrics, University of Maastricht, The Netherlands) for their constructive initial practical input as well as Dr. Petra Ina Pfefferle and Thomas Ruppersberg (Comprehensive BioBank Marburg, Germany) and Dr. Bernd Schmeck (Institute for Lung Research, Philipps-University of Marburg, Germany) for providing tissue and cell materials, respectively. We also thank the Genomics and Bioinformatics platform of the Institute for Lung Health of the University Gießen, Germany (Heads Drs. Jochen Wilhelm and Marek Bartkuhn) for sample sequencing and Dr. Isabella Ellinger (Medical University of Vienna, Austria) for support in the establishment of IFA protocols.

Funding Statement

The author(s) declared that financial support was received for this work and/or its publication. This research was funded by the German Federal Institute for Risk Assessment (BfR, grant 60-0102-01#00021 - P586), the German Center for Lung Research (DZL, Disease Area Asthma & Allergy, grant 82DZL005C2), and by the European Union Horizon Europe MSCA DN-ID program (grant 101073263; cordis.europa.eu/project/id/101073263). Open access funding was provided by the Open Access Publishing Fund of the Philipps University of Marburg.

Footnotes

Edited by: Sabine Flicker, Medical University of Vienna, Austria

Reviewed by: Zhaowei Yang, Guangzhou Institute of Respiratory Health, China

Doris Cerecedo, National Polytechnic Institute (IPN), Mexico

Abbreviations 2D, Two-dimensional; 3D, Three-dimensional; ALI, Air-liquid interface; BCAM, Basal cell adhesion molecule; Cas9, CRISPR-associated protein 9; CEACAM5, Carcinoembryonic antigen-related cell adhesion molecule 5; COPD, Chronic obstructive pulmonary disease; CRISPR, Clustered regularly interspaced short palindromic repeats; CXCL8, C-X-C motif chemokine ligand 8; DMSO, Dimethyl sulfoxide; FOXJ1, Forkhead box J1; HBECs, Human bronchial epithelial cells; IFA, Immunofluorescence assay; IL1B, Interleukin 1 beta; iPSCs, Induced pluripotent stem cells; ITGA6, Integrin subunit alpha 6; KRT5, Keratin 5; MUC5AC, Mucin 5AC; PCLS, Precision cut lung slices; PGK1, Phosphoglycerate kinase 1; Poly(I:C), Polyinosinic:polycytidylic acid; RPLP0, Ribosomal protein lateral stalk subunit P0; RT-qPCR, Reverse transcription quantitative polymerase chain reaction; SCGB1A1, Secretoglobin family 1A member 1; scRNA-seq, Single cell RNA sequencing; TNF, Tumor necrosis factor; TUBA1B, Tubulin alpha 1b; UMAP, Uniform Manifold Approximation and Projection; WTA, Whole Transcriptome Analysis.

Data availability statement

The single cell sequencing data for this study have been deposited in the European Nucleotide Archive (ENA) at EMBL-EBI under accession number PRJEB112513 (https://www.ebi.ac.uk/ena/browser/view/PRJEB112513). All other original data are available on reasonable request from the corresponding author.

Ethics statement

The studies involving humans were approved by Die Ethikkommission des Fachbereichs Medizin der Philipps-Universität Marburg. The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study.

Author contributions

LK: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Validation, Visualization, Writing – original draft, Writing – review & editing. AC: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Validation, Visualization, Writing – original draft, Writing – review & editing. NL: Investigation, Methodology, Resources, Validation, Writing – review & editing. SM: Conceptualization, Funding acquisition, Investigation, Methodology, Project administration, Supervision, Visualization, Writing – original draft, Writing – review & editing. KP: Data curation, Formal analysis, Investigation, Methodology, Software, Visualization, Writing – original draft, Writing – review & editing. KR: Investigation, Methodology, Resources, Writing – review & editing. ND: Investigation, Methodology, Validation, Writing – review & editing. PG: Investigation, Methodology, Validation, Writing – review & editing. EM: Investigation, Methodology, Validation, Writing – review & editing. EH: Investigation, Methodology, Validation, Writing – review & editing. AM: Investigation, Methodology, Validation, Writing – review & editing. AB: Investigation, Methodology, Validation, Writing – review & editing. MB: Investigation, Methodology, Validation, Writing – review & editing. JHP: Formal analysis, Investigation, Methodology, Validation, Software, Writing – review & editing. PD: Formal analysis, Investigation, Methodology, Software, Writing – review & editing. DPP: Project administration, Resources, Supervision, Validation, Writing – original draft, Writing – review & editing. ASS: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing. HG: Conceptualization, Data curation, Formal analysis, Methodology, Funding acquisition, Project administration, Resources, Supervision, Writing – original draft, Writing – review & editing.

Conflict of interest

The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

The authors DPP and HG declared that they were an editorial board member of Frontiers, at the time of submission. This had no impact on the peer review process and the final decision.

Generative AI statement

The author(s) declared that generative AI was not used in the creation of this manuscript.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher's note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary Material for this article including detailed experimental protocols can be found online at: https://www.frontiersin.org/articles/10.3389/falgy.2026.1811482/full#supplementary-material

Supplementary Video S1

Cilia movement within a human bronchial organoid.

Download video file (9.3MB, mp4)
Supplementary Video S2

Z stacks movie through the Positive IFA sample shown in Figure 4.

Download video file (4.2MB, mp4)
Datasheet1.pdf (510.4KB, pdf)

References

  • 1.Lancaster MA, Knoblich JA. Organogenesis in a dish: modeling development and disease using organoid technologies. Science. (2014) 345(6194):1247125. 10.1126/science.1247125 [DOI] [PubMed] [Google Scholar]
  • 2.van der Vaart J, Lamers MM, Haagmans BL, Clevers H. Advancing lung organoids for COVID-19 research. Dis Model Mech. (2021) 14(6):dmm049060. 10.1242/dmm.049060 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Clevers H. Modeling development and disease with organoids. Cell. (2016) 165:1586–97. 10.1016/j.cell.2016.05.082 [DOI] [PubMed] [Google Scholar]
  • 4.Wang Q, Tan S, Fu X, He J, Ma Q, You F, et al. Advancing lung organoids toward clinical applications: a global perspective on research focus and future directions. Front Med (Lausanne). (2025) 12:1611304. 10.3389/fmed.2025.1611304 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Kang M, Kim J-Y, Kwon CW, Kim WJ, Hong S-H. Recent applications of lung organoid and lung-on-a-chip technologies for evaluating the toxicity of fine particulate matter. Int J Stem Cells. (2025) 18:357–67. 10.15283/ijsc25036 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Wang Q, Guo F, Jin Y, Ma Y. Applications of human organoids in the personalized treatment for digestive diseases. Signal Transduct Target Ther. (2022) 7:336. 10.1038/s41392-022-01194-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Kühl L, Graichen P, von Daacke N, Mende A, Wygrecka M, Potaczek DP, et al. Human lung organoids-A novel experimental and precision medicine approach. Cells. (2023) 12(16):2067. 10.3390/cells12162067 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Bukowy-Bieryłło Z. Long-term differentiating primary human airway epithelial cell cultures: how far are we? Cell Commun Signal. (2021) 19:63. 10.1186/s12964-021-00740-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Chen S, Schoen J. Air-liquid interface cell culture: from airway epithelium to the female reproductive tract. Reprod Domest Anim. (2019) 54:38–45. 10.1111/rda.13481 [DOI] [PubMed] [Google Scholar]
  • 10.Konar D, Devarasetty M, Yildiz DV, Atala A, Murphy SV. Lung-On-A-Chip technologies for disease modeling and drug development. Biomed Eng Comput Biol. (2016) 7(Suppl 1):17–27. 10.4137/BECB.S34252 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Liu Y, Wu P, Wang Y, Liu Y, Yang H, Zhou G, et al. Application of precision-cut lung slices as an in vitro model for research of inflammatory respiratory diseases. Bioengineering. (2022) 9:767. 10.3390/bioengineering9120767 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Coraux C, Hajj R, Lesimple P, Puchelle E. In vivo models of human airway epithelium repair and regeneration. Eur Respir Rev. (2005) 14:131–6. 10.1183/09059180.05.00009702 [DOI] [Google Scholar]
  • 13.Sachs N, Papaspyropoulos A, Zomer-van Ommen DD, Heo I, Böttinger L, Klay D, et al. Long-term expanding human airway organoids for disease modeling. EMBO J. (2019) 38(4):e100300. 10.15252/embj.2018100300 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Ekanger CT, Zhou F, Bohan D, Lotsberg ML, Ramnefjell M, Hoareau L, et al. Human organotypic airway and lung organoid cells of bronchiolar and alveolar differentiation are permissive to infection by influenza and SARS-CoV-2 respiratory virus. Front Cell Infect Microbiol. (2022) 12:841447. 10.3389/fcimb.2022.841447 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Vazquez-Armendariz AI, Tata PR. Recent advances in lung organoid development and applications in disease modeling. J Clin Invest. (2023) 133(22):e170500. 10.1172/JCI170500 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Jiang S-P, Lin B-Q, Zhou X-Q, Li M-H, Feng Z-C, Qin Y-Y, et al. Airway organoid models as pivotal tools for unraveling molecular mechanisms and therapeutic targets in respiratory diseases: a literature review. Ther Clin Risk Manag. (2025) 21:975–86. 10.2147/TCRM.S526727 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Barkauskas CE, Chung M-I, Fioret B, Gao X, Katsura H, Hogan BLM. Lung organoids: current uses and future promise. Development. (2017) 144:986–97. 10.1242/dev.140103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Chan LLY, Anderson DE, Cheng HS, Ivan FX, Chen S, Kang AEZ, et al. The establishment of COPD organoids to study host-pathogen interaction reveals enhanced viral fitness of SARS-CoV-2 in bronchi. Nat Commun. (2022) 13:7635. 10.1038/s41467-022-35253-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Huch M, Gehart H, van Boxtel R, Hamer K, Blokzijl F, Verstegen MMA, et al. Long-Term culture of genome-stable bipotent stem cells from adult human liver. Cell. (2015) 160:299–312. 10.1016/j.cell.2014.11.050 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Vieira Braga FA, Kar G, Berg M, Carpaij OA, Polanski K, Simon LM, et al. A cellular census of human lungs identifies novel cell states in health and in asthma. Nat Med. (2019) 25:1153–63. 10.1038/s41591-019-0468-5 [DOI] [PubMed] [Google Scholar]
  • 21.Travaglini KJ, Nabhan AN, Penland L, Sinha R, Gillich A, Sit RV, et al. A molecular cell atlas of the human lung from single-cell RNA sequencing. Nature. (2020) 587:619–25. 10.1038/s41586-020-2922-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Chacón-Martínez CA, Koester J, Wickström SA. Signaling in the stem cell niche: regulating cell fate, function and plasticity. Development. (2018) 145(15):dev165399. 10.1242/dev.165399 [DOI] [PubMed] [Google Scholar]
  • 23.Tsao P-N, Vasconcelos M, Izvolsky KI, Qian J, Lu J, Cardoso WV. Notch signaling controls the balance of ciliated and secretory cell fates in developing airways. Development. (2009) 136:2297–307. 10.1242/dev.034884 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Lee W, Lee S, Yoon J-K, Lee D, Kim Y, Han YB, et al. A single-cell atlas of in vitro multiculture systems uncovers the in vivo lineage trajectory and cell state in the human lung. Exp Mol Med. (2023) 55:1831–42. 10.1038/s12276-023-01076-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kim J, Eo E-Y, Kim B, Lee H, Kim J, Koo B-K, et al. Transcriptomic analysis of air–liquid interface culture in human lung organoids reveals regulators of epithelial differentiation. Cells. (2024) 13:1991. 10.3390/cells13231991 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Wang X, Hallen NR, Lee M, Samuchiwal S, Ye Q, Buchheit KM, et al. Type 2 inflammation drives an airway basal stem cell program through insulin receptor substrate signaling. J Allergy Clin Immunol. (2023) 151:1536–49. 10.1016/j.jaci.2023.01.030 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Bonser LR, Koh KD, Johansson K, Choksi SP, Cheng D, Liu L, et al. Flow-Cytometric analysis and purification of airway epithelial-cell subsets. Am J Respir Cell Mol Biol. (2021) 64:308–17. 10.1165/rcmb.2020-0149MA [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Ritter M, Mennerich D, Weith A, Seither P. Characterization of toll-like receptors in primary lung epithelial cells: strong impact of the TLR3 ligand poly(I:c) on the regulation of toll-like receptors, adaptor proteins and inflammatory response. J Inflamm. (2005) 2:16. 10.1186/1476-9255-2-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Susaki EA, Takasato M. Perspective: extending the utility of three-dimensional organoids by tissue clearing technologies. Front Cell Dev Biol. (2021) 9:679226. 10.3389/fcell.2021.679226 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Shan Q-H, Qin X-Y, Zhou N, Huang C, Wang Y, Chen P, et al. A method for ultrafast tissue clearing that preserves fluorescence for multimodal and longitudinal brain imaging. BMC Biol. (2022) 20:77. 10.1186/s12915-022-01275-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Phan N, Hong JJ, Tofig B, Mapua M, Elashoff D, Moatamed NA, et al. A simple high-throughput approach identifies actionable drug sensitivities in patient-derived tumor organoids. Commun Biol. (2019) 2:78. 10.1038/s42003-019-0305-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Raby KL, Michaeloudes C, Tonkin J, Chung KF, Bhavsar PK. Mechanisms of airway epithelial injury and abnormal repair in asthma and COPD. Front Immunol. (2023) 14:1201658. 10.3389/fimmu.2023.1201658 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Carlier FM, de Fays C, Pilette C. Epithelial barrier dysfunction in chronic respiratory diseases. Front Physiol. (2021) 12:691227. 10.3389/fphys.2021.691227 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Hysenaj L, Little S, Kulhanek K, Magnen M, Bahl K, Gbenedio OM, et al. SARS-CoV-2 infection of airway organoids reveals conserved use of tetraspanin-8 by ancestral, Delta, and omicron variants. Stem Cell Rep. (2023) 18:636–53. 10.1016/j.stemcr.2023.01.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Kim M, Mun H, Sung CO, Cho EJ, Jeon H-J, Chun S-M, et al. Patient-derived lung cancer organoids as in vitro cancer models for therapeutic screening. Nat Commun. (2019) 10:3991. 10.1038/s41467-019-11867-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Lane C, Burgess S, Kicic A, Knight D, Stick S. The use of non-bronchoscopic brushings to study the paediatric airway. Respir Res. (2005) 6:53. 10.1186/1465-9921-6-53 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Schögler A, Blank F, Brügger M, Beyeler S, Tschanz SA, Regamey N, et al. Characterization of pediatric cystic fibrosis airway epithelial cell cultures at the air-liquid interface obtained by non-invasive nasal cytology brush sampling. Respir Res. (2017) 18:215. 10.1186/s12931-017-0706-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Dekkers JF, Alieva M, Wellens LM, Ariese HCR, Jamieson PR, Vonk AM, et al. High-resolution 3D imaging of fixed and cleared organoids. Nat Protoc. (2019) 14:1756–71. 10.1038/s41596-019-0160-8 [DOI] [PubMed] [Google Scholar]
  • 39.Leibel SL, McVicar RN, Winquist AM, Niles WD, Snyder EY. Generation of complete multi−cell type lung organoids from human embryonic and patient-specific induced pluripotent stem cells for infectious disease modeling and therapeutics validation. Curr Protoc Stem Cell Biol. (2020) 54(1):e118. 10.1002/cpsc.118 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Konda B, Mulay A, Yao C, Beil S, Israely E, Stripp BR. Isolation and enrichment of human lung epithelial progenitor cells for organoid culture. J Vis Exp. (2020):(161). 10.3791/61541 [DOI] [PubMed] [Google Scholar]
  • 41.Demchenko A, Belova L, Balyasin M, Kochergin-Nikitsky K, Kondrateva E, Voronina E, et al. Airway basal cells from human-induced pluripotent stem cells: a new frontier in cystic fibrosis research. Front Cell Dev Biol. (2024) 12:1336392. 10.3389/fcell.2024.1336392 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Silva S, Bicker J, Falcão A, Fortuna A. Air-liquid interface (ALI) impact on different respiratory cell cultures. Eur J Pharm Biopharm. (2023) 184:62–82. 10.1016/j.ejpb.2023.01.013 [DOI] [PubMed] [Google Scholar]
  • 43.Cattaneo CM, Dijkstra KK, Fanchi LF, Kelderman S, Kaing S, van Rooij N, et al. Tumor organoid–T-cell coculture systems. Nat Protoc. (2020) 15:15–39. 10.1038/s41596-019-0232-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Liu J, Li P, Wang L, Li M, Ge Z, Noordam L, et al. Cancer-Associated fibroblasts provide a stromal niche for liver cancer organoids that confers trophic effects and therapy resistance. Cell Mol Gastroenterol Hepatol. (2021) 11:407–31. 10.1016/j.jcmgh.2020.09.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Middendorp S, Schneeberger K, Wiegerinck CL, Mokry M, Akkerman RDL, Wijngaarden S, et al. Adult stem cells in the small intestine are intrinsically programmed with their location-specific function. Stem Cells. (2014) 32:1083–91. 10.1002/stem.1655 [DOI] [PubMed] [Google Scholar]
  • 46.Tindle C, Fuller M, Fonseca A, Taheri S, Ibeawuchi S-R, Beutler N, et al. Adult stem cell-derived complete lung organoid models emulate lung disease in COVID-19. Elife. (2021) 10:e66417. 10.7554/eLife.66417 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Soto-Gamez A, Gunawan JP, Barazzuol L, Pringle S, Coppes RP. Organoid-based personalized medicine: from tumor outcome prediction to autologous transplantation. Stem Cells. (2024) 42:499–508. 10.1093/stmcls/sxae023 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Drost J, Clevers H. Translational applications of adult stem cell-derived organoids. Development. (2017) 144:968–75. 10.1242/dev.140566 [DOI] [PubMed] [Google Scholar]
  • 49.Schwank G, Koo B-K, Sasselli V, Dekkers JF, Heo I, Demircan T, et al. Functional repair of CFTR by CRISPR/Cas9 in intestinal stem cell organoids of cystic fibrosis patients. Cell Stem Cell. (2013) 13:653–8. 10.1016/j.stem.2013.11.002 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Video S1

Cilia movement within a human bronchial organoid.

Download video file (9.3MB, mp4)
Supplementary Video S2

Z stacks movie through the Positive IFA sample shown in Figure 4.

Download video file (4.2MB, mp4)
Datasheet1.pdf (510.4KB, pdf)

Data Availability Statement

The single cell sequencing data for this study have been deposited in the European Nucleotide Archive (ENA) at EMBL-EBI under accession number PRJEB112513 (https://www.ebi.ac.uk/ena/browser/view/PRJEB112513). All other original data are available on reasonable request from the corresponding author.


Articles from Frontiers in Allergy are provided here courtesy of Frontiers Media SA

RESOURCES