Molecular insights into small RNA–mediated regulation of biofilm formation and multidrug resistance in Pseudomonas aeruginosa under zinc oxide nanoparticle exposure

Abstract

Background

Pseudomonas aeruginosa is an opportunistic pathogen with marked biofilm-forming capacity and increasing multidrug resistance, prompting the need for alternative antimicrobials. Zinc oxide (ZnO) nanomaterials exhibit antibacterial potential; however, their effects on small RNA-mediated regulation remain unclear.

Objective

To assess the antimicrobial and antibiofilm activities of biosynthesized ZnO and determine its effects at subinhibitory concentrations on selected small regulatory RNAs and biofilm-associated genes in clinical P. aeruginosa isolates.

Materials and methods

Fifty clinical isolates were identified and tested for antibiotic susceptibility and biofilm formation. The biosynthesized ZnO was characterized using UV–Vis, FTIR, EDX, FE-SEM, and AFM. The MIC and antibiofilm activity were evaluated using resazurin, broth microdilution, agar diffusion, and crystal violet assays. Three multidrug-resistant isolates underwent PCR and RT-qPCR analyses of ErsA, SrbA, amrZ, and algD after exposure to 12,500 and 25,000 μg/mL ZnO.

Results

Among biofilm-forming isolates, 55% were strong, 33% moderate, and 11% weak producers; 88.8% of multidrug-resistant isolates showed strong or moderate biofilm formation. The ZnO nanoparticles had a mean diameter of 40.75 nm and MIC of 50,000 μg/mL. Significant biofilm inhibition occurred at 25,000 μg/mL (p = 0.039) and 50,000 μg/mL (p = 0.01) concentrations. The inhibition zones at 50,000 μg/mL were 16 ± 1.2 mm, 15 ± 1.0 mm, and 17 ± 1.1 mm for urine, burn, and wound isolates, respectively. Gene expression analysis revealed source-dependent transcriptional responses: urine isolates showed marked upregulation of SrbA (58.89-fold) and algD (43.71-fold), indicating pre-adaptation to environmental stressors, while wound isolates exhibited predominantly downregulation of biofilm-associated genes. Burn isolates displayed a biphasic response, with stress pathway activation at 1/4 MIC but gene suppression at 1/2 MIC.

Conclusion

Biosynthesized ZnO exerts concentration-dependent antibacterial and antibiofilm effects against clinical P. aeruginosa while differentially modulating sRNA-linked regulatory networks under sub-MIC exposure. The key findings demonstrate that ZnO nanoparticles effectively inhibit biofilm formation at concentrations ≥25,000 μg/mL, while sub-inhibitory exposure triggers source-specific adaptive transcriptional responses mediated through sRNA regulatory circuits. These findings conclusively support the potential of biosynthesized ZnO nanoparticles as adjunctive antimicrobial agents against MDR P. aeruginosa biofilms, with the critical caveat that therapeutic concentrations must be maintained above the MIC to prevent adaptive resistance enhancement through sRNA-mediated stress responses.

1. Introduction

Pseudomonas aeruginosa is a heterotrophic, gram-negative, non-fermentative, rod-shaped bacterium measuring approximately 1–5 μm in length and 0.5–1.0 μm in width. It is an opportunistic pathogen that is widely distributed in both environmental and clinical settings and can cause severe infections, particularly in immunocompromised individuals.¹ A significant factor that contributes to its persistence and pathogenicity is its capacity to form a biofilm. Biofilms serve to shield microbial cells from host defenses and restrict antibiotic penetration due to the existence of an extracellular matrix² Within this matrix, P. aeruginosa can survive under adverse conditions and exhibit markedly increased tolerance to antimicrobial agents. The biofilm matrix of P. aeruginosa is composed of bacterial cells, extracellular DNA (eDNA),³ proteins, rhamnolipids involved in surface motility and biofilm development,⁴ and extracellular polysaccharides, including PSL, PEL, and alginate.⁵

Biofilm formation in Pseudomonas aeruginosa is a highly coordinated process controlled by complex genetic regulatory networks, including transcriptional regulators and small regulatory RNAs (sRNAs), which modulate gene expression at the post-transcriptional level.6, 7 Key regulatory genes, such as amrZ and algD play essential roles in biofilm development and alginate biosynthesis, thereby contributing to the structural integrity and persistence of the biofilm matrix.8, 9 In addition, stress-responsive regulators, including ErsA and SrbA, enhance bacterial adaptation and survival under unfavorable conditions. Notably, ErsA has been shown to promote biofilm formation through post-transcriptional regulation of amrZ and to function as a trans-encoded sRNA under the control of the envelope stress response pathway.10, 11, 12 As a global transcriptional regulator, amrZ controls multiple pathways associated with biofilm formation, motility, and virulence in P. aeruginosa.¹³ Collectively, these regulatory systems underscore the complexity of biofilm formation and help explain the difficulty in therapeutically targeting biofilm-associated infections.

Nanomaterials have emerged as transformative agents across diverse biomedical and environmental applications owing to their unique physicochemical properties, including high surface area-to-volume ratio, tunable surface chemistry, and quantum confinement effects.¹⁴ In the biomedical domain, nanoparticles have demonstrated remarkable potential in drug delivery, antimicrobial therapy, cancer nanotherapy, and diagnostic imaging.15, 16 Metal oxide nanoparticles, particularly zinc oxide (ZnO), titanium dioxide (TiO₂), and iron oxide nanoparticles, have attracted considerable attention for their multifunctional capabilities encompassing antibacterial, antifungal, anticancer, and photocatalytic activities.17, 18 Green synthesis approaches utilizing biological sources such as plant extracts, microbial metabolites, and biopolymers have gained prominence as sustainable and eco-friendly alternatives to conventional chemical synthesis methods, yielding nanoparticles with enhanced biocompatibility and reduced cytotoxicity.19, 20 Furthermore, nanocomposite formulations incorporating polymeric matrices such as chitosan, polyethylene glycol (PEG), and starch have demonstrated superior pharmacotherapeutic activities, including anti-quorum sensing effects against pathogenic microorganisms and enhanced bioavailability for therapeutic applications.21, 22, 23

Simultaneously, the global rise in antibiotic-resistant infections has intensified the need for alternative, non-antibiotic strategies capable of overcoming biofilm-associated resistance.²⁴ Among these, nanotechnology-based approaches, particularly the use of nanoparticles (NPs), have emerged as promising alternatives due to their elevated surface area-to-volume ratio and distinctive physicochemical characteristics, which can improve antimicrobial efficacy.25, 26 Zinc oxide nanoparticles (ZnO NPs) have attracted particular attention because of their antibacterial and antibiofilm effects, attributed to mechanisms including reactive oxygen species (ROS) generation, membrane disruption, and interference with intracellular signaling pathways.61, 62 Recent studies have further demonstrated the efficacy of biogenic ZnO nanoparticles synthesized from various biological sources against multidrug-resistant pathogens, highlighting their potential as sustainable antimicrobial alternatives.27, 28

Despite these advances, an important knowledge gap remains regarding the molecular mechanisms by which ZnO NPs influence biofilm-associated regulation in P. aeruginosa, particularly at the level of post-transcriptional control by sRNAs and key regulatory genes. Most previous studies have focused on phenotypic outcomes, such as bacterial growth inhibition and biofilm reduction, with limited investigation of how ZnO NPs affect the regulators involved in biofilm formation, stress adaptation, and pathogenicity.²⁹ We hypothesize that sub-inhibitory concentrations of biosynthesized ZnO nanoparticles differentially modulate the expression of small regulatory RNAs (ErsA and SrbA) and their downstream target genes (amrZ and algD) in clinical P. aeruginosa isolates, with the magnitude and direction of transcriptional responses being dependent on the ecological origin of the isolate and the nanoparticle concentration applied. Zinc oxide was specifically selected as the nanoparticle material for this study due to its well-documented broad-spectrum antimicrobial activity, FDA-recognized safety profile (Generally Recognized as Safe, GRAS status), cost-effectiveness, and demonstrated capacity to generate reactive oxygen species that disrupt bacterial membranes and intracellular processes. Compared to other metal oxide nanoparticles such as TiO₂, CuO, or Ag NPs, ZnO offers a favorable balance between antimicrobial potency and biocompatibility, making it particularly suitable for potential therapeutic applications.30, 31 The novelty of this study lies in the first systematic investigation of how biosynthesized ZnO nanoparticles affect sRNA-mediated post-transcriptional regulatory networks in P. aeruginosa, providing mechanistic insights beyond the conventional phenotypic assessments that dominate the current literature.

Therefore, the present study aimed to evaluate the antibacterial and antibiofilm effects of biosynthesized ZnO NPs on clinical MDR of P. aeruginosa isolates and to investigate their impact on the expression of selected regulatory RNAs and biofilm-associated genes, including ErsA, SrbA, amrZ, and algD before and after exposure to ZnO NPs, to provide molecular insight into their potential as alternative therapeutic agents.

2. Materials and methods

2.1. Chemicals and reagents

All chemicals and reagents used in this study were of analytical grade. Zinc chloride (ZnCl₂, ≥98% purity) was purchased from Sigma-Aldrich (St. Louis, MO, USA). Mueller-Hinton broth (MHB), Mueller-Hinton agar (MHA), Tryptic Soy Broth (TSB), nutrient broth, cetrimide agar, and MacConkey agar were obtained from HiMedia Laboratories (Mumbai, India). Crystal violet (0.1%), methanol (≥99.8%), glacial acetic acid (33%), absolute ethanol, and resazurin sodium salt were procured from Merck (Darmstadt, Germany). Phosphate-buffered saline (PBS, pH 7.4) was prepared in-house using standard protocols. The EasyPure® Bacteria Genomic DNA Kit was obtained from TransGen Biotech (Beijing, China). The TRIzol™ Plus RNA Purification Kit was purchased from Invitrogen (Carlsbad, CA, USA). The ProtoScript® First-Strand cDNA Synthesis Kit and Luna® Universal qPCR Master Mix were obtained from New England Biolabs (Ipswich, MA, USA). All primers were synthesized by Integrated DNA Technologies (Coralville, IA, USA). Deionized water (18.2 MΩ·cm) was used throughout the experiments.

2.2. Sample collection and identification

From October 2024 to January 2025, 150 clinical specimens were collected from patients with suspected bacterial infections at teaching hospitals in Baghdad, Iraq. Specimens were obtained from various clinical sources, including wound swabs (n = 55), burn exudates (n = 45), and midstream urine samples (n = 50), following standard clinical protocols.

Following initial isolation on appropriate culture media, 50 isolates were presumptively identified as Pseudomonas aeruginosa based on standard microbiological and biochemical characterization. These tests included Gram staining (revealing Gram-negative rods), oxidase and catalase production, indole negativity, citrate utilization, and the inability to ferment lactose on MacConkey agar plates. Furthermore, the isolates demonstrated characteristic growth on cetrimide agar, producing typical greenish pigments (pyocyanin) and a characteristic fruity odor. The ability to grow at 42 °C was also assessed. Final confirmation of the P. aeruginosa isolates was achieved using the VITEK 2 Compact automated system (bioMérieux, France). The selection criteria for the 50 clinical isolates included: (i) confirmed identification as P. aeruginosa by VITEK 2, (ii) isolation from clinically significant infections (not colonization), (iii) representation of diverse clinical sources (urine, burn, and wound), and (iv) collection during the defined study period.

2.3. Antibiotic susceptibility testing and MIC determination

The antimicrobial susceptibility of P. aeruginosa isolates was evaluated using the VITEK 2 Compact system with gram-negative susceptibility cards. The minimum inhibitory concentrations (MIC) were determined using broth microdilution in accordance with CLSI recommendations (M100-S25).³² Antimicrobial susceptibility testing was performed and interpreted according to the Clinical and Laboratory Standards Institute (CLSI) guidelines (M100, 33rd Edition, 2024). Multidrug resistance (MDR) was defined as non-susceptibility to at least one agent in three or more antimicrobial categories, consistent with the international expert consensus definition proposed by Magiorakos et al. (2012). Escherichia coli ATCC 25922 and Pseudomonas aeruginosa ATCC 27853 functioned as quality control strains.

2.4. Phenotypic detection of biofilm formation

Biofilm-forming capacity was quantified using a static microtiter plate assay as previously described.³³ Optical density was measured at 630 nm using an ELISA reader. Isolates were classified as strong, moderate, weak, or non-producers based on OD cutoff values relative to negative controls. All assays were performed in triplicate.

2.5. Biosynthesis of ZnO NPs

ZnO nanoparticles were synthesized via biological reduction using a clinical Staphylococcus aureus isolate, following the protocol of³⁴ with minor modifications. The S. aureus isolate used for biosynthesis was obtained from the institutional microbial culture collection and was identified and authenticated using standard biochemical tests (catalase-positive, coagulase-positive, mannitol salt agar fermentation) and confirmed by VITEK 2 automated identification system (bioMérieux, France). The rationale for selecting S. aureus as the biological source was based on its well-documented capacity to produce extracellular enzymes and metabolites (including NADH-dependent reductases and proteins) that serve as effective reducing and capping agents during nanoparticle biosynthesis, as previously demonstrated.³⁴ A culture of S. aureus was grown in 100 mL nutrient broth at 37 °C for 24 h with orbital shaking (150 rpm). Following centrifugation (10,000 rpm, 10 min, 4 °C), the cell-free supernatant was collected. The synthesis was performed under the following optimized conditions: zinc chloride (ZnCl₂) solution at a precursor concentration of 0.1 M was added dropwise to the cell-free supernatant under magnetic stirring at a temperature of 60–80 °C, pH adjusted to 7.5–8.0 using 1 M NaOH, with a total reaction time of 2 h. The reaction yielded a white precipitate. The suspension was centrifuged (8000 rpm, 15 min), and the pellet was washed three times with deionized water and twice with absolute ethanol to remove residual precursor and organic matter. The product was dried at 60 °C for 1 h, ground to a fine powder using a mortar and pestle, and stored in an airtight container until characterization and biological assays. To ensure reproducibility across different batches, the synthesis was performed in triplicate under identical conditions, and the resulting nanoparticles were characterized by UV–Vis spectroscopy to confirm consistent absorption peaks. Batch-to-batch variation in particle size was assessed by FE-SEM analysis, with acceptable variation defined as ≤10% coefficient of variation in mean particle diameter.

2.6. Characterization of ZnO NPs

The biosynthesized ZnO NPs were subjected to comprehensive physicochemical characterization to determine their optical, structural, and morphological properties. UV–Vis spectrophotometry (300–800 nm range) was employed to confirm nanoparticle formation through identification of the characteristic surface plasmon resonance peak. FTIR spectroscopy (4000–400 cm⁻¹) was utilized to identify functional groups and biomolecules responsible for reduction and capping of the nanoparticles. EDX spectroscopy confirmed elemental composition and purity of the synthesized nanoparticles. AFM provided surface topography and three-dimensional structural details, while FE-SEM enabled precise determination of particle size and morphological features. These complementary techniques were selected to provide a comprehensive characterization covering optical properties (UV–Vis), chemical bonding (FTIR), elemental composition (EDX), surface morphology (FE-SEM), and nanoscale topography (AFM).35, 36, 37, 38 The average particle size was calculated from FE-SEM micrographs by measuring the diameter of 50 individual nanoparticles using ImageJ software (NIH, USA), and the results were expressed as mean ± standard deviation.

2.7. Determination of MIC of ZnO NPs

In this paper, three different methods are used for determining the MIC of ZnO NPs. The first method is by using resazurin dye,³⁹ in a microtiter plate by preparing different concentrations of ZnO NPs, which are dissolved (0.5, 0.25, 0.125, 0.625, 0.321, and 0.156 mg) of the biosynthesis powder in 10 ml deionized water. These concentrations are loaded in wells that contain broth and bacteria and incubated at 37 °C for 24 h. After incubation, add resazurin dye in a concentration of 0.01% and incubate in dark conditions for 2–4 h. The positive control contained broth and bacteria, while the negative control contained sterile Mueller-Hinton broth without bacterial inoculation. An additional growth control (bacteria without ZnO NPs) and a sterility control (broth only) were included in each plate. A color change from blue to pink indicated viable bacterial growth. The second method employed broth microdilution following CLSI document M100-S25 guidelines, using the same concentration range but assessing visible turbidity and subculturing onto cetrimide agar plates for confirmation. Finally, agar well diffusion was used to evaluate the antimicrobial activity of three concentrations of ZnO NPs (50,000, 25,000, and 12,500 μg/mL) against P. aeruginosa growth.40, 41

2.8. Anti-biofilm activity of ZnO NPs

The inhibitory effect of ZnO NPs on biofilm formation by P. aeruginosa was evaluated using a modified crystal violet assay in 96-well microtiter plates.⁴² Serial dilutions of ZnO NPs (ranging from 50,000 to 156 μg/mL) were prepared in TSB supplemented with 1% glucose to promote biofilm formation. Each well was inoculated with a standardized bacterial suspension (1 × 10^⁶ CFU/ml) Incubated at 37 °C for 24 h under static conditions. Positive controls consisted of bacterial cultures grown without ZnO NP treatment under identical conditions, while negative controls contained sterile TSB medium with 1% glucose without bacterial inoculation. Following incubation, planktonic cells were removed, and the wells were rinsed three times with sterile PBS. The adherent biofilms were fixed with methanol, stained with 0.01% crystal violet for 15 min, and subsequently destained using 33% glacial acetic acid. Optical density was measured at 570 nm using an ELISA reader. The percentage of biofilm inhibition was calculated relative to that of the untreated positive control wells.

2.9. Molecular detection and gene expression analysis

Genomic DNA was isolated from overnight cultures of multidrug-resistant P. aeruginosa using the EasyPure® Bacteria Genomic DNA Kit (TransGen Biotech, China) per manufacturer's protocol. Bacterial cells were pelleted by centrifugation (10,000 ×g, 1 min), resuspended in lysis buffer containing lysozyme and proteinase K, and incubated at 55 °C for 30 min. DNA was purified using spin columns and quantified spectrophotometrically (NanoDrop 2000, Thermo Fisher Scientific, USA). Samples with A260/A280 ratios of 1.8–2.0 were stored at −20 °C.⁴³

Target genes involved in biofilm formation and stress adaptation (ErsA, SrbA, amrZ, algD) and the 16S rRNA reference gene were selected. The rationale for selecting these specific targets was as follows: ErsA and SrbA are small regulatory RNAs (sRNAs) that function as key post-transcriptional regulators of biofilm formation and stress adaptation in P. aeruginosa; amrZ encodes a global transcriptional regulator controlling biofilm development, motility, and virulence; and algD encodes GDP-mannose dehydrogenase, a rate-limiting enzyme in alginate biosynthesis that directly contributes to biofilm matrix production. Together, these genes represent critical nodes in the regulatory network governing biofilm formation and provide mechanistic insight into how ZnO nanoparticles affect post-transcriptional regulation. Reference sequences were obtained from NCBI GenBank. Primers were designed using Geneious Prime (v2021.2.2; Biomatters Ltd., New Zealand) with the following specifications: 18–25 bp length, 53–59 °C melting temperature, 40–60% GC content, and 100–200 bp amplicon size. Primer specificity was validated in silico using NCBI Primer-BLAST and OligoAnalyzer (Integrated DNA, USA).⁴⁴

Three multidrug-resistant P. aeruginosa isolates were selected for PCR and RT-qPCR analyses based on the following criteria: (i) confirmed MDR phenotype (resistance to ≥3 antimicrobial categories), (ii) strong biofilm-forming capacity as determined by crystal violet assay, and (iii) representation of each clinical source (one isolate each from urine, burn, and wound specimens) to enable comparative analysis of source-dependent transcriptional responses. This selection strategy was designed to maximize the diversity of ecological backgrounds while maintaining the feasibility of detailed molecular characterization.

2.9.1. Conventional PCR for gene detection

PCR amplification was conducted in 25 μL reactions including 12.5 μL of 2× PCR Master Mix, 1 μL each of forward and reverse primers (10 μM), 3 μL of template DNA (∼50 ng), and 7.5 μL of nuclease-free water. Amplification was performed according to the following protocol: initial denaturation at 95 °C for 5 min; 30 cycles of 95 °C for 30 s, primer-specific annealing at 53–59 °C (Table 1) for 45 s, and 72 °C for 45 s; concluding with a final extension at 72 °C for 7 min. PCR products were resolved on a 2% agarose gel infused with RedSafe dye and seen under ultraviolet light using a gel imaging equipment.⁴⁵

Table 1.

Primer Sequences for Target and Reference Genes.

Gene	Forward Primer (5′ → 3′)	Reverse Primer (5′ → 3′)	Amplicon Size (bp)	Tm (°C)
amrZ	TGACAAATTCGTCGTTCGTCTGCC	AACACCGAGATTGTCTTGCAGCG	148	53
ErsA	CGTATGGGGAGGGGGAAGTT	TTCGATGCTCCTTTGCAGTGT	94	59
algD	TTGGTTTGGGCTATGTCGGTG	CGACTTGCCCTGGTTGATCAG	116	58
SrbA	TTCTCGACTGGATCAAGTGCC	CTTGACGAGATTGCGACTGGA	135	58
16S rRNA	TTCGGGAACAGAGACACAGGT	TCACCGGCAGTCTCCTTAGAG	139	59

2.10. Treatment of bacterial isolates with ZnO nanoparticles for expression analysis

Selected multidrug-resistant P. aeruginosa isolates demonstrating strong biofilm formation were subjected to sub-inhibitory concentrations of ZnO NPs to evaluate their transcriptional responses. Mid-logarithmic phase cultures (OD600 ≈ 0.5) grown in TSB were treated with ZnO NPs at final concentrations of 12,500 μg/mL (equivalent to 1/4 MIC) and 25,000 μg/mL (equivalent to 1/2 MIC). These sub-inhibitory concentrations were selected based on the established MIC value (50,000 μg/mL) to investigate bacterial transcriptional responses at concentrations that do not cause complete growth inhibition but may trigger adaptive stress responses. The 1/2 MIC and 1/4 MIC represent physiologically relevant sub-lethal exposures commonly used in gene expression studies to evaluate bacterial adaptive mechanisms without confounding effects of cell death. Negative controls were established using untreated cultures grown under identical conditions. All cultures were maintained at 37 °C for a duration of 4 h with shaking at 150 rpm before proceeding with RNA extraction.⁴⁶

2.11. RNA extraction and RT-qPCR analysis

Total RNA was isolated from treated and untreated P. aeruginosa using the TRIzol™ Plus RNA Purification Kit (Invitrogen, USA) following the manufacturer's guidelines. Briefly, samples were lysed in TRIzol, subjected to chloroform phase separation, and precipitated with isopropanol. Pellets were washed with 75% ethanol and dissolved in RNase-free water. Following spectrophotometric quantification, samples were treated with RNase-free DNase I to remove residual genomic DNA.

cDNA was synthesized with the ProtoScript® First-Strand cDNA Synthesis Kit (New England Biolabs, USA) using target-specific reverse primers (algD, ErsA, SrbA, amrZ) and a 16S rRNA internal control.

RT-qPCR was conducted on a QuantStudio 3 system (Applied Biosystems, USA) using the SYBR Green-based Luna® Universal qPCR Master Mix (New England Biolabs, USA). Triplicate 20 μL reactions (including non-template controls) contained 10 μL of 2× Master Mix, 1 μL of each 10 μM primer, 5 μL of 1:10 diluted cDNA, and 3 μL of nuclease-free water. The cycling conditions were 95 °C for 60 s, followed by 40 cycles of 95 °C for 15 s and 60 °C for 30 s. Amplification specificity was confirmed via melt curve analysis (60–95 °C at 0.3 °C/step).⁴⁷ The 16S rRNA gene was used as the housekeeping reference gene for normalization. Its stability as an internal control was validated by confirming consistent Ct values (coefficient of variation <5%) across all experimental conditions (treated and untreated samples from all three isolates). Additionally, the stability of 16S rRNA expression was assessed by comparing Ct values between ZnO NP-treated and untreated groups using a paired t-test, which confirmed no statistically significant difference (p > 0.05), thereby validating its suitability as a reference gene.

2.12. Data analysis and statistical methods

The relative expression levels of the target genes (ErsA, SrbA, amrZ, and algD) in response to ZnO NP treatment were quantified using the comparative Ct method (2⁻ΔΔCt, Livak method), as described by Livak and Schmittgen.⁴⁸ All quantitative studies were conducted in separate biological triplicates, and the findings are expressed as mean ± SD. Statistical analyses were performed using GraphPad Prism (version 9.0). The distinctions between different experimental groups were evaluated using one-way analysis of variance (ANOVA), followed by post hoc pairwise comparisons with Bonferroni correction for multiple testing adjustments. Statistical significance for all analyses was determined at p < 0.05.

3. Results

3.1. Antibiotic susceptibility profiles

A total of 150 clinical specimens were collected from patients with suspected bacterial infections from different sources, including wounds, burns, and urine. Fifty samples resulted in positive P. aeruginosa cultures. The total of 50 samples which were tested for antibiotic sensitivity, were sensitive to Ceftazidime/Tazobactam in which MIC was of ≤0.25 mg/ml.

The VITEK 2 analysis showed that the majority of samples (36%) were sensitive to ceftolozane/tazobactam, other tests can be viewed in Table 2.

Table 2.

Antibiotic Susceptibility Profiles of P. aeruginosa Isolates.

Antibiotic	Susceptible (n, %)	Intermediate (n, %)	Resistant (n, %)	MIC Range (mg/mL)
Piperacillin/ Tazobactam	21 (42%)	6 (12%)	23 (46%)	≤4 to ≥128
Ceftazidime	30 (60%)	0 (0%)	20 (40%)	≤1 to ≥64
Ceftazidime/ Avibactam	19 (38%)	0 (0%)	31 (62%)	≤0.25 to ≥32
Ceftolozane/ Tazobactam	18 (36%)	0 (0%)	32 (64%)	≤0.25 to ≥16
Cefepime	29 (58%)	1 (2%)	20 (40%)	≤2 to ≥64
Imipenem	35 (70%)	0 (0%)	15 (30%)	≤1 to ≥16
Meropenem	33 (66%)	0 (0%)	17 (34%)	≤0.25 to ≥16
Amikacin	33 (66%)	2 (4%)	15 (30%)	≤0.25 to ≥4
Gentamicin	32 (64%)	1 (2%)	17 (34%)	≤2 to ≥64
Ciprofloxacin	31 (62%)	0 (0%)	19 (38%)	≤1 to ≥16
Colistin	0 (0%)	47 (94%)	3 (6%)	≥4
Piperacillin/Tazobactam	21 (42%)	6 (12%)	23 (46%)	≤0.5 to ≥8

3.2. Biofilm formation capacity

The phenotypic assessment of biofilm formation revealed that most P. aeruginosa isolates demonstrated the capacity to form biofilms. Of the nine isolates analyzed, 55% were classified as strong a biofilm producers, 33% as moderate biofilm producers, and 11% as weak biofilm producers. A notable correlation was observed between the MDR phenotype and significant the formation of biofilm with eight MDR isolates (88.8%) exhibiting strong or moderate biofilm production.

3.3. Characterization of biosynthesized ZnO NPs

UV–Vis spectroscopic analysis of the ZnO NPs revealed characteristic absorption peaks at 290 and 300 nm in the broth sample (Fig. 1). FTIR spectrographic analysis identified the vibration frequencies of chemical bonds and functional groups present in the ZnO NPs. The absorption band at 3379.29 cm⁻¹ is attributed to C C stretching vibration, while ranges of 1643.35–1633.71 cm⁻¹ correspond to N—H bending and C C stretching vibrations. The strong absorption bands in the low-frequency region of 609.51–567.07 cm⁻¹ are attributed to metal–oxygen (Zn—O) stretching vibrations, confirming successful ZnO nanoparticle formation (Fig. 2). EDX analysis confirmed the elemental composition with atomic percentages of 25.5% Zn and 74.5% O (Fig. 3). FE-SEM imaging revealed the morphological features of the nanoparticles (Fig. 4). AFM analysis demonstrated quasi-spherical morphology with an average particle diameter of 40.75 nm (Fig. 5).

Fig. 1.

Absorption by UV–Vis. a. Absorption of broth. B.Absorption of ZnO NPs.

Fig. 2.

FTIR for a. broth sample and b.ZnO NPs.

Fig. 3.

EDX Spectrum of Sample Showing Elemental Composition.

Fig. 4.

NANOPARTICLE IMAGE BY FESEM.

Fig. 5.

AFM images for nanoparticles; (Left) 2D and (Right) 3D.

Regarding the stability of the biosynthesized ZnO nanoparticles, the UV–Vis absorption spectra remained consistent over a 30-day observation period when stored at room temperature in an airtight container, with no significant shift in the characteristic absorption peak position, indicating good colloidal stability. However, it should be noted that formal zeta potential measurements and dynamic light scattering (DLS) analysis for aggregation behavior assessment were not performed in the current study, which represents a limitation. Future studies should incorporate zeta potential analysis, polydispersity index (PDI) measurements, and long-term stability assessments under various storage conditions (temperature, pH, ionic strength) to comprehensively evaluate the physicochemical stability of the biosynthesized ZnO nanoparticles prior to antimicrobial testing.

3.4. Antimicrobial activity of ZnO NPs

The MIC of ZnO NPs against P. aeruginosa isolates was determined using three methods. First, the resazurin assay provided a colorimetric indication of bacterial viability. At a concentration of 50,000 μg/mL, all wells exhibited a blue color, signifying the complete inhibition of bacterial growth and validating this concentration as the MIC (Fig. 6). At sub-MIC concentrations of 25,000 and 12,500 μg/mL, the wells exhibited a purple color, indicating partial bacterial growth. At concentrations ≤6250 μg/mL, the wells turned pink, indicating robust bacterial growth comparable to that of the untreated controls.

Fig. 6.

Determination of MIC ZnO NPs by resazurin methods.

3.5. Antimicrobial activity of ZnO NPs

The MIC of ZnO NPs against P. aeruginosa isolates was determined using three methods. The resazurin assay demonstrated complete inhibition at 50,000 μg/mL (blue color), partial growth at 25,000 and 12,500 μg/mL (purple color), and robust growth at ≤6250 μg/mL (pink color) (Fig. 6). Broth microdilution confirmed the MIC at 50,000 μg/mL with clear wells, while lower concentrations exhibited increasing turbidity (Fig. 7). The agar well diffusion assay demonstrated concentration-dependent zones of inhibition: for urine isolates, 16 ± 1.2 mm at 50,000 μg/mL, 13 ± 0.9 mm at 25,000 μg/mL, and 10 ± 0.7 mm at 12,500 μg/mL. Similar trends were observed for burn and wound isolates (Table 3, Fig. 8).

Fig. 7.

a. determination the MIC of ZnO NPS by Broth dilution methods, b. culturing of P. aeruginosa after application of ZnO NPs.

Table 3.

Zone of Inhibition (ZOI) of ZnO NPs Against P. aeruginosa.

Isolate Source	ZOI at 50,000 μg/mL (mm)	ZOI at 25,000 μg/mL (mm)	ZOI at 12,500 μg/mL (mm)
Urine	16 ± 1.2	13 ± 0.9	10 ± 0.7
Burn	15 ± 1.0	13 ± 0.8	9 ± 0.6
Wound	17 ± 1.1	15 ± 0.7	11 ± 0.5

Fig. 8.

Disk diffusion methods.

3.6. Anti-biofilm activity of ZnO nanoparticles

The anti-biofilm efficacy of ZnO NPs was assessed across a range of concentrations (50,000 to 156 μg/mL). A statistically significant difference in biofilm biomass was observed among the treatment groups (F(6, 14) = 4.306, p = 0.011). Pairwise comparisons employing Bonferroni correction revealed significant biofilm inhibition at concentrations of 25,000 μg/mL (p = 0.039) and 50,000 μg/mL (p = 0.01) when compared to untreated controls. Lower concentrations (12,500, 6250, 3125, and 156 μg/mL) exhibited non-significant differences (p > 0.05).

3.7. Molecular detection of target genes

Genomic DNA was successfully extracted from three selected MDR P. aeruginosa isolates from different sources. DNA concentration ranged from 26.6 to 39.5 ng/μL, and purity (A260/A280 ratio) ranged from 1.54 to 1.75. Conventional PCR successfully amplified all five target genes (amrZ, ErsA, algD, SrbA, and 16S rRNA) in all isolates. Gel electrophoresis revealed distinct bands corresponding to the expected amplicon sizes (Fig. 9).

Fig. 9.

(a,b): a. gel electrophoresis. b. ladder (50-150 bp).

3.8. Gene expression analysis by RT-qPCR

Total RNA was extracted from P. aeruginosa isolates following treatment with ZnO NPs at sub-MIC concentrations (12,500 and 25,000 μg/mL) and from untreated controls. The relative gene expression was calculated using the 2⁻ΔΔCt method with 16S rRNA as the reference gene. The urine isolate (A1) showed marked upregulation of all target genes: amrZ (17-fold and 15.56-fold), ErsA (15.56-fold and 9.41-fold), algD (42.71-fold and 25.54-fold), and SrbA (24.25-fold and 58.89-fold) at 12,500 and 25,000 μg/mL, respectively. The burn isolate (A2) showed variable responses, with slight upregulation at 12,500 μg/mL but predominantly downregulation at 25,000 μg/mL, except for ErsA (6.52-fold upregulation). The wound isolate (A3) exhibited downregulation of all genes except ErsA, which showed slight upregulation (0.72-fold) at 25,000 μg/mL (Table 4).

Table 4.

Fold Change in Gene Expression Following ZnO NP Treatment.

Isolate Source	ZnO NP Concentration (μg/mL)	amrZ	ErsA	algD	SrbA
Urine (A1)	12,500	18.00	16.56	43.71	24.25
	25,000	16.56	10.41	26.54	58.89
Burn (A2)	12,500	3.12	7.52	1.28	8.22
	25,000	0.16	7.52	0.09	0.09
Wound (A3)	12,500	0.23	0.28	0.19	0.13
	25,000	0.04	1.72	0.03	0.07

Note: Fold change > 2 indicates upregulation; fold change < 0.

4. Discussion

The present study investigated the molecular mechanisms by which biosynthesized ZnO nanoparticles modulate biofilm formation and small RNA-mediated regulation in clinical multidrug-resistant Pseudomonas aeruginosa. Out of 50 clinical isolates obtained from wounds, burns, and urine specimens, 88.8% of the multidrug-resistant isolates demonstrated either strong or moderate capacity for biofilm formation. This strong association between multidrug resistance and biofilm formation is consistent with previous studies demonstrating that biofilm formation facilitates bacterial persistence and resistance through complex regulatory mechanisms.2, 5 Biofilms protect bacterial cells from host immune defenses and limit antibiotic penetration through the presence of an extracellular matrix composed of bacterial cells, extracellular DNA, proteins, rhamnolipids, and extracellular polysaccharides, including PSL, PEL, and alginate.3, 4 These three core exopolysaccharides are directly associated with Pseudomonas biofilm formation and provide structural stability to the biofilm architecture.⁴⁹

The multidrug resistance phenotype observed in this study is mediated through multiple mechanisms that work synergistically with biofilm formation. The reduced permeability of the outer membrane restricts antibiotic entry, while the production of multidrug efflux pumps actively extrudes antibiotics from bacterial cells.⁵⁰ Four primary categories of efflux pumps have been linked to antibiotic resistance in P. aeruginosa: MexAB-OprM, MexXY, MexCD-OprJ, and MexEF-OprN, with RND family efflux pumps displaying the strongest correlation with multidrug resistance.50, 51 Additionally, carbapenem resistance in P. aeruginosa is primarily mediated by OprD loss, which confers resistance to imipenem and other carbapenems.⁵² The coexistence of these resistance mechanisms with biofilm formation creates a formidable challenge for antimicrobial therapyBiofilms have the potential to enhance bacterial resistance to therapeutic interventions by a factor of up to 1000.⁵³

The development of biofilms in P. aeruginosa is governed by complex genetic networks that include both transcriptional and post-transcriptional processes. The global transcriptional regulator AmrZ is essential in modulating several pathways associated with biofilm formation, motility, and virulence, functioning as both an activator and a repressor of particular target genes.8, 54 The algD gene, which encodes an enzyme that mediates carbon flux from sugars into alginate biosynthesis, is a key target of AmrZ regulation.¹³ The ECF sigma factor AlgU (σ^E) is responsible for alginate overproduction, leading to mucoidy and chronic biofilm formation, whereas the anti-sigma factor MucA inhibits AlgU activity.⁵⁵ Mutations in mucA lead to AlgU misregulation, resulting in a mucoid phenotype associated with enhanced biofilm formation and poor clinical outcomes in patients with cystic fibrosis.

The regulation of post-transcriptional processes by small RNAs is essential for the development of biofilms and the adaptation to stress conditions. The small RNA ErsA facilitates biofilm formation by post-transcriptionally regulating amrZ and operates as a trans-encoded sRNA governed by the envelope stress response pathway.¹⁰ The small RNA SrbA has been identified as a crucial regulator of biofilm formation, demonstrating upregulation in both substratum-attached and colony biofilms. The regulation of algU, mucA, rhlA, and rsmA is of significant importance, as these factors are vital for the processes of biofilm formation and virulence.⁵⁶ RsmA functions as a posttranscriptional regulator that governs the production of virulence factors and the formation of biofilms. Its expression is influenced by various regulatory sRNAs, notably SrbA.⁵⁷

Biofilm development and bacterial motility are both regulated by cyclic di-GMP (c-di-GMP) signaling. In both planktonic cultures and biofilm models, c-di-GMP plays a significant role in regulating P. aeruginosa metabolic activity.⁵⁸ Finding that AmrZ is a key regulator of c-di-GMP levels in P. aeruginosa has important consequences for the development and spread of biofilms.⁵⁹ Quorum sensing systems such as the Las, Rhl, Pqs, and Iqs systems are hierarchically linked to the c-di-GMP signaling pathway.⁶⁰ In this intricate web, the Rhl system regulates the synthesis of several biofilm components and virulence factors associated with quorum sensing.⁶⁰

ZnO NPs were successfully synthesized using biological methods and characterized, with an average diameter of 40.75 nm. Biological synthesis methods represent an eco-friendly and sustainable approach to nanoparticle production, with biologically synthesized nanoparticles demonstrating biocompatibility and comparable or superior antimicrobial activity compared to their chemically synthesized counterparts.61, 62 The nanoparticles exhibited concentration-dependent antibacterial activity with an MIC of 50,000 μg/mL and significant anti-biofilm activity at 25,000 and 50,000 μg/mL. These findings are consistent with recent studies demonstrating concentration-dependent antimicrobial activity of biogenic ZnO nanoparticles against Gram-negative pathogens, where the antibacterial efficacy was attributed to ROS-mediated membrane damage and intracellular zinc ion release.30, 31 The primary antimicrobial mechanism of metal oxide nanoparticles is the generation of ROS, which induce severe oxidative stress.53, 63 ROS, such as superoxide anions (O₂•⁻), hydrogen peroxide (H₂O₂), and hydroxyl radicals (•OH), disrupt bacterial cell membranes, proteins, and DNA, ultimately resulting in the death of bacterial cells.⁶³ By penetrating the extracellular polymeric substance (EPS) layer, nanoparticles bypass traditional resistance mechanisms, making them highly effective against multidrug-resistant strains.⁵³

The antimicrobial and antibiofilm activities observed in the present study are consistent with recent findings reported in the literature. Comparable concentration-dependent antibacterial effects have been documented for biogenic ZnO nanoparticles synthesized from various biological sources, including plant extracts of Andrographis paniculata and Calotropis gigantea, which demonstrated significant antimicrobial activity against both Gram-positive and Gram-negative pathogens.19, 27 Similarly, multi-functional ZnO nanoparticles inspired from Myristica fragrans seed extract exhibited potent antibacterial activity against pyogenic bacteria through ROS-mediated mechanisms.¹⁶ The antibiofilm effects observed at 25,000 and 50,000 μg/mL in our study align with the findings of recent systematic reviews demonstrating that metal and metal oxide nanoparticles effectively disrupt biofilm architecture through multiple mechanisms, including EPS degradation, quorum sensing interference, and membrane permeabilization⁶⁴.⁵⁰ Furthermore, iron oxide-based nanocomposites have demonstrated pharmacotherapeutic activity against P. aeruginosa through inhibition of the LasR gene expression pathway, suggesting that metal oxide nanoparticles may target multiple regulatory circuits simultaneously.22, 65

Recent investigations have further corroborated the potential of metal oxide nanoparticles as antimicrobial agents against drug-resistant pathogens. Studies on the antimicrobial mechanisms of nanoparticles have demonstrated that the generation of reactive oxygen species, coupled with direct membrane interaction, constitutes the primary bactericidal mechanism.63, 66 Moreover, the application of nanotechnology-based approaches in combating biofilm-associated infections has shown promising results in both in vitro and in vivo models, supporting the translational potential of nanoparticle-based antimicrobial strategies.⁶⁷

Gene expression analysis revealed that bacterial responses to sub-MIC ZnO nanoparticle exposure were contingent on both the source of the isolate and the concentration of nanoparticles, demonstrating source-specific adaptive responses. Urine isolates exhibited marked upregulation of biofilm-associated genes, particularly SrbA (up to 58.89-fold) and algD (up to 43.71-fold), suggesting pre-adaptation to environmental stressors inherent to the urinary tract. The significant upregulation of SrbA implicates its involvement in the oxidative stress response elicited by ZnO nanoparticles.⁵⁶ The upregulation of algD indicates enhanced alginate biosynthesis, representing an adaptive mechanism that increases biofilm matrix production in response to nanoparticle-induced stress. The amrZ gene showed upregulation (up to 18-fold), reflecting the activation of multiple virulence pathways, whereas ErsA sRNA demonstrated upregulation (up to 16.56-fold), consistent with its role as a stress-responsive regulator.¹⁰ These findings suggest that urine isolates, which are frequently exposed to osmotic stress and nutrient limitation, have developed pre-existing stress response mechanisms that are activated upon nanoparticle exposure.

The marked upregulation of SrbA and algD in urine isolates can be explained by the unique ecological pressures of the urinary tract environment. Bacteria colonizing the urinary tract are chronically exposed to osmotic stress, fluctuating pH, nutrient limitation, and host antimicrobial peptides, which necessitate robust stress response mechanisms. This pre-conditioning likely primes the sRNA regulatory networks, particularly SrbA, which regulates algU and mucA expression, creating a heightened state of transcriptional readiness. Upon exposure to sub-MIC ZnO nanoparticles, the oxidative stress generated by ROS production activates these pre-existing stress response pathways, resulting in the dramatic upregulation observed. The consequent increase in algD expression reflects enhanced alginate biosynthesis as a protective biofilm matrix response, consistent with the known role of alginate in shielding bacteria from oxidative damage.

Burn isolates exhibited a concentration-dependent response reflecting adaptive survival mechanisms. At the lower concentration (12,500 μg/mL, representing 1/4 MIC), these isolates showed upregulation of amrZ (3.12-fold), ErsA (7.52-fold), algD (1.28-fold), and SrbA (8.22-fold), indicating activation of stress response pathways. However, at the higher concentration (25,000 μg/mL, representing 1/2 MIC), these isolates demonstrated downregulation of most genes (amrZ 0.16-fold, algD 0.09-fold, SrbA 0.09-fold), with ErsA remaining upregulated (7.52-fold). This pattern suggests that at lower nanoparticle concentrations, burn isolates attempt to mount a stress response, but at higher concentrations, the cytotoxic effects of ROS generation overwhelm the adaptive capacity of cells, leading to downregulation of metabolic genes and eventual cell death.

Wound isolates primarily exhibited downregulation of biofilm-associated genes, with the exception of ErsA, which demonstrated a slight upregulation at higher concentrations (1.72-fold). The downregulation of amrZ (0.23-fold at 12,500 μg/mL, 0.04-fold at 25,000 μg/mL), algD (0.19-fold at 12,500 μg/mL, 0.03-fold at 25,000 μg/mL), and SrbA (0.13-fold at 12,500 μg/mL, 0.07-fold at 25,000 μg/mL) reflects the cytotoxic implications of nanoparticle exposure. The slight upregulation of ErsA may represent a final attempt by cells to activate stress response mechanisms before succumbing to the nanoparticle-induced damage. Wound isolates, which typically experience higher oxygen availability and more variable nutrient conditions than urine isolates, may have less developed pre-existing stress response mechanisms, rendering them more susceptible to nanoparticle-induced oxidative stress.

The observed increase in biofilm-associated gene expression at subinhibitory concentrations raises important clinical considerations regarding bacterial persistence and resistance development. The upregulation of algD and SrbA at sub-MIC levels, particularly in urine isolates, could potentially enhance bacterial persistence by promoting alginate-rich biofilm formation that provides additional protection against both host immune responses and subsequent antimicrobial treatments. This phenomenon parallels the well-documented “sub-MIC antibiotic paradox,” wherein sublethal antibiotic concentrations can inadvertently promote biofilm formation and horizontal gene transfer. Therefore, in clinical applications, it is imperative to ensure that ZnO nanoparticle concentrations are maintained consistently above the MIC to prevent the selection of biofilm-enhanced, stress-adapted bacterial subpopulations that could exhibit increased recalcitrance to treatment.

The upregulation of amrZ, ErsA, algD, and SrbA after exposure to sub-MIC concentrations suggests that bacterial cells initiate adaptive responses to nanoparticle-induced stress. While ZnO nanoparticles exhibit potent antibacterial and antibiofilm properties at higher concentrations, sub-inhibitory levels may inadvertently trigger stress-response pathways that enhance biofilm-associated gene expression. This adaptive transcriptional response underscores the necessity of careful therapeutic optimization when considering nanoparticles as alternative antimicrobial agents. The upregulation of biofilm-related genes at sub-MIC concentrations could potentially lead to enhanced biofilm formation and increased resistance if the nanoparticle concentrations are not maintained at bactericidal levels. The differential responses observed among isolates from different clinical sources highlight the importance of considering the ecological origin of bacterial isolates when developing antimicrobial strategies.⁶⁸

The findings of the present study are further supported by recent investigations on biogenic nanoparticles and their antimicrobial mechanisms. Studies on ZnO nanoparticles synthesized through green chemistry approaches have demonstrated comparable antibacterial efficacy against both Gram-positive and Gram-negative pathogens, with the antimicrobial activity being attributed to the synergistic effects of ROS generation, zinc ion release, and direct membrane interaction.30, 31 Furthermore, research on nanoparticle-mediated waste valorization and environmental remediation has highlighted the versatility of biogenic metal oxide nanoparticles in addressing multiple challenges simultaneously, from antimicrobial applications to sustainable waste management.²⁸

Although cytotoxicity, biocompatibility, and safety assessments of the biosynthesized ZnO nanoparticles were not performed in the current study, these evaluations are essential for determining their suitability for therapeutic applications. Future investigations should incorporate comprehensive biocompatibility assessments using established in vitro models, including MTT/XTT assays on mammalian cell lines (e.g., HEK-293, L929 fibroblasts, and HaCaT keratinocytes) to determine the therapeutic index and selective toxicity toward bacterial cells over host cells. In vivo biocompatibility and biosafety evaluations should employ zebrafish embryo toxicity models, murine dermal irritation tests, and systemic toxicity assessments following the OECD guidelines. Ecotoxicological assessments should include seed germination assays, soil microbial community analysis, and aquatic organism toxicity tests (Daphnia magna, algal growth inhibition) to evaluate environmental safety.69, 70, 71 Recent studies on polymer-based nanocomposites have demonstrated the feasibility of such comprehensive biosafety profiling for nanomaterial-based therapeutics, providing a framework for future evaluation of the ZnO nanoparticles described herein.72, 73, 74

4.1. Challenges and future prospects

Several challenges remain for the clinical translation of ZnO nanoparticle-based antimicrobial therapies: (i) achieving consistent nanoparticle stability and reproducible synthesis at scale; (ii) determining optimal therapeutic concentrations that maximize bactericidal effects while minimizing host cytotoxicity; (iii) understanding the long-term ecological impact of nanoparticle exposure on commensal microbiota; and (iv) addressing regulatory requirements for nanomaterial-based therapeutics. Future studies should focus on: (a) comprehensive in vivo efficacy evaluation using murine wound and urinary tract infection models; (b) combination therapy approaches pairing ZnO nanoparticles with conventional antibiotics to achieve synergistic effects at lower concentrations; (c) surface functionalization strategies to enhance targeted delivery and reduce systemic toxicity; (d) whole-transcriptome (RNA-seq) analysis to map the complete regulatory response to nanoparticle exposure; and (e) long-term stability and shelf-life assessments under various environmental conditions. Additionally, the development of nanocomposite formulations incorporating biocompatible polymers (chitosan, PEG, alginate) may enhance the therapeutic index and enable controlled release applications for chronic biofilm-associated infections.72, 73, 74

4.2. Limitations

Considering the limitations of this study, the sample size of isolates to evaluate molecular gene expression was limited to three strains of multidrug-resistant isolates from distinct clinical sources. Although these results yield insight into source-specific responses, a larger cohort is needed to translate these transcriptional trends across the general P. aeruginosa population. Second, gene expression analysis was conducted on specific regulatory RNAs (ErsA and SrbA) and transcriptional regulators (amrZ and algD). The intricate regulatory network governing biofilm formation is complex; transcriptomic data such as RNA-seq would provide a more comprehensive picture of the global regulatory changes in response to ZnO nanoparticles. Third, formal zeta potential measurements and dynamic light scattering analysis were not performed to comprehensively characterize nanoparticle stability and aggregation behavior. Fourth, cytotoxicity and biocompatibility assessments on mammalian cell lines were not conducted, which limits the evaluation of therapeutic applicability. Fifth, the absence of in vivo validation using animal infection models restricts the translational relevance of the observed in vitro findings. Finally, the biofilm assays were performed in vitro and therefore may not accurately resemble the complex microenvironments experienced during human infections (in vivo), especially regarding interactions with host immune system components and changes in fluid dynamics.

5. Conclusion

This study demonstrated that biosynthesized ZnO nanoparticles exert effective concentration-dependent antibacterial and anti-biofilm properties against clinical multidrug-resistant P. aeruginosa, with significant inhibition at concentrations ≥25,000 μg/mL. Gene expression analysis revealed distinct source-dependent regulatory patterns at sub-inhibitory concentrations, with urine isolates exhibiting marked upregulation of sRNA-mediated biofilm-associated genes. These findings support the potential of biosynthesized ZnO nanoparticles as adjunctive antimicrobial agents, while emphasizing the critical need for therapeutic concentration optimization to prevent adaptive resistance enhancement.

Availability of data and material

The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.

CRediT authorship contribution statement

Nagham Amer Mohammed Ali: Writing – review & editing, Writing – original draft, Visualization, Validation, Software, Resources, Project administration, Methodology, Investigation, Funding acquisition, Formal analysis, Data curation, Conceptualization. Rana Kadhim Mohammed: Writing – review & editing, Supervision, Project administration, Data curation.

Ethical approval

This study was conducted in accordance with the ethical principles outlined in the Declaration of Helsinki and received approval from the Institutional Review Board of the College of Science, University of Baghdad (Approval No.: [CSEC/0325/0049], Date: [march 21.2025]). Informed consent was obtained from all patients or their legal guardians prior to specimen collection.

Funding

No funds were received to fulfil this work.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

The author is an Editorial Board Member/Editor-in-Chief/Associate Editor/Guest Editor for this journal and was not involved in the editorial review or the decision to publish this article.

The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: