Protocol for mitochondrial DNA extraction, purity evaluation, and global methylation assessment via LC-MS/MS

Summary

Established epigenetic mechanisms, including nuclear (n)DNA methylation, are also known to regulate the mitochondrial (mt) genome despite its lack of histones. However, studies referring to evaluations of mtDNA methylation are often influenced by technical and biological confounders. We present an optimized protocol for extracting mtDNA from peripheral blood and bone marrow mononuclear cells, followed by steps for qualitative assessment to exclude nDNA contaminations and a downstream quantitative analysis of the mtDNA global methylation profile using liquid chromatography combined with mass spectrometry.

Graphical abstract

Highlights

• •Steps for sucrose-gradient mitochondrial isolation
• •Steps for mitochondrial DNA extraction
• •Guidance on mitochondrial DNA purification validation
• •Instructions for LC-MS/MS sample preparation and mtDNA methylation assessment

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

Established epigenetic mechanisms, including nuclear (n)DNA methylation, are also known to regulate the mitochondrial (mt) genome despite its lack of histones. However, studies referring to evaluations of mtDNA methylation are often influenced by technical and biological confounders. We present an optimized protocol for extracting mtDNA from peripheral blood and bone marrow mononuclear cells, followed by steps for qualitative assessment to exclude nDNA contaminations and a downstream quantitative analysis of the mtDNA global methylation profile using liquid chromatography combined with mass spectrometry.

Before you begin

A workflow is outlined for the isolation of peripheral blood and bone marrow mononuclear cells (PBMCs and BMMCs respectively) from human samples, with a further stepwise process of mitochondria concentration by a sucrose gradient method, followed by mtDNA extraction, qualitative evaluation of the purity of mitochondrial enrichment via multiplex PCR and assessment of mtDNA methylation levels quantitatively using the Liquid Chromatography tandem Mass Spectrometry (LC-MS/MS) methodology.

Peripheral blood and bone marrow samples should be collected in anticoagulant-treated tubes, with EDTA, and should be processed immediately after collection or else, they should be maintained at 4°C until processing within less than 12 hours.

Before proceeding to the LC-MS/MS analytical method for the determination of mtDNA methylation levels, mitochondria enrichment must be verified. For an accurate mtDNA methylation assessment, rigorous exclusion of nDNA contamination is required.

To verify the purity of mitochondrial fraction a multiplex PCR was designed by targeting both nuclear gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and mitochondrial gene encoding cytochrome B (MT-CYB). Only mtDNA samples that exhibited amplification of MT-CYB with simultaneous absence of GAPDH amplification were proceeded to LC-MS/MS methylation analysis.

In general, methods of evaluation of mtDNA methylation are considered highly tricky processes, arising first from purity and integrity of mtDNA isolated fractions. Secondly, classical bisulfite conversion and next generation sequencing (NGS) workflows suffer from technical limitations: a) harsh treatment during bisulfite conversion of mtDNA often leads to degradation of the small circular mtDNA fragments, b) heavy (H) and light (L) strands of mtDNA have asymmetric base composition, which biases sequencing and conversion efficiency and also, c) the high copy number heterogeneity of mtDNA relying on the mixed populations (heteroplasmy), further complicate interpretation of NGS results. On the other hand, assessment of mtDNA methylation by LC-MS/MS, offers a quick solution for global rather than targeted estimation¹ albeit very low methylation levels (<1-2%) can be effectively measured. Finally, the 5-methyl-2′-deoxycytidine (5-mdC) and 5-hydroxymethyl-2′-deoxycytidine (5-hmdC) epigenetic marks can be distinguished in contrast to NGS methods, providing a more accurate detection of the true methylation profile.

Innovation

This method has primarily been designed for human bone marrow and peripheral blood mononuclear cells and integrates isolation of mitochondria, qualitative evaluation of mtDNA fraction purity and detection of methylation levels of mtDNA into a consistent one-day protocol. The method has also been applied to cultured human erythroleukemic cells K562. Innovation angles of the present method are the reproducibility and the accuracy of identifying genomic DNA contamination in the mtDNA fraction through a multiplex PCR design, concurrently targeting nuclear and mitochondrial loci in the same reaction. Finally, this method allows the quick, downstream assessment of mtDNA epigenetic modifications of 5-mdC and 5-hmdC nucleosides, providing accurate quantification of mtDNA methylation down to 0,5ppb and simultaneous 5-mdC/5-hmdC detection with the requirement of ≥200 ng mtDNA. The whole procedure from blood/marrow collection to mtDNA methylation assessment requires no longer than 10-11 laboratory working hours for application in a small number of samples and provides high reproducibility of results and low cost per analysis compared to NGS technology.

Institutional permissions

Experiments were performed in accordance with all relevant institutional and governmental ethics regulations, and written informed consent was obtained from all subjects for the experimental use of their blood and bone marrow aspirates. For this protocol, human peripheral blood and bone marrow samples were obtained from donors treated at the “Olympion” General Clinic, Dept of Hematology, Patras, Greece. Sample collection and experimental procedures were approved by the institutional ethics committee of the “Olympion” General Clinic. All procedures were performed in accordance with the Declaration of Helsinki and relevant national regulations.

Isolation of mononuclear cells from peripheral blood and bone marrow samples

Timing: 2 h

Isolate mononuclear cells from human peripheral blood samples and bone marrow aspirates² (troubleshooting 1) through the following steps.

• 1.
  Transfer sample to a 15 ml Falcon tube and add 1 V PBS 1X for dilution (volume should not exceed 6 mL).

  • a.
    Mix thoroughly.
  • b.
    To another 15 ml falcon tube add 1 V Lymphosep.
  • c.
    Transfer carefully the diluted sample over the Lymphosep, avoid mixing and create a sharp interphase.
  • d.
    Centrifuge at 400 g, for 30 minutes, at 20°C–25°C (room temperature, RT). Acceleration and centrifuge brakes should be switched off to prevent mixing of layers during deceleration.

    Note: 30 min of spin time plus 10–12 min acceleration/deceleration without brake, will take about 40 min total centrifuge occupancy.

  • e.
    Transfer the buffy phase to a clean falcon tube and add 1 V PBS 1X.

    Note: Special care in handling should be considered to avoid disturbing layers and co-transferring Lymphosep to the clean falcon tube.

  • f.
    Centrifuge at 200 g, for 10 minutes, at 20 – 25 °C (RT) and discard the supernatant.
• 2.
  Add Pharm Lyce to the pelleted cells and resuspend thoroughly to break up and remove any clots (Figure 1).

  Note: The volume depends on the amount of cell pellet and the degree of red blood cell contamination.

  • a.
    Incubate, protected from light, at 20°C–25°C, for 5 minutes.
  • b.
    Centrifuge at 200 g, for 10 minutes, at 20°C–25°C, and discard the supernatant, without disturbing pellet.
  • c.
    Add 1 ml of PBS 1X to the pelleted cells and resuspend thoroughly.
  • d.
    Add 9 ml of PBS 1X to the pelleted cells and mix gently.

    Note: Adding PBS stepwise improves cell resuspension efficiency.

    Optional: Cells may be counted at this step using an automated cell counter or a hemocytometer under a photonic microscope. Following this step the final amount of isolated mtDNA can be converted to a percentage per cell and provide direct correlations of mtDNA content between different samples.

    Note: Use a minimum amount of resuspended cells (at least 10⁴ cells), for total DNA extraction (including both nDNA and mtDNA). Perform total DNA extraction using organic-solvent based extraction methods according to standard protocols.³

• 3.Centrifuge at 1200 × g, 6 minutes, 4°C, and discard the supernatant.

Note: Cells must be pelleted to continue with the isolation of mitochondria.

Note: Cells can be kept at 4°C or on ice for 1 h maximum before proceeding to the “Mitochondrial enrichment from PBMCs and BMMCs” protocol step.

Figure 1.

Mononuclear cell pellet

(A) Cell pellet with red blood cell contamination.

(B) Cell pellet after Pharm Lyce treatment.

Primer design for mitochondrial and nuclear DNA amplification

Timing: 1.5 h

Design two sets of primers to use in a multiplex conventional PCR to qualitative assess mtDNA purity and detect genomic DNA contamination (Figure 2).

• 4.
  Select a mitochondrial gene that is encoded exclusively by the mtDNA; MT-CYB has been selected in the present protocol.

  • a.
    Retrieve the reference sequence from the NCBI nucleotide database.

Note: This set of primers will confirm the presence of mtDNA. Binding to nDNA sequences encoding mitochondrial genes (NUMTs)^4,5 should be avoided.

• 5.
  Select a nuclear genomic locus; GAPDH has been selected in the present protocol.

  • a.
    Find the gene sequence in NCBI.
  • b.
    Select a locus on an intronic region.

Note: This set of primers will serve as genomic DNA contamination control and should only bind to the nuclear genome therefore, intronic regions ensure specific binding.

• 6.
  Design primer sets using NCBI Primer Blast with the following parameters:

  • a.
    18–24 nucleotides primer length.
  • b.
    GC content between 40% and 60%.
  • c.
    Melting Temperature (Tm) between 58°C and 62°C.

    Note: The two primer sets need to have similar melting temperatures.

  • d.
    Amplicon size ranging between 80bp and 200bp.

    Note: Distinct amplicon sizes for mitochondrial and nuclear targets enables apparent discrimination in multiplex PCR products during agarose gel electrophoresis.

    Note: The size of the PCR product for the mitochondrial target (MT-CYB) is 137bp and for the nuclear target (GAPDH) is 168bp.

• 7.Assess primer specificity in silico by using BLAST to align candidate primer sequences against both human nuclear and mitochondrial genomes.
• 8.Select primer sets that exhibit specific amplification of the targeted mitochondrial and nuclear sequences with no anticipated off-target hits.
• 9.Verify that the two sets of primers have compatible annealing temperatures and amplification efficiencies to support multiplex PCR conditions.
• 10.Assess primer pairs by conventional PCR to confirm expected amplification patterns prior to experimental use in both single and double mode.

Note: In multiplex PCR reactions, total DNA samples should yield both 137bp and 168bp PCR products, while mtDNA samples should produce a single PCR product of 137bp (MT-CYB).

Note: The time investment for the primers’ design is only for once and therefore has not been calculated in the total protocol implementation.

Figure 2.

Primer design

Schematic representation of the two primer set sequences targeting mitochondrial DNA and nuclear DNA loci.

Preparation of nucleoside standard stock solutions

Timing: 1.5 h

• 11.
  Prepare individual 1 mg/L stock solutions for each pure nucleoside standard: 2′-deoxyguanosine (dG), 5-methyl-2′-deoxycytidine (5-mdC) and 5-hydroxymethyl-2′-deoxycytidine (5-hmdC).

  • a.
    Weigh 0.5 mg of each nucleoside powder on an analytical lab scale.
  • b.
    Dissolve each in 0.5 L 1:1 (v/v) mixture of Mobile Phase A (1% acetic acid in LC-MS grade H₂O) and Mobile Phase B (acetonitrile LC-MS grade) in a volumetric flask to obtain a final concentration of 1 mg/L. Mix thoroughly until the powder is completely dissolved.

Note: Stock solutions are stable for up to 6 months when stored at −80°C and up to a maximum of 2 thawing cycles. It is highly recommended to aliquot stock solutions and keep them constantly in −80°C until use.

Preparation of calibration standard mixtures

Timing: 1.5 h

• 12.Perform serial dilutions of the stock solutions using a 1:1 (v/v) mixture of Mobile Phase A and Mobile Phase B in 100 mL volumetric flasks to create intermediate working solutions (e.g., 100 ng/mL for dG, 10 ng/mL for 5-mdC and 5-hmdC).
• 13.
  Prepare calibration standard mixtures covering the following molar ratio ranges, relatively to dG (used as the internal reference):

  • a.
    For 5-mdC/dG: 0.02 to 1 (×10^-2).
  • b.
    For 5-hmdC/dG: 20 to 100 (×10^-5).

Note: For each calibration point, keep the amount of dG constantly at a relatively high concentration (100 ng/mL for 5-mdC standard solutions and 100 mg/L for 5-hmdC standard solutions), to serve as internal ref.¹ Adjust only the volumes of the 5-mdC and 5-hmdC working solutions to generate the desired molar ratios relative to dG. This ensures that calibration curves are constructed based on analyte-to-dG peak area ratios rather than absolute peak areas, ensuring that measured results will not be influenced by injection variability and instrumental fluctuations.

Note: The time investment for the preparation of standards concerns a periodic laborious task and therefore has not been calculated in the total protocol implementation.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Biological samples
Peripheral Blood	Male donor	N/A
Bone Marrow	Male donor	N/A
Chemicals, peptides, and recombinant proteins
PBS 10X	Sigma Aldrich	P5493
Lymphosep	BIO WEST	L0560
Pharm Lyce	BD Bioscience	555899
Tris Ultrapure	Duchefa Biochemie	T1501
Sodium Chloride	CHEM-LAB	CL00.1429
Magnesium Chloride	CHEM-LAB	CL00.1316
Sodium Acetate	MERCK	1.06268
DTT	Sigma Aldrich	D0632
Saccharose A.G.	PENTA Chemicals	24970-31000
EDTA diNa salt.2aq a.r.	CHEM-LAB	CL00.0503
Boric Acid	DUCHEFA	B0503
Triton-X 100	Sigma Aldrich	93443
RNAase A	AppliChem	A3832
Phenol/Chloroform/isoamyl alcohol (25:24:1)	Sigma Aldrich	P2069
Ethanol 100%	AppliChem	147194.1212
MiliQ H2O	N/A	N/A
Nuclease-free H2O	Qiagen	129117
Agarose	NIPPON Genetics	AG02
d H2O	N/A	N/A
100bp DNA Ladder ready-to-use	NIPPON Genetics	MWD100
Acetic Acid 100% for LC-MS LiChropur	MERCK	533001
Acetonitrile (LC-MS grade) 99.95%	CHEM-LAB	CL00.0194
2′-Deoxyguanosine (dG) monohydrate 99-100%	Sigma	D7145
2-Deoxy-5(hydroxymethyl)cytidine (5-hmdC)	TCI	D4220
5-Methyl-2′-deoxycytidine (5-mdC) 99%	ALFA AESAR	J65209
Critical commercial assays
Qubit™ 1X dsDNA High Sensitivity (HS) Assay Kit	Invitrogen™, Thermo Fisher Scientific	Q32851
Nucleoside Digestion Mix	New England Biolabs	M0649S
DreamTaq DNA Polymerase	Thermo Scientific	EP0712
Deoxynucleotide (dNTP) Solution Mix (10mM each)	NEB	N0447
Experimental models: Cell lines
Human Erythroleukemia cell line K562	ATCC	CCL-243
Oligonucleotides
Primers for GAPDH gene: Forward – CGGGTCTTTGCAGTCGTATG Reverse - CTGTTTCTGGGGACTAGGGG	Eurofins Genomic	N/A
Primers for MT-CYB gene: Forward – ACAATTCTCCGATCCGTCCC Reverse - AGTGATTGGCTTAGTGGGCG	Eurofins Genomic	N/A
Software and algorithms
NCBI nucleotide Data base	National Library of Medicine (NLM)	https://www.ncbi.nlm.nih.gov
NCBI Primer Blast	National Library of Medicine (NLM)	https://www.ncbi.nlm.nih.gov/tools/primer-blast/
Cell Counter	Corning	CytoSMART
Gel Imager Software	Cleaver Scientific	GENEPIX V1.8.2.0
LabSolutions LCMS Software	Shimadzu	Version 5.109
IBM SPSS Statistics (v20)	IBM	N/A
Other
Centrifuge	Thermo Fisher Scientific	MicroCL 21 R
Centrifuge	Thermo Fisher Scientific	SL 16 R
Vortex	Finepcr	Finevortex
Cell Counter	Corning Cell Counter	6749
Dounce homogenizer	Fisher Scientific	15321321
Thermal cycler	Applied Biosystems	ProFlex PCR System
Gel Imager electrophoresis	Cleaver Scientific	chemiPRO XL9
Shim-pack Scepter Column (4.6 mm × 100 mm, 5 μm)	Shimadzu	C18-120
LCMS Triple Quadrupole Mass Spectrometer	Shimadzu	8050
Qubit 4.0 Fluorometer	Thermo Fisher Scientific	Q33238
Biometra ThermoShaker	Analytik Jena	TS1
LC-MS autosampler vial kit (1.5 mL PP caps with silicone/PTFE septa)	Shimadzu (CoreFocus)	961-10010-23

Materials and equipment

Solutions and buffers

Tris-HCl (1 M, pH 8.0)

Add 12.11 g Tris to a Duran bottle.

Add 80 ml d H₂O.

Dissolve the solution.

Add a pH meter to observe the pH.

Slowly add hydrochloric acid using a Pasteur pipette to reduce the pH to 8.0.

Adjust the volume to 100 ml.

Sterilize by autoclaving.

Note: Store at 20 – 25 °C for up to 12 months.

5 M NaCl

Add 29.22 g Sodium Chloride to a Duran Bottle.

Add 80 ml dH₂O.

Dissolve the solution.

Adjust the volume to 100 ml.

Sterilize by autoclaving.

Note: Store at 20 – 25 °C for up to 12 months.

2 M MgCl₂

Add 19.04 g of anhydrous MgCl₂ in a Duran Bottle.

Add 80 ml of dH₂O to the bottle and dissolve the solution.

Adjust the volume to 100 ml.

Sterilize by autoclaving.

Note: Store at 20 – 25 °C for up to 12 months.

1 M DTT

Add 3.3 ml Sodium Acetate (CH3COONa) 0.01 M to a 15 ml Falcon tube.

Add 0.515 g DTT to the tube.

Mix thoroughly.

The solution should be filtered sterilized.

Aliquote 7 μl of the solution to 0.2 ml Eppendorf tubes.

Note: Do not autoclave. Store at −20°C. Open a fresh new tube for every experiment.

0.33 M Sucrose

Add 1.13 g Saccharose to a 50 ml falcon tube.

Add 10 ml dH₂O to the same tube.

Fully dissolve the solution.

Filter sterilize the mixture.

Note: Store at 20 – 25 °C for up to 1-2 weeks.

EDTA (0.5 M, pH 8.0)

Add 18.61 g EDTA diNa salt.2aq a.r. to a Duran bottle.

Add 80 ml dH₂O.

Adjust pH to 8.0 by adding NaOH.

Adjust volume to 100 ml.

Note: EDTA will not dissolve until pH is approximately 8.0. Store at 20 – 25 °C for up to 12 months.

TBE 10X

Reagent	Final concentration	Weight or volume
Tris base	1 M	54 g
Boric Acid	1 M	27.5 g
EDTA 0.5 M pH 8.0	20 mM	20 ml
dH2O	N/A	Up to 500 ml

Note: Sterilize by autoclaving. Store at 20 – 25 °C for up to 6 months.

Lysis Buffer

Reagent	Final concentration	Weight or volume
Tris-HCl	10 mM	50 μl
NaCl	10 mM	10 μl
MgCl2	3 mM	7.5 μl
TritonX-100	0.1 %	50 μl
DTT	0.7 mM	3.5 μl
Sucrose	0.1 M	15 μl
MiliQ H2O	N/A	up to 5 ml

Note: Prepare a fresh lysis buffer every time. It should be ice-cold for use.

TNE Buffer

Reagent	Final concentration	Weight or volume
Tris-HCl	10 mM	5 ml
NaCl	100 mM	10 ml
EDTA	1 mM	1 ml
dH2O	N/A	up to 500 ml

Note: Store at 20 – 25 °C for up to 12 months.

Mobile phase A

• •1% (v/v) Acetic Acid (CH₃COOH) in miliQ H₂O.

Storage: Store at 20 – 25 °C for up to 1 week.

Mobile phase B

• •100% Acetonitrile, LC-MS grade.

Storage: Store at 20 – 25 °C in a sealed bottle.

CRITICAL: Use only LC-MS grade solvents and miliQ filtered water to minimize background noise and ion suppression. For consistent, high-quality chromatography, it is strongly recommended to prepare fresh Mobile Phase A and B at the opening of each batch.

Step-by-step method details

Mitochondrial enrichment from PBMCs and BMMCs

Timing: 1.5 h

This part describes a stepwise process of mitochondria concentration derived from cell lysed mixtures of human PBMCs and BMMCs. At least 5x10⁶ cells should be used as starting material. The protocol is optimized to avoid contamination of the mitochondrial fractions with cell nuclei and nDNA. This protocol has also been performed with cell lines such as K562.

• 1.
  Add 600 μl of ice-cold lysis buffer to the cell pellet and resuspend thoroughly by gentle pipetting.

  Note: Lysis buffer selectively disrupts the plasma membrane while preserving organelle integrity.

  • a.
    Incubate the suspension on ice for 15 minutes.
  • b.
    Transfer the cells to a Dounce homogenizer.
  • c.
    Mildly homogenize the cells for 3 minutes.
• 2.
  Prepare a 2ml Eppendorf tube with 350 μl Sucrose 0.33 M (Figure 3).

  • a.
    Carefully layer the homogenate over Sucrose, without disturbing layers.
  • b.
    Centrifuge at 1700 g, for 10 minutes at 4°C.
  • c.
    Carefully transfer the supernatant to a 1.5 ml Eppendorf tube.
  • d.
    Repeat steps 2b and 2c for 3–4 times total and remove as much supernatant as possible.

Note: Supernatant contains mitochondria while nuclei are removed as pellet.

Note: Pelleted nuclei may be kept frozen at −80⁰ C for other applications since they will not be needed for the present workflow.

• 3.Centrifuge the mitochondria-containing supernatant at 13000 g, for 10 minutes in 4°C and discard the supernatant.

Note: The mitochondria are now pelleted.

Figure 3.

Mitochondria isolation

(A) Layering of the cell homogenate over sucrose to an inclined tube.

(B) The upper layer of the cell homogenate and the bottom layer with the sucrose before the centrifugation.

(C) The mitochondrial pellet.

Extraction of mtDNA

Timing: 1.5 h

During the following protocol steps, DNA is extracted from mitochondria using an organic solvent-based method. This method enables retainment of the mtDNA biochemical modifications, such as 5-mdC and 5-hmdC (troubleshooting 2).

• 4.
  Add 300 μl TNE buffer to the pelleted mitochondria and resuspend thoroughly.

  • a.
    Add 3 μl DTT to the suspension.
  • b.
    Add 1 μl RNAase A (10 mg/ml) and mix gently by pipetting.
  • c.
    Incubate in 37°C for 30 minutes.

    Note: RNA should be completely cleaned off as it carries several modified nucleosides that may interfere during LC-MS/MS analysis.

  • d.
    Add equal volume of phenol/chloroform/isoamyl alcohol in 25:24:1 ratio and 30 μl Sodium Acetate 3 M pH 5.2.
  • e.
    Mix vigorously.
• 5.
  Centrifuge at 16200 × g, for 10 min, 4°C.

  • a.
    Transfer carefully the aqueous phase to a new tube.

    Note: If the phases are not separated properly repeat centrifugation.

  • b.
    Add 2.5 volumes of 100% ethanol.
  • c.
    Maintain the sample at −80°C for at least 30 min to precipitate the mtDNA.

    Note: At this stage sample may be kept at −20°C for 16 to 18 h or for longer storage.

• 6.
  Centrifuge at 16200 × g, for 10 min, 4°C.

  • a.
    Discard the supernatant.
  • b.
    Add 200 μl 70% ethanol without resuspending pellet.
  • c.
    Centrifuge at 16200 × g, for 10 min, 4°C.
  • d.
    Discard the supernatant.
  • e.
    Airdry the pelleted DNA.
• 7.Add 30 μl sterile miliQ H₂O and resuspend thoroughly.
• 8.
  Quantify mtDNA using fluorometric assay according to the manufacturer’s instructions.

  • a.
    Use the Qubit™ 1X dsDNA High Sensitivity (HS) Assay Kit.
  • b.
    Prepare standards and working solution as described by the manufacturer.
  • c.
    Pipette 190 μl of working solution into Qubit assay tubes.
  • d.
    Add 10 μl of each mtDNA sample to the corresponding tube.
  • e.
    Vortex briefly and incubate at 20 – 25 °C for 2 minutes.
  • f.
    Measure fluorescence using a Qubit 4.0 Fluorometer.
  • g.
    Record DNA concentration and adjust samples to the desired concentration with sterile miliQ H₂O.

Optional: 0.8% agarose gel electrophoresis can be performed for visual detection.

Detection of mtDNA purity by multiplex conventional PCR

Timing: 2.5 h

A multiplex PCR and consequent agarose gel electrophoresis are performed for the assessment of the purity of the mtDNA, to determine potential contamination with nDNA (Figure 4) (troubleshooting 3 and 4).

• 9.
  Prepare dilutions for mtDNA and total DNA (isolated at Preparation step 2 d, second note) from both peripheral blood and bone marrow samples.

  Note: DNA isolated immediately after cell pelleting encompasses both nDNA and mtDNA and thereby the two different lengths of designed PRC products should be obtained.

  • a.
    Dilute total DNA to a final concentration 15 ng/μL.
  • b.
    Dilute mtDNA to a final concentration 3 ng/μL.

    Note: Use lower input of mtDNA as targeted genes in mtDNA exist at higher copy numbers per cell in relation to the nDNA genes.

• 10.Prepare a multiplex PCR Reaction Master mix containing both sets of primers (Table 1).

Note: The concentrations of the two primer sets are different to reduce amplification bias.

• 11.Aliquote Master Mix into five 0.2 ml PCR tubes.
• 12.
  Add templates as follows to the five tubes respectively:

  • a.
    Add 1 μL of bone marrow mtDNA.
  • b.
    Add 1 μL of bone marrow total DNA.
  • c.
    Add 1 μL of peripheral blood mtDNA.
  • d.
    Add 1 μL of peripheral blood total DNA.
  • e.
    Add 1 μL of nuclease-free H₂O.
• 13.Mix gently by pipetting and briefly centrifuge.
• 14.Place the tubes into a thermal cycler and initiate PCR cycles using the conditions in Table 2.

Figure 4.

Multiplex PCR workflow

MtDNA and nDNA are added in separate tubes to provide amplification products by reacting with unified master mix reagents.

The PCR tubes are placed into a thermal cycler and incubated in specific PCR cycling conditions.

MtDNA purity is confirmed by visualization of the expected PCR products in agarose gel electrophoresis.

Table 1.

Multiplex PCR reaction master mix

Reagent	Final concentration	Amount per reaction
Buffer 10X	1X	5 μl
dNTPs 10 mM each	0.2 mM each	1 μl
Forward Primer MT-CYB 10 μM	0.3 μM	1.5 μl
Reverse Primer MT-CYB 10 μM	0.3 μM	1.5 μl
Forward Primer GAPDH-intron 10μM	0.7 μM	3.5 μl
Reverse Primer GAPDH-intron 10μM	0.7 μM	3.5 μl
DREAMTaq polymerase	1.25 units/rxn	0.25 μl
Nuclease-free H2O	N/A	up to 49 μl

Table 2.

PCR cycling conditions

Steps	Temperature	Time	Cycles
Initial Denaturation	95 °C	3 min	1
Denaturation	95 °C	30 sec	31 cycles
Annealing	57 °C	30 sec	–
Extension	72 °C	1 min	–
Final extension	72 °C	5 min	1
Hold	12 °C	Hold

Agarose gel electrophoresis

Timing: 40 min

This step describes the separation and observation of PCR products by agarose gel electrophoresis to determine any residuals of genomic DNA in the mtDNA fraction (troubleshooting 5).

• 15.Prepare a 2% agarose gel in 1X TBE buffer.
• 16.Load 15 μl of each sample into separate wells.

Note: 10X buffer already contains a density reagent and tracking dye so that PCR products can be loaded directly onto an agarose gel without adding extra loading dye.

• 17.Load 5 μL of 100bp DNA ladder for size reference in a separate well.
• 18.Run at 85 V for 40 minutes for adequate separation of the products.
• 19.Visualize bands using UV light and capture image.

Enzymatic digestion of mtDNA to nucleosides for LC–MS/MS analysis

Timing: 2.5 h

This step describes enzymatic digestion of mtDNA to single nucleosides and the preparation of samples for LC–MS/MS analysis for the quantification of 5-mdC and 5-hmdC levels incorporated in the mtDNA (Figure 5)⁶ (troubleshooting 6).

• 20.
  Preparation of the enzymatic digestion reaction.

  • a.
    Add 200 ng of each mtDNA sample in each digestion reaction (max volume should not exceed 13 μL).

    Note: If mtDNA sample concentration is too low, you may scale up the reaction or use the maximum volume allowed (25 μl), noting this as a limitation.

  • b.
    In a sterile, low-binding microcentrifuge tube, combine the following components in order:

    • i.
      X μL of mtDNA (200 ng total).

      Note: Depending on the mtDNA concentration of each sample, the volume added in the reaction might change.

    • ii.
      1.5 μL of 10X Digestion Buffer.
    • iii.
      0.5 μL of Nucleoside Digestion Mix.
    • iv.
      Sterile miliQ H₂O water to a final volume of 15 μL.
  • c.
    Mix gently and briefly spin down the reaction.
• 21.
  Incubate the enzymatic digestion reaction.

  • a.
    Place the tube with the reaction mix in a Thermomixer set to 37°C and shake tubes at 270 rpm.
  • b.
    Incubate for 2 h with continuous shaking of the reaction.

    Note: Every 0.5 h, briefly spin down the tube in a microcentrifuge to keep the reaction intact at the bottom of the tube.

  • c.
    After incubation, proceed immediately to sample dilution. The digested nucleosides can be stored at −20 °C for up to one week.

    Note: The standard protocol recommends digestion of 1 μg DNA for 1 h. In order to ensure complete digestion of DNA, we have extended incubation time.

Figure 5.

Schematic workflow of LC-MS/MS analysis

(A) Mitochondrial DNA is hydrolyzed into nucleosides, which are separated via liquid chromatography and quantified by mass spectrometry.

(B) Chemical structures and distribution across mtDNA of the modified nucleosides.

Sample and standard preparation for LC-MS/MS analysis

Timing: 10 min per batch of samples

This step describes the preparation steps of digested nucleosides for injection to the mass spectrometer instrument. The samples must be diluted in the mobile phases to be compatible with the LC system. Pure nucleoside standards’ serial dilutions are also prepared for every run to enable generation of calibration curves to enable absolute quantification of 5-mdC and 5-hmdC in the unknown samples.

• 22.
  Dilute digested samples for LC-MS/MS injection.

  • a.
    Dilute the 15 μL of the digestion reaction with 1:1 (v/v) mixture of Mobile Phase A and Mobile Phase B to obtain a final concentration of 6.25 ng/μL of the original DNA input.

    • i.
      Add 17 μL of a 1:1 (v/v) mixture of Mobile Phase A and Mobile Phase B directly to the 15 μL digestion reaction.
    • ii.
      The final volume is 32 μL, containing nucleosides derived from 200 ng of input DNA, resulting in a final concentration of 6.25 ng/μL of the original DNA.
  • b.
    Mix thoroughly by pipetting. The sample is now ready for injection.

    CRITICAL: The injection volume is 10 μL. Therefore, each injection will contain 62.5 ng of DNA (6.25 ng/μL × 10 μL), which is within the optimal sensitivity range of the instrument.

  • c.
    Transfer the diluted samples and calibration standards into LC-MS compatible autosampler vials (Figure 6).

    • i.
      Place low-volume vial inserts inside each autosampler vial prior to sample transfer to ensure sufficient liquid height for reliable sample uptake by the LC-MS/MS autosampler. Load the samples into the vials containing the inserts, cap the vials securely and vortex briefly to ensure sample consistency prior to the injection.
  • d.
    Place the vials in the autosampler tray and proceed with LC-MS/MS analysis.

    CRITICAL: The use of low-volume inserts is necessary to prevent injection failure due to insufficient sample depth.

Figure 6.

LC-MS/MS Autosampler vial and low volume vial insert

LC-MS/MS analysis for nucleoside quantification

Timing: 20 min per sample (plus system equilibration)

This step details the liquid chromatography and mass spectrometry parameters using LCMS-8050 Triple Quadrupole Mass Spectrometer system (Shimadzu, Japan), for the separation and quantification of the modified nucleosides 5-mdC and 5-hmdC (Figure 5) (troubleshooting 7).

• 23.
  Configure the Liquid Chromatography (LC) system.

  • a.
    Use a Shim-pack Scepter C18-120 (4.6 mm × 100 mm, 5 μm particle size) with a 3.0 x 10 mm pre-column (C18, 2μm particle size).
  • b.
    Set the column oven temperature to 35 °C.
  • c.
    Use the mobile phases A and B prepared as described previously.
  • d.
    Apply a linear gradient from 95% A/5% B to 35% A/65% B over 15 min, followed by a return to initial conditions (95% A/5% B).
  • e.
    Set the flow rate to 0.2 mL/min.
• 24.
  Configure the tandem mass spectrometer (MS/MS).

  • a.
    Operate the source in positive electrospray ionization (ESI+) mode.
  • b.
    Use the following source parameters:

    • i.
      Nebulizing Gas Flow: 3.0 L/min.
    • ii.
      Drying Gas Flow: 7.0 L/min.
    • iii.
      Heating Gas Flow: 10.0 L/min.
    • iv.
      Interface Temperature: 526°C.
    • v.
      Desolvation Line (DL) Temperature: 250°C.
    • vi.
      Heat Block Temperature: 400 °C.
    • vii.
      Interface Voltage: 4.0 kV.
  • c.
    Set the detector to acquire data in Multiple Reaction Monitoring (MRM) mode.
  • d.
    Define the following MRM transitions (precursor ion > product ion) with optimized collision energy at 15eV (CE) (Table 3).⁷
• 25.
  Execute the LC–MS/MS acquisition method, following the operational parameters detailed previously.

  • a.
    Create a batch sequence using the LabSolutions software (version 5.109, Copyright © 2008-2021, Shimadzu Corporation, Kyoto, Japan).”
  • b.
    Include blank injections (1:1 Mobile Phase A/B) between samples to prevent carryover.
  • c.
    Start the sequence. The total run time per injection is 20 minutes.
  • d.
    Each sample is analyzed twice.

Note: All samples should be kept at a constant temperature of 4°C in the autosampler during the entire batch run to preserve analyte stability.

Table 3.

Optimized MRM transitions for the target nucleosides

Target nucleoside	Q1 Mass (m/z)	Q3 Mass (m/z)
Deoxyguanosine (dG)	268.4	152.4
5-methyl-2′-deoxycytidine (5-mdC)	242.1	126.1
5-hydroxy-methyl-2′-deoxycytidine (5-hmdC)	258.1	142.1

Data processing and calculation of global methylation levels in mtDNA samples

Timing: 1–2 h

This final step involves the processing of raw chromatographic data, construction of calibration curves, and calculation of global levels of the cytosine modifications in each of the mtDNA samples.

• 26.
  Process chromatographic data.

  • a.
    Using the LabSolutions software (Post Run Analysis), integrate the peak areas for each nucleoside (dG, 5-mdC, 5-hmdC) in all standard and sample chromatograms, following integration parameters as below:

    • i.
      MaxPeak:5
    • ii.
      Width: 5 sec
    • iii.
      Slope: 10/min
    • iv.
      Drift: 0/min
    • v.
      T.DBL: 1000 min
    • vi.
      Min. Area/Height: 30000 counts
  • b.
    Retrieve peak area and retention time of each nucleoside see Figure 7.
• 27.Generate calibration curves.
• 28.Calculate global mtDNA modification levels of 5-mdC and 5-hmdC, in each of the samples, by applying values to the respective calibration curve equations derived from the analytical standards

Note: The duration of this step depends on the number of samples analyzed simultaneously and the time required for data processing. Since chromatographic data analysis and calculations can be performed independently of the experimental workflow, the time required for this step is not included in the total protocol duration.

Figure 7.

Representative MRM chromatograms obtained via LC-ESI-MS/MS for the three analytical standards

Expected outcomes

Purified mtDNA is extracted from human PBMCs and BMMCs with undetectable nDNA contamination using the presented method, which is suitable for further epigenetic research. 5x10⁶ cells should be at least obtained as a starting material for downstream isolation of mtDNA. Enrichment of mitochondria followed by organic solvent-based DNA extraction method usually generates sufficient mtDNA (>300 ng) for qualitative PCR-based purity assessment as well as quantitative methylation analysis. Commercial kits with columns for the mtDNA isolation largely decimate its biochemical composition of cytosine modifications 5-mdC and 5-hmdC, therefore the organic solvent-based DNA extraction was the method of choice in the present protocol.

Different amplification patterns emerged by performing the designed multiplex conventional PCR using two primer sets, depending on the DNA template. Total DNA samples from PBMCs and BMMCs produced two distinct PCR products that corresponded to MT-CYB and GAPDH sets of primers, respectively. However, a single PCR product, matching only to the MT-CYB, was anticipated to be amplified by mtDNA and successfully confirmed the absence of nuclear DNA contamination (Figure 8).

Figure 8.

Multiplex PCR amplification of mitochondrial and nuclear genes from bone marrow (BM) and peripheral blood (PB) samples

Amplification of MT-CYB is detected in all mtDNA and total DNA samples.

Amplification of GAPDH-Intron is detected only in total DNA samples, confirming the purity of mtDNA samples.

Band sizes correspond to the expected amplicons.

The present protocol provides an efficient and reproducible workflow for pure mtDNA extraction and quantification of mtDNA global methylation levels using LC-MS/MS. Well-resolved chromatographic peaks are extracted for each monitored nucleoside (5-mdC and 5-hmdC) (Figure 7). Each nucleoside elutes at a consistent and reproducible retention time (6.4 min for 5-hmdC and 7.6 min for 5-mdC), with clearly distinguishable peak shapes and minimal baseline interference, enabling reliable peak integration. dG with retention time 9.8 min is included as an internal standard which ensures normalization across samples and compensates for variability introduced at any step of the process. It also enhances the quantitative accuracy and comparability of measurements across experimental runs. Calibration curves generated from pure nucleoside standards demonstrated strong linearity (R² > 0.99), supporting absolute quantification. Standard curves for 5mdC/10²dG and 5hmdC/10⁵dG ranged between 0.02-1 for 5mdC/10²dG and 20-100 for 5hmdC/10⁵dG (Figure 9).

Figure 9.

Standard curves for 5mdC/10²dG and 5hmdC/105dG

Application of the protocol to mtDNA samples derived from human PBMCS and BMMCs yielded reproducible and quantifiable levels of 5mdC. MtDNA inputs of 200 ng, exhibited a range from 0.15 to 0.30 for 5-mdC. However, 5-hmdC mark was present at levels near the limit of detection (LOD), therefore quantitative values cannot be reported confidently.

Together, these measurements provide both DNA relative methylation levels (normalized to dG) and absolute analyte concentrations, confirming the sensitivity and quantitative consistency of the LC–MS/MS workflow. Replicate analyses showed consistent retention times and peak area ratios, indicating high analytical reproducibility.

Quantification and statistical analysis

Quantification of mtDNA modifications is performed using calibration curves generated from pure nucleoside standards. For each modification, calibration curves are constructed by plotting the measured LC–MS/MS peak area ratio relative to dG (5-mdC/dG and 5-hmdC/dG) against the corresponding molar ratio of each modification normalized to dG (5-mdC/10² dG and 5-hmdC/10⁵ dG). Linear regression is applied to generate the equation of the calibration curve for each modified nucleoside (y = a+bx), where y is the peak area ratio and x is the molar ratio. Peak area ratios obtained from sample chromatograms after integration are then used to determine the corresponding concentration of each modification by inserting into the appropriate calibration curve equation. Sample measurements are accepted for quantification only when peak areas fall within the linear dynamic range of the calibration curve and show consistent retention times compared with standards. Samples are measured in duplicates. For statistical analysis, the mean value of the duplicate measurements is used as the representative value per sample. Statistical analysis is performed using IBM SPSS Statistics software (version 20).

Limitations

The present protocol is designed for the extraction of mtDNA from PBMCs and BMMCs as well as for evaluation of its’ purity through multiplex PCR and downstream assessment of mtDNA methylation profile.

The designed multiplex conventional PCR assay provides a qualitative assessment of mtDNA but cannot represent an absolute quantitative assay. Even though GAPDH (nuclear gene) amplification was not detected in any of the mtDNA samples when tested by the multiplex PCR, a more sensitive method (for example a digital PCR assay) would probably be capable of detecting small traces of nDNA, indicating minimal contaminations. The implementation of dPCR however, would substantially increase the cost per sample without delivering proportional benefits to the workflow.

Balanced amplification of both targets (nuclear and mitochondrial genes) is essential for multiplex PCR. Optimizing primer concentration and PCR conditions is crucial when adapting the protocol to different primer sets or sample types. Differences occurred in primer efficiency or template concentration may affect band intensity in gel electrophoresis and should not be quantitatively interpreted. The efficiency of mtDNA isolation may vary depending on numerous factors, such as sample quality, cell number and handling conditions. Downstream applications may be affected by low mtDNA yield, when higher DNA concentrations are required.

Conclusively, it can be considered safe to assess mtDNA methylation levels internally compared across different mitochondrial samples with extremely low-level genomic DNA carryover homogeneously present, if all mtDNA samples are isolated by the same method and all precautions mentioned above have been taken into account. Even though nuclear sequences cannot be totally eliminated, suitable primer design and mitochondrial enrichment process limit their impact on downstream methylation analysis.

The protocol for LC-MS/MS requires a minimum of 200 ng of purified mtDNA for reliable quantification. Very low mtDNA yields from human PBMCs or BMMCs samples cannot be subjected to methylation analysis. While LC-MS/MS enables accurate discrimination between 5-mdC and 5-hmdC, very low-abundance of cytosine modifications below the detection limits of the instrument are not captured (mainly for 5-hmdC), potentially leading to minor underestimation of total cytosine modification content.

Another limitation is that this method measures global, not locus-specific, mtDNA methylation levels.

Overall, the presented protocol gives highly accurate and cost/time effective global estimations of mtDNA content for 5-mdC and 5-hmdC modifications providing a novel and reliable method for epigenetic studies related to mtDNA.

Troubleshooting

Problem 1

Small pellet of mononuclear cells from peripheral blood and bone marrow samples. (Related to step Isolation of mononuclear cells from peripheral blood and bone marrow samples).Cell loss during washing steps or insufficient separation during density gradient centrifugation.

Potential solution

When layering diluted samples over the Lymphosep medium, verify that a clear interphase develops. Also, careful handling will not disturb the interphase when collecting. During the washing phases, carefully aspirate the supernatants without disturbing the pelleted cells.

Problem 2

Low concentration yields of mtDNA from peripheral blood and bone marrow mononuclear cells. (Related to Step: Extraction of mtDNA) Lower mitochondrial content per cell, or mitochondrial loss during enrichment steps.

Potential solution

Process samples promptly after collection. Maintain all buffers and samples on ice to preserve organelle integrity during mitochondrial isolation and minimize mitochondrial loss.

Problem 3

Amplification of MT-CYB is weak or absent in mtDNA samples (Related to Step: Detection of mtDNA purity by multiplex conventional PCR).

Low mtDNA concentration due to inadequate starting material, loss of mitochondria during isolation or during organic solvent-based mtDNA extraction.

Potential solution

Verify that during the extraction and precipitation procedures that mitochondria pellet is apparent. Before setting up the PCR, confirm concentrations of DNA samples and increase the amount of mtDNA template used for amplification if needed.

Problem 4

MT-CYB and GAPDH exhibit distinct amplification efficiencies in multiplex PCR (Related to Step: Detection of mtDNA purity by multiplex conventional PCR).

Differences in amplification efficiency or primer binding efficiency or competition between the two sets of primers or differences in template concentration.

Potential solution

Perform optimization of the concentration for each of the primer sets separately to accomplish balanced amplification or lower the concentration of the more effective primer set. The annealing temperatures of the two primer sets should be compatible and the two PCR products should have sufficiently different sizes for agarose gel resolution.

Problem 5

GAPDH amplification is detected in mtDNA samples. (Related to Step: Agarose gel electrophoresis) During subcellular compartmentalization (fractionation) there was incomplete separation of mitochondria from nuclei. Nuclear membranes may be ruptured through excessive mechanical force during homogenization, leading to genomic DNA carryover. Furthermore, nuclear pellets may be disrupted by improper supernatant aspiration.

Potential solution

Avoid excessive force and perform gently and consistently homogenization and cell lysis. Carefully aspirate supernatants without disrupting pellets. If contamination persists, include an additional low-speed centrifugation step to improve nuclear removal.

Problem 6

Low mtDNA concentration prevents preparation of 200 ng input for the digestion reaction (Related to Step: Enzymatic digestion of mtDNA to nucleosides for LC–MS/MS analysis).

Potential solution

• •If the available mtDNA amount is insufficient to reach 200 ng, reduce the DNA input to 150 ng and proceed with the enzymatic digestion.
• •If required, increase the digestion reaction volume from 15 μL to 25 μL to accommodate a larger sample volume, while maintaining 1X Digestion Buffer concentration and proportional enzyme amounts.

To keep LC-MS/MS injection conditions constant, adjust the final dilution volume after digestion rather than changing the injection volume. Dilute the digested sample with a 1:1 (v/v) mixture of Mobile Phase A and Mobile Phase B to reach a final concentration of 6.25 ng/μL of mtDNA, ensuring that each 10 μL injection corresponds to 62.5 ng of mtDNA, regardless of initial DNA input.

Calculate the required final volume using the following relationship:

$$V_{final\left(\mu L\right)}=\frac{{DNA}_{input\left(ng\right)}}{6.25}$$

For example, 200 ng DNA corresponds to a final volume of 32 μL, whereas 150 ng DNA corresponds to a final volume of 24 μL.

Note: Maintaining constant DNA-equivalent concentration and injection volume enables direct comparison across samples and preserves analytical sensitivity, particularly for low-abundance nucleosides such as 5-hmdC.

Problem 7

Detector saturation (peak signal exceeds the linear range) during LC-MS/MS acquisition (Related to Step: LC-MS/MS analysis for nucleoside quantification and/or Data processing and calculation of global methylation levels).

Potential solution

• •If the signal intensity (peak height/area) indicates detector saturation (e.g., flattened peak tops or out-of-range response), do not use the chromatogram for quantification.
• •Prepare a higher dilution of the digested sample using the same 1:1 (v/v) Mobile Phase A: Mobile Phase B matrix and re-inject the sample to bring peak areas within the linear range of the calibration curve.
• •Re-run the sample and confirm that all target nucleosides (dG, 5-mdC, 5-hmdC) fall within the validated calibration range before calculating methylation ratios.

Note: Always verify that saturated samples are diluted using the same solvent composition as standards to preserve matrix matching and quantitative accuracy.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Argyro Sgourou (sgourou@eap.gr).

Technical contact

Technical questions on executing this protocol should be directed to and will be answered by the technical contacts, Argyri Chroni (argychroni@gmail.com), Theodora Alexiou (theodora.alexiou5@gmail.com), and John Zafeiropoulos (jzafeirop@eap.gr).

Materials availability

This study did not generate new unique reagents.

Data and code availability

This study did not generate new data and code.

Acknowledgments

This study was supported by the Hellenic Open University through grant no. 80706 from the Special Account of Research Funds (ELKE).

Author contributions

A.C., T.A., and J.Z. performed the experiments and drafted the manuscript. V.C. supervised experimental procedures. A. Symeonidis provided human samples. A. Sgourou edited and refined the manuscript. All authors have approved the manuscript and agreed to submit it for publication.

Declaration of interests

The authors declare no competing interests.