Skip to main content
NCBI home page
Journal of Traditional and Complementary Medicine logoLink to Journal of Traditional and Complementary Medicine
. 2025 Mar 14;16(4):422–432. doi: 10.1016/j.jtcme.2025.03.004

Combination therapy of shinbaro and celecoxib improves joint pain and cartilage degradation in an osteoarthritis mouse model

Jae-Hwan Jang 1, Yurim Song 1, Seok Hee Han 1, Bo Ram Choi 1, Yoon Jae Lee 1, In-Hyuk Ha 1,⁎
PMCID: PMC13316409  PMID: 42382059

Abstract

Osteoarthritis is characterized by cartilage degeneration and joint pain, and celecoxib is widely used to treat osteoarthritis, but it has the risk of side effects. We investigated the effect of Shinbaro, a herbal medicine, combined with celecoxib in osteoarthritis. In vitro, primary chondrocytes treated with Shinbaro (200 μg/mL) or celecoxib (0.5 or 1 μM) in the presence of interleukin (IL)-1β (1 ng/mL) for 24 and 48 h were analyzed for cell viability, gene expression, and protein levels. In vivo, mice with osteoarthritis induced via destabilization of the medial meniscus (DMM) surgery were treated with Shinbaro (100 mg/kg) and/or celecoxib (15 or 30 mg/kg) five times weekly for 8 weeks (n = 7/groups; total n = 42). Cartilage degradation and inflammation were evaluated through behavioral tests, Osteoarthritis Research Society International (OARSI) scoring, and immunofluorescence. The combined treatment did not affect cell viability but reduced the IL-1β-induced expression of extracellular matrix (ECM)-degrading enzymes (matrix metallopeptidase 13 and a disintegrin and metalloproteinase with thrombospondin motifs 5) in chondrocytes. It also inhibited IL-1β-induced mitogen-activated protein kinase pathway activation, showing a synergistic reduction in pro-inflammatory markers compared to single treatments. In a DMM-induced osteoarthritis mouse model, the combined treatment improved weight distribution, reduced mechanical allodynia, and protected against cartilage degradation, evidenced by lower OARSI scores and preserved ECM components (COL2A1, aggrecan). The combined treatment with Shinbaro and celecoxib may offer superior therapeutic benefits in reducing joint pain and degeneration in osteoarthritis by targeting inflammation and preserving cartilage, potentially addressing the limitations of long-term celecoxib use.

Keywords: Herbal medicine, Celecoxib, Combination therapy, Osteoarthritis, Cartilage degradation

Graphical abstract

Image 1

Open in a new tab

Abbreviations

NSAIDs

Nonsteroidal Anti-inflammatory Drugs

ECM

Extracellular matrix

IL-1β

Interleukin-1 beta

DMM

Destabilization of the medial meniscus

CCK-8

Cell Counting Kit-8

qRT-PCR

Quantitative real-time polymerase chain reaction

MMP13

Matrix metallopeptidase 13

ADAMTS5

A Disintegrin and Metalloproteinase with Thrombospondin Motifs 5

MAPK

Mitogen-activated protein kinase

ERK

Extracellular signal-regulated kinase

JNK

c-Jun N-terminal kinase

p38

p38 Mitogen-activated protein kinase

COL2A1

Type II collagen

OARSI

Osteoarthritis Research Society International

FBS

Fetal bovine serum

PBS

Phosphate-buffered saline

1. Introduction

Osteoarthritis, a degenerative knee disease, is primarily characterized by cartilage degeneration and subchondral bone sclerosis.1 Clinical symptoms include joint pain, stiffness, tenderness, and local inflammation.1,2 Osteoarthritis affects more than 32.5 million or 1 in 7 adults in the United States, and 528 million or 7% of people worldwide.3 Conventional treatments for osteoarthritis include nonsteroidal anti-inflammatory drugs (NSAIDs). Celecoxib, a cyclooxygenase-2 (COX-2) selective inhibitor is a widely used NSAID because of its lower risk of gastrointestinal adverse effects than other NSAIDs.4 However, prolonged celecoxib use can lead to several adverse effects, including cardiovascular, headache, dizziness, stomach pain, diarrhea, and dyspepsia.,5,6 and has been shown to increase cardiovascular risk in a dose-dependent manner.7

Shinbaro (Shinbaro®), a herbal formulation comprising six herbs—Ledebouriellae Radix, Achyranthis Radix, Acanthopanacis Cortex, Cibotii Rhizoma, Glycine Semen, and Eucommiae Cortex— is used in oriental medicine to treat patients with osteoarthritis.8 In preclinical studies, Ledebouriellae Radix demonstrated anti-inflammatory and analgesic effects in complete Freund's adjuvant (CFA)-induced arthritis in rats,9 whereas Achyranthis Radix contributed to mesenchymal stem cell repair for the treatment of osteoarthritis.10 Shinbaro effectively suppresses pro-inflammatory cytokines and inflammatory mediators in a monosodium iodoacetate-induced osteoarthritis rat model through both oral and intra-articular administration.11,12 Additionally, it exhibits high gastrointestinal safety during long-term use for 24 weeks in patients with osteoarthritis.13 Building on these findings, we hypothesized that combining low-dose celecoxib with Shinbaro might be a safe and long-term treatment and effective management of patients with osteoarthritis.

To test this hypothesis, in this study, we aimed to investigate the effects of combined administration of Shinbaro and celecoxib on cartilage degradation inhibition compared to monotherapy in a mouse model of osteoarthritis induced by destabilization of the medial meniscus (DMM).

2. Materials and methods

2.1. Articular chondrocytes primary culture and drug treatment

Murine articular chondrocytes were isolated from the femoral condyles and tibial plateaus of 4-d-old postnatal mice (DBL Co. Ltd, Eumseong, Korea) digested with 0.2% collagenase type Ⅱ, at 37 °C in a 5% CO2 atmosphere.14 The cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 1% penicillin/streptomycin (Gibco, NY, USA) and 10% fetal bovine serum (FBS, HyClone, Logan, UT, USA) for 3 d.

IL-1β was dissolved in saline, and Shinbaro (Green Cross Corp., Yongin, Korea) and celecoxib (PHR1683, Sigma-Aldrich) were dissolved in 0.5% carboxymethyl cellulose (CMC) sodium solution. The cells were then treated with various doses of Shinbaro and/or celecoxib, along with IL-1β (1 ng/mL) for 24 or 48 h.

2.2. Cell viability assay

Chondrocytes (1 × 104 cells/well) were treated with Shinbaro (1–200 μg/mL; 8 doses) or celecoxib (0.1–50 μM; 9 doses), and a combination of both (Shinbaro 200 μg/mL and celecoxib 0.1–50 μM; 9 doses) for 24 h. Cell viability following the treatment with Shinbaro, celecoxib, or both in chondrocytes was assessed using cell counting kit-8 (CCK-8) measured at 450 nm using a microplate reader (Epoch; BioTek, Winooski, VT, USA).

2.3. Quantitative real-time polymerase chain reaction (qRT-PCR)

Chondrocytes (5 × 105 cells/well) were treated with Shinbaro (200 μg/mL) or celecoxib (0.5 or 1 μM), or a combination of Shinbaro (200 μg/mL) and celecoxib (0.5 or 1 μM) for 24 h. Total RNA was extracted from chondrocytes using TRIzol (Life Technologies, Carlsbad, CA, USA), followed by the synthesis of cDNA using an RT kit (Biofact, Daejeon, Korea) according to the manufacturer's instructions. qRT-PCR analysis was conducted using SYBR Green Master mix (Bio-Rad, Hercules, CA, USA) and an iCycler iQ real-time PCR detection system (Bio-Rad). The primer sequences of the genes are provided in Table 1.

Table 1.

Primer sequences used for RT-qPCR analysis in this study.

Gene Sequence
Actb F: 5′- TGGAATCCTGTGGCATCCATGAAAC -3′
R: 5′- TAAAACGCAGCTCAGTAACAGTCCG -3′
Adamts5 F: 5′- GCCATTGTAATAACCCTGCACC -3′
R: 5′- TCAGTCCCATCCGTAACCTTTG -3′
Mmp13 F: 5′- CCTTGAACGTCATCATCAGG -3′
R: 5′- TGTTTATTGTTGCTGCCCAT -3′
Open in a new tab

2.4. Western blot

Chondrocytes (5 × 105 cells/well) were treated with IL-1β (1 ng/mL) and then Shinbaro (200 μg/mL), celecoxib (0.5 or 1 μM), or a combination of both for 48 h. Cells were lysed in RIPA buffer (Biosesang, Sungnam, Korea) containing 1% phosphatase and protease inhibitors for 15 min. The lysates were centrifuged and the supernatant (protein sample) was collected for protein concentration measurement using the BCA protein assay kit. The protein samples, mixed with the protein loading liquid, were boiled at 95 °C for 5 min for denaturation. Subsequently, the protein samples were separated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a polyvinylidene fluoride membrane. After blocking with 1% skim milk at room temperature (15–25 °C for 1 h, the membrane was incubated with following primary antibodies for 24 h: matrix metallopeptidase 13 (MMP13; rabbit, 1:1000, 18165-1-AP; Proteintech, Rosemont, IL, USA), a disintegrin and metalloproteinase with thrombospondin motifs 5 (ADAMTS5; rabbit, 1:1000, NBP2-15286; Novus Biologicals), phosphor-ERK (p-ERK; rabbit, 1:1000, #9101; Cell Signaling Technology), ERK (rabbit, 1:1000, #9102; Cell Signaling Technology), phosphor-JNK (p-JNK; mouse, 1:1000, #9255; Cell Signaling Technology), JNK (rabbit, 1:1000, #9252; Cell Signaling Technology), phosphor-p38 (p-p38; rabbit, 1:1000, #4511; Cell Signaling Technology), p38 (rabbit, 1:1000, #8690; Cell Signaling Technology), and β-actin (mouse, 1:5000, #3700; Cell Signaling Technology). Afterward, the membrane was incubated with secondary antibodies [goat anti-rabbit IgG, polyclonal antibody (1:5000, ADI-SAB-300-J; Enzo Life Sciences) and goat anti-mouse IgG F (ab')2, polyclonal antibody (1:5000, ADI-SAB-100-J; Enzo Life Sciences)] for 1 h. All membranes were visualized using amersham imager 600 (GE Healthcare, Chicago, IL, USA) after luminescence staining with Clarity Western ECL Substrate (Bio-Rad; Hercules, CA) attachment, and the signal intensities were analyzed using the Chemidoc image analyzer (Vilber Lourmat, Collégien, France).

2.5. Animals

Eight-week-old male C57BL/6 mice (22–25 g; DBL Co. Ltd, Eumseong, Korea) were acclimated under a 12-h light/dark cycle for 7 d before the experiment. Mice were randomly assigned to six groups, and water and food were provided ad libitum. All experimental procedures were performed in accordance with the institutional guidelines and regulations for the care and use of laboratory animals, and all experiments were approved by Jaseng Animal Care and Use Committee [JSR-2024-01-001-A].

2.6. DMM-induced osteoarthritis model

The DMM method was used to establish the osteoarthritis model. A small incision was made in the skin of the right knee joint of the hind limb, and the medial meniscus ligament was surgically removed. The muscle and skin were sutured using black silk (4-0 Black Silk, AILEE Co., Pusan, Korea). Mice in the Sham group underwent an incision of the right knee joint skin of the hind limb, and then the muscle and skin were sutured using black silk (4-0 Black Silk) without surgical removal of the medial meniscus ligament. The DMM- and Sham-operated mice were given a rest period for 7 d.

2.7. Drug administration

Shinbaro and celecoxib were dissolved in 0.5% CMC sodium solution. Celecoxib was used at 15 and 30 mg/kg, with an effective dose of 10–50 mg/kg.15 To observe the enhancement in the efficacy of celecoxib at lower concentrations, we used 15 mg/kg in combination with Shinbaro (100 mg/kg). Seven days after DMM or sham surgery, Shinbaro (100 mg/kg) and/or celecoxib (15 or 30 mg/kg) were administered to the mice five times a week for 8 weeks by oral gavage (100 μL). Mice in the Sham and DMM groups that did not receive drug treatment were administered the 0.5% CMC sodium solution in the same manner. Subsequently, the mice were randomly and equally divided into six groups: Sham (n = 7; only sham surgery), DMM (n = 7; only DMM surgery), DMM + Shin [n = 7; only Shinbaro (100 mg/kg) injection], DMM + Cel15 group [n = 7; only celecoxib (15 mg/kg) injection], DMM + Cel30 [n = 7; only celecoxib (30 mg/kg) injection], and DMM + Shin + Cel15 [n = 7; combined administration of Shinbaro (100 mg/kg) and celecoxib (15 mg/kg)].

2.8. Behavior tests

2.8.1. Weight-bearing test

Articular nociception was evaluated using an incapacitance tester librae (Ugo Basile, Varese, Italy). The device consists of a plastic chamber (64 mm length × 55 mm height × 40 mm width) with a plantar sensor positioned above a pressure transducer. Mice were placed in the chamber and allowed to acclimate freely for 5 min. The average weight applied by the bilateral forelimb and hindlimb to the plantar sensor was then measured for 5 min. Weight distribution was expressed as the percentage of weight transmitted through the ipsilateral limb compared with the contralateral limb. The improvement rate of weight distribution was calculated using the following formula:

Improvement rate of weight bearing (%) = [(Weight distribution of the drug administration group at 8 weeks – Weight distribution of the DMM group at 8 weeks)/Weight distribution of the DMM group at 8 weeks] × 100.

2.8.2. Von frey test

Mechanical allodynia in both hind paws was evaluated using the von Frey test (Dynamic Plantar Aesthesiometer; Ugo Basile, Varese, Italy). Progressively increasing filament force (0–5.0 g for 10 s) was applied to the plantar surface of each hind paw. The time (latency time) and force (paw withdrawal threshold) for filament removal from the plantar surface of the hind paw were measured, and the average of five measurements was recorded. The von Frey test was performed before DMM surgery (baseline) and on 2, 4, 6, and 8 weeks after the drug administration.

2.9. Osteoarthritis Research Society International (OARSI) score

The right hind limbs of mice were extracted and postfixed in 4% paraformaldehyde at 4 °C for 24 h. The tissues were then decalcified in 0.5M ethylenediaminetetraacetic acid in phosphate-buffered saline (PBS, pH 7.4) for 2 weeks and embedded in paraffin. Afterward, the paraffin-embedded articular cartilage samples were sectioned (4-μm-thick) and stained with hematoxylin and eosin (H&E) and Safranin-O/Fast Green to investigate articular cartilage degradation.16 to investigate articular cartilage degradation. Images were obtained using a microscope (Eclipse Ti2-U; Nikon, Konan, Minato‐ku, Japan) and analyzed using the OARSI score (0–6).17 The improvement rate of cartilage degradation was calculated using the following formula: Improvement rate of cartilage degradation (%) = [(Total OARSI score of drug administration group – Total OARSI score of DMM group)/Total OARSI score of DMM group] × 100.

2.10. Immunofluorescence

Immunofluorescence assay was performed to assess the expression levels of type Ⅱ collagen (COL2A1), aggrecan, MMP13, and ADAMTS5 in the right hind limbs (thickness: 4 μm) of mice. Primary antibodies against COL2A1 (mouse, 1:100, sc-52658; Santa Cruz Biotechnology Inc.), aggrecan (rabbit, 1:2000, AB313636; Abcam), MMP13 (rabbit, 1:100, 18165-1-AP; Proteintech), and ADAMTS5 (rabbit, 1:200, NBP2-15286; Novus Biologicals) were diluted in 1 × PBST (PBS + 0.3% Triton X-100) supplemented with 0.3% goat serum (Sigma-Aldrich). The tissue sections were incubated at 4 °C for 72 h. The tissue sections were sequentially incubated for 1 h with a mixture of donkey anti-Rabbit IgG (H + L) highly cross-adsorbed secondary antibody, Alexa Fluor™ 488 (1:1000 or 1:2000; A-21206, Invitrogen) and donkey anti-mouse IgG (H + L) highly cross-adsorbed secondary antibody, and Alexa Fluor™ 594 (1:1000; A-21203, Invitrogen). Images of the medial tibial plateau of articular cartilage were captured using a confocal microscope (Eclipse C2 Plus; Nikon, Konan, Minato‐ku, Japan). Optical density was measured by analyzing images within a square grid of 50 μm × 50 μm using ImageJ 1.53e (Java 1.8.0_172, National Institutes of Health, USA).

2.11. Statistical analysis

All data are presented as mean ± standard deviation (SD). Statistical analyses were performed using GraphPad Prism 8.0.1 software (GraphPad Software, San Diego, CA). Data were analyzed using one-way analysis of variance (ANOVA) followed by Tukey's post hoc test, as well as two-way ANOVA followed by Tukey's post hoc test. A p-value of <0.05 was considered statistically significant in all analyses.

3. Results

3.1. Cell viability of chondrocytes was not affected by the combined treatment of shinbaro and celecoxib

Assessment of the cytotoxicity of the Shinbaro, celecoxib, or their combined treatments in chondrocytes (Fig. 1A) using CCK-8 assay revealed that different concentrations of Shinbaro (1–200 μg/mL) had a significant effect on cell viability (one-way ANOVA, F [8,53] = 2.375, p = 0.0286); however, the difference was not significant compared to the untreated control (p = 0.2063 vs. untreated control; Tukey's post hoc test; Fig. 1B). Similarly, different concentrations of celecoxib (0.1–50 μM; 9 doses) demonstrated significant effects on cell viability (one-way ANOVA, F [9,60] = 96.24, p < 0.0001), and all concentrations at > 2 μM significantly reduced the viability (Tukey's post hoc test, 2 μM, p = 0.0027 and 5–50 μM, p < 0.0001 vs. 0 μM; Fig. 1C). The combined treatment of celecoxib (0.1–50 μM) and Shinbaro (200 μg/mL) also showed significant effects on cell viability (one-way ANOVA, F [9,60] = 201.5, p < 0.0001), wherein the combination of Shinbaro (200 μg/mL) and celecoxib at > 2 μM significantly reduced cell viability (2–50 μM, p < 0.0001 vs. 0 μM; Tukey's post hoc test; Fig. 1D). Therefore, we used the combination of Shinbaro (200 μg/mL) and celecoxib (0.5 and 1 μM) for further experiments.

Fig. 1.

Fig. 1

Open in a new tab

Effect of Shinbaro and celecoxib on cell viability of chondrocytes. (A) Experimental design for primary chondrocyte treatments. Cell viability of mouse articular chondrocytes treated with (B) Shinbaro (1–200 μg/mL), (C) celecoxib (0.1–50 μM), and (D) Shinbaro (200 μg/mL) + celecoxib (0.1–50 μM) for 24 h. Cell viability was evaluated using the cell counting kit-8 (CCK-8). N = 7/group. ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001 vs.0 μM. Data were analyzed using one-way repeated-measures analysis of variance (ANOVA) followed by Tukey's post hoc test. The results are expressed as the mean ± standard deviation (SD).

3.2. Combined treatment of shinbaro and celecoxib reduced extracellular matrix (ECM)-degrading enzymes increased by IL-1β in chondrocytes

Treatment with IL-1β in chondrocytes increases ECM-degrading enzymes, such as MMP13 (collagenase-3) and ADAMTS5 (aggrecanase).18 Therefore, in this study, we evaluated the effects of the combined treatment of Shinbaro and celecoxib on the levels of expression of MMP13 and ADAMTS5. As shown in Fig. 2A, IL-1β increased the expression of Mmp13 in all treatment groups (one-way ANOVA, F [6,21] = 56.53, p < 0.0001); the expression of Mmp13 mRNA increased significantly compared to that in untreated control (p < 0.0001; Tukey's post hoc test). Treatment with single administration of Shinbaro (p = 0.0026 vs. IL-1β) or celecoxib (celecoxib 0.5 μM, p = 0.0119, celecoxib 1 μM, p = 0.0002 vs. IL-1β) significantly reduced the IL-1β-induced increases in Mmp13 mRNA expression. Nevertheless, the combined treatment with Shinbaro and celecoxib significantly reduced the IL-1β-induced increase in Mmp13 expression in a synergistic manner (Shinbaro + celecoxib 0.5 μM, p < 0.0001 and Shinbaro + celecoxib 1 μM, p < 0.0001 vs. IL-1β; Fig. 2A). Similarly, the expression of Adamts5 mRNA significantly increased with IL-1β treatment (one-way ANOVA, F [6,21] = 46.92, p < 0.0001). Furthermore, the pairwise comparison revealed that IL-1β significantly increased Adamts5 mRNA expression compared to control (p < 0.0001; Tukey's post hoc test), which was alleviated by single (Shinbaro, p < 0.0001, celecoxib 0.5 μM, p = 0.0002, celecoxib 1 μM, p < 0.0001 vs. IL-1β) as well as combined (Shinbaro + celecoxib 0.5 μM, p < 0.0001, Shinbaro + celecoxib 1 μM, p < 0.0001 vs. IL-1β) treatments with Shinbaro and celecoxib (Fig. 2B).

Fig. 2.

Fig. 2

Open in a new tab

Effect of combined treatment of Shinbaro and celecoxib on extracellular matrix (ECM)-degrading enzymes in chondrocytes. (A, B) Expression of Mmp13 and Adamts5 mRNA was analyzed using qRT-PCR after 24 h of treatment. (C, D) Expression of MMP13 and ADAMTS5 was analyzed using Western blot after 48 h of treatment. Primary chondrocytes were treated with Shinbaro (200 μg/mL) and/or celecoxib (0.5 or 1 μM) along with IL-1β (1 ng/mL) to investigate effects at both the RNA and protein levels. N = 4/group. ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001 vs. untreated group; #p < 0.05, ##p < 0.01, ###p < 0.001, ####p < 0.0001 vs. IL-1β treatment group. Data were analyzed using one-way ANOVA followed by Tukey's post hoc test. Results are expressed as mean ± SD. Shin (200 μg/mL), Shinbaro (200 μg/mL); qRT-PCR, quantitative real-time polymerase chain reaction; MMP13, matrix metallopeptidase 13; ADAMTS5, a disintegrin and metalloproteinase with thrombospondin motifs 5.

IL-1β increased the expression of MMP13 in all treatment groups (one-way ANOVA, F [6,21] = 12.38, p < 0.0001). Pairwise comparison of the expression of MMP13 between different groups revealed that IL-1β treatment significantly increased the expression of MMP13 compared to the control (p = 0.0003; Tukey's post hoc test); however, single treatments with Shinbaro (p = 0.9881 vs. IL-1β) or celecoxib could not alleviate this increase (celecoxib 0.5 μM, p = 0.9719, celecoxib 1 μM, p > 0.9999 vs. IL-1β). In contrast, MMP13 levels reduced significantly with combined treatment of Shinbaro and celecoxib (Shinbaro + celecoxib 0.5 μM, p = 0.0033 and Shinbaro + celecoxib 1 μM, p = 0.0009 vs. IL-1β; Fig. 2C).

Furthermore, the expression level of ADAMTS5 was also significantly increased by IL-1β (one-way ANOVA, F [6,21] = 52.33, p < 0.0001). Tukey's post hoc test revealed a significant increase by IL-1β treatment compared with untreated control (p < 0.0001). Single treatments with 1 μM celecoxib reduced the IL-1β-induced increase in ADAMTS5 (p = 0.0325 vs. IL-1β), whereas sole treatments with Shinbaro or 0.5 μM celecoxib did not show significant effects. In contrast, the combined treatment with Shinbaro and celecoxib significantly reduced ADAMTS5 expression (Shinbaro + celecoxib 0.5 μM, p < 0.0001; Shinbaro + celecoxib 1 μM, p < 0.0001 vs. IL-1β; Fig. 2D).

3.3. Combined treatment of shinbaro and celecoxib inhibited MAPK signaling pathway increased by IL-1β in chondrocytes

ERK1/2, JNK, and p38, associated with the MAPK signaling pathway, are pivotal regulators of pro-inflammatory cytokines.19 These proteins significantly contribute to osteoarthritis development by regulating MMP production.20 Therefore, we investigated the effects of the combined treatment of Shinbaro and celecoxib on the expression of ERK, JNK, and p38. The expression level of p-ERK (one-way ANOVA, F [6,21] = 15.92, p < 0.0001) significantly increased with IL-1β treatment in all treatments. The pairwise comparison revealed a significant increase in p-ERK expression in IL-1β-treated chondrocytes compared with control (p < 0.0001; Tukey's post hoc test). Furthermore, single treatments with Shinbaro and celecoxib did not induce significant alterations in IL-1β-induced increases. However, IL-1β-induced increased pERK expression levels were significantly reduced in combination treatments (Shinbaro + celecoxib 0.5 μM, p = 0.0030, Shinbaro + celecoxib 1 μM, p < 0.0001 vs. IL-1β; Fig. 3A). The expression of p-JNK (one-way ANOVA, F [6,21] = 11.89, p < 0.0001) increased by IL-1β. The increase in p-JNK expression was significant compared with the untreated control (p = 0.0002, Tukey's post hoc test); however, the treatment with either Shinbaro or celecoxib could not reduce the IL-1β-induced increased expression of p-JNK. In contrast, the combined treatment with Shinbaro + celecoxib 1 μM showed a significant decrease (p = 0.0238 vs. IL-1β; Fig. 3B). Concordantly, the IL-1β-induced increase in expression of p-p38 (one-way ANOVA, F [6,21] = 35.68, p < 0.0001). However, pairwise comparison revealed no significant reduction in p-p38 expression by single treatments with Shinbaro or celecoxib. In contrast, combined treatment with Shinbaro and celecoxib significantly downregulated the expression of p-p38 (Shinbaro + celecoxib 1 μM; p < 0.0001 vs. IL-1β; Tukey's post hoc test, Fig. 3C). These results demonstrate that combined treatment with Shinbaro and celecoxib reduced chondrocyte loss by inhibiting the activation of ECM-degrading enzymes in chondrocytes.

Fig. 3.

Fig. 3

Open in a new tab

Effects of combined Shinbaro and celecoxib treatment on the MAPK signaling pathway in chondrocytes. (A) Protein expression levels of p-ERK and ERK, (B) p-JNK and JNK, (C) p-p38 and p38 were analyzed using Western blot. Primary chondrocytes were treated with Shinbaro (200 μg/mL), celecoxib (0.5 or 1 μM), and IL-1β (1 ng/mL) for 48 h N = 4/group. ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001 vs. untreated group; #p < 0.05, ##p < 0.01, ####p < 0.0001 vs. IL-1β treatment group. Data were analyzed using one-way ANOVA followed by Tukey's post hoc test and are presented as mean ± SD. p-ERK, phosphorylated ERK; p-JNK, phosphorylated JNK; p-p38, phosphorylated p38.

3.4. Combined administration of shinbaro and celecoxib reduced articular nociception in a mouse model of DMM

We investigated the efficacy of the combined administration of Shinbaro and celecoxib in a DMM mouse model (Fig. 4A). The weight-bearing test revealed that weight distribution (two-way ANOVA, interaction, F [20,144] = 3.153, p < 0.0001; time, F [4144] = 57.77, p < 0.0001) was reduced in the DMM group compared to that in the Sham group (Tukey's post hoc test, 2 weeks, p = 0.0033, 4, 6, 8 weeks, p < 0.0001), and no significant increase was observed in the Shinbaro or Cel15 groups (vs. DMM). However, a significant increase was observed from the 4th week of combined administration (4 weeks, p = 0.0058, 6 weeks, p = 0.0021, 8 weeks, p < 0.0001 vs. DMM; Fig. 4B and Supplementary Table 1). Week 8 wt distribution (one-way ANOVA followed by Tukey's post hoc test, F [5,36] = 31.40, p < 0.0001) is shown in Fig. 4C. Furthermore, at 8 weeks, the rate of improvement in weight bearing was higher in DMM + Shinbaro + celecoxib (15 mg/kg) than that in the DMM + celecoxib (15 mg/kg) and DMM + Shinbaro groups (Table 2). Additionally, no changes in body weight were observed in C57BL/6 mice treated with Shinbaro or celecoxib, and the survival rate remained at 100% in all groups after 8 weeks of treatment (Supplementary Fig. 1). As a result of observing the mouse for 8 weeks, we identified that there were no adverse effects on general appearance, posture, behavior, breathing, or hair.

Fig. 4.

Fig. 4

Open in a new tab

Combined effect of Shinbaro and celecoxib on articular nociception in a destabilization of the medial meniscus (DMM)-induced osteoarthritis model. (A) Experimental design. Mice with DMM-induced osteoarthritis were treated with Shinbaro (100 mg/kg), celecoxib (15 mg/kg or 30 mg/kg), or a combination of Shinbaro (100 mg/kg) and celecoxib (15 mg/kg) via oral administration (p.o.) five times a week for 8 weeks. (B) Articular nociception was assessed using the WB test at 2, 4, 6, and 8 weeks after the start of drug administration. (C) To observe the synergistic effect of co-administration of Shinbaro (100 mg/kg) and celecoxib (15 mg/kg), the result of the WB test at week 8 was analyzed. N = 7/group. ∗∗p < 0.01, ∗∗∗∗p < 0.0001 vs. Sham; ##p < 0.01, ####p < 0.0001 vs. DMM. Data were analyzed using one-way and two-way ANOVA followed by Tukey's post hoc test and are presented as mean ± SD. WB, weight bearing; VF, von Frey test; DMM + Shin, DMM + Shinbaro (100 mg/kg); DMM + Cel15, DMM + celecoxib (15 mg/kg); DMM + Cel30, DMM + celecoxib (30 mg/kg); DMM + Shin + Cel15, DMM + Shinbaro (100 mg/kg) + celecoxib (15 mg/kg).

Table 2.

Improvement rate of weight distribution and cartilage degradation on the combination therapy of Shinbaro and celecoxib for 8 weeks.

Groups Improvement rate
 Total OARSI score
Weight distribution Cartilage degradation
Sham – – 0.7 ± 0.75
DMM – – 18.3 ± 5.86
DMM + Shinbaro 21.98% 16.94% 15.2 ± 1.47
DMM + celecoxib (15 mg/kg) 12.80% 24.59% 13.8 ± 4.45
DMM + celecoxib (30 mg/kg) 28.35% 36.06% 11.7 ± 5.95
DMM + Shinbaro + celecoxib (15 mg/kg) 43.64% 64.48% 6.5 ± 2.28
Open in a new tab

Improvement rate (vs. DMM).

3.5. Combination administration of shinbaro and celecoxib decreased mechanical allodynia in a mouse model of DMM

Next, we performed the von Frey test to investigate the effect of the combined administration of Shinbaro and celecoxib on mechanical allodynia. Latency time, the time taken to avoid the filament reduced significantly in all treatment groups at 6 weeks (two-way ANOVA, interaction, F [20,144] = 1.569, p = 0.0680; time, F [4144] = 0.5683, p = 0.6861; Fig. 5A). Furthermore, it also showed significant differences at 8 weeks (one-way ANOVA followed by Tukey's post hoc test, F [5,36] = 18.31, p < 0.0001; Fig. 5B). Tukey's post hoc test revealed significant reduction in latency time in the DMM group compared to that in the Sham group on 6 (p = 0.0008; Fig. 5A) and 8 weeks (p < 0.0001; Fig. 5B). Latency time did not increase in the Shin or Cel15 groups compared to that in the DMM group; however, it significantly increased in the Shin + Cel15 group from 6 weeks onwards (6 weeks, p = 0.0086, 8 weeks, p < 0.0001; Fig. 5A and B). Likewise, the withdrawal threshold, which measures the pressure required to remove the hind paw from the filament showed significant differences in all treatments at weeks 6 (two-way ANOVA, interaction, F [20,144] = 1.553, p = 0.0725; time, F [4144] = 0.5303, p = 0.7137; Figs. 5C) and 8 (one-way ANOVA followed by Tukey's post hoc test, F [5,36] = 18.52, p < 0.0001; Fig. 5D). It was significantly decreased in the DMM group compared to that in the Sham group (Tukey's post hoc test, 6 weeks, p = 0.0010, 8 weeks, p < 0.0001; Fig. 5C and D), while no significant increase was observed in the Shin and Cel15 groups compared to that in the DMM group. However, Shin + Cel15 significantly increased the DMM-induced reductions in withdrawal threshold (6 weeks, p = 0.0102, 8 weeks, p < 0.0001 vs. DMM; Fig. 5C and D). These results indicate that co-administration of Shinbaro and celecoxib improved joint pain and mechanical allodynia in an animal model of DMM-induced osteoarthritis.

Fig. 5.

Fig. 5

Open in a new tab

Combined effect of Shinbaro and celecoxib on mechanical allodynia in a mouse model of DMM-induced osteoarthritis. (A–D) Latency time (A, B) and withdrawal threshold (C, D). Mechanical allodynia was assessed using the von Frey test at 2, 4, 6, and 8 weeks after the initiation of drug administration. The synergistic effect of the combined use of Shinbaro (100 mg/kg) and celecoxib (15 mg/kg) was analyzed in the 8th week data. N = 7/group. ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001 vs. Sham; #p < 0.05, ##p < 0.01, ####p < 0.0001 vs. DMM. The data were analyzed using one-way and two-way ANOVA followed by Tukey's post hoc test and are presented as mean ± SD. DMM + Shin, DMM + Shinbaro (100 mg/kg); DMM + Cel15, DMM + celecoxib (15 mg/kg); DMM + Cel30, DMM + celecoxib (30 mg/kg); DMM + Shin + Cel15, DMM + Shinbaro (100 mg/kg) + celecoxib (15 mg/kg).

3.6. Combined administration of shinbaro and celecoxib inhibited cartilage degradation by DMM surgery

Next, to investigate the effect of the combination administration of Shinbaro and celecoxib on the degeneration of articular cartilage, we performed H&E and Safranin-O/Fast Green staining on cartilage (Fig. 6A–F). Cartilage degeneration was measured using the OARSI score.17 In the medial femoral condyle (one-way ANOVA, F [5,24] = 6.334, p = 0.0007) and medial tibial plateau (one-way ANOVA, F [5,24] = 4.470, p = 0.0051), OARSI scores were higher in the DMM group than those in the Sham group (Tukey's post hoc test, medial femoral condyle, p = 0.0023, medial tibial plateau, p = 0.0078). Shin + Cel15 significantly reduced the OARSI score increased by DMM in the medial femoral condyle (p = 0.0491; Fig. 6B and C). In the lateral femoral condyle (one-way ANOVA, F [5,24] = 4.704, p = 0.0039) and lateral tibial plateau (one-way ANOVA, F [5,24] = 5.705, p = 0.0013), OARSI scores were also higher in the DMM group than those in the Sham group (Tukey's post hoc test, lateral femoral condyle, p = 0.0030, lateral tibial plateau, p = 0.0007), and Shin + Cel15 significantly decreased the OARSI score (lateral femoral condyle, p = 0.0468, lateral tibial plateau, p = 0.0339; Fig. 6D and E). Total OARSI score (one-way ANOVA, F [5,24] = 10.13, p < 0.0001), which includes four regions, significantly increased in the DMM group compared to that in the Sham group (Tukey's post hoc test, p < 0.0001), and Shin + Cel15 significantly decreased (p = 0.0044 vs. DMM). However, the Shin (p = 0.8813), Cel15 (p = 0.6190), and Cel30 (p = 0.2262) groups did not indicate a significant reduction compared to the DMM group (Fig. 6F and Table 2). Furthermore, the analysis revealed an increased improvement rate of cartilage degradation in the DMM + Shinbaro + celecoxib (15 mg/kg) group compared to those in the DMM + celecoxib (15 mg/kg) and DMM + Shinbaro groups (Table 2).

Fig. 6.

Fig. 6

Open in a new tab

Combined effect of Shinbaro and celecoxib on cartilage degradation in a DMM-induced osteoarthritis model. (A) Hematoxylin and eosin (H&E) and Safranin-O/Fast Green staining used to assess cartilage degradation in mice following 8 weeks of oral administration. Scale bar: 500 μm. (B–E) Osteoarthritis Research Society International (OARSI) scores evaluated for the medial femoral condyle (B), medial tibial plateau (C), lateral femoral condyle (D), and lateral tibial plateau (E), with total scores summed (F). N = 5/group. ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001 vs. Sham; #p < 0.05, ##p < 0.01 vs. DMM. All data were analyzed using one-way ANOVA followed by Tukey's post hoc test and are presented as mean ± SD. DMM + Shin, DMM + Shinbaro (100 mg/kg); DMM + Cel15, DMM + celecoxib (15 mg/kg); DMM + Cel30, DMM + celecoxib (30 mg/kg); DMM + Shin + Cel15, DMM + Shinbaro (100 mg/kg) + celecoxib (15 mg/kg).

3.7. Combined therapy of shinbaro and celecoxib inhibited the increase in ECM-degrading enzymes induced by DMM surgery and protected against damage to the ECM components

ECM comprises macromolecules, the main components of which are collagen and aggrecan. COL2A1 is known as a representative component of ECM. Therefore, we investigated the effect of the combined administration of Shinbaro and celecoxib on ECM components. Immunofluorescence staining of COL2A1 and aggrecan in cartilage demonstrated that the expression level of COL2A1 (one-way ANOVA, F [5,24] = 13.52, p < 0.0001) was decreased in the DMM group compared to that in the Sham group (Tukey's post hoc test, p = 0.0002) and significantly increased in Shin + Cel15 (p = 0.0042 vs. DMM) in the medial tibial plateau of the cartilage. Furthermore, COL2A1 expression levels tended to increase in the Shin group (p = 0.3281 vs. DMM), but no difference was observed in the Cel15 and Cel30 groups (Cel15, p = 0.9978, Cel30 p = 0.9438 vs. DMM; Fig. 7A and E). The expression level of aggrecan (one-way ANOVA, F [5,24] = 4.418, p = 0.0054) was lower in the DMM group than that in the Sham group (Tukey's post hoc test, p = 0.0160) and significantly higher in Shin + Cel15 than that in the DMM group (p = 0.0242). The expression of aggrecan tended to increase in Cel15 (p = 0.0552 vs. DMM) but did not increase in the Shin group (p = 0.8717 vs. DMM; Fig. 7B and F).

Fig. 7.

Fig. 7

Open in a new tab

Combined effect of Shinbaro and celecoxib on ECM components and ECM-degrading enzymes in a DMM-induced osteoarthritis model. (A–D) Representative images of immunofluorescence staining used to evaluate the expression levels of representative components of ECM. (A) COL2A1, (B) aggrecan, (C) MMP13, and (D) ADAMTS5 in the medial tibial plateau of mice after 8 weeks of oral administration. The staining shows COL2A1 in red, aggrecan in green, MMP13 in green, ADAMTS5 in green, and nuclei in blue (DAPI). Scale bar: 50 μm. (E–H) Optical density analysis of the medial tibial plateau performed to quantify the expression of (E) COL2A1, (F) aggrecan, (G) MMP13, and (H) ADAMTS5. N = 5/group. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001 vs. Sham; #p < 0.05, ##p < 0.01 vs. DMM. Data were analyzed using one-way ANOVA followed by Tukey's post hoc test and are presented as mean ± SD. DMM + Shin, DMM + Shinbaro (100 mg/kg); DMM + Cel15, DMM + celecoxib (15 mg/kg); DMM + Cel30, DMM + celecoxib (30 mg/kg); DMM + Shin + Cel15, DMM + Shinbaro (100 mg/kg) + celecoxib (15 mg/kg). COL2A1, type II collagen; MMP13, matrix metallopeptidase 13; ADAMTS5, a disintegrin and metalloproteinase with thrombospondin motifs 5.

Next, we investigated the efficacy of combination administration of Shinbaro and celecoxib on ECM-degrading enzymes. The expression levels of MMP13 and ADAMTS5 were analyzed in the medial tibial plateau of the cartilage. The expression level of MMP13 (one-way ANOVA, F [5,24] = 4.964, p = 0.0029) was significantly increased in the DMM group (Tukey's post hoc test, p = 0.0039 vs. Sham) and significantly reduced in Shin + Cel15 group compared to that in the DMM group (p = 0.0108). MMP13 expression levels did not differ in the Cel15 and Cel30 groups from the DMM group but were significantly reduced in the Shin group (p = 0.0433 vs. DMM; Fig. 7C and G). The expression level of ADAMTS5 (one-way ANOVA, F [5,24] = 8.595, p < 0.0001) was also higher in the DMM group than that in the Sham group (Tukey's post hoc test, p = 0.0020). However, Shin + Cel15 significantly lowered the expression level of ADAMTS5 (p = 0.0145 vs. DMM). ADAMTS5 was not decreased in Shin (p = 0.9672 vs. DMM) but indicated a tendency to decrease in Cel15 (p = 0.0682 vs. DMM; Fig. 7D and H). Similar to the results on the effect of combined administration of Shinbaro and celecoxib in chondrocytes, we found that it protected against cartilage degradation by inhibiting the activation of ECM-degrading enzymes.

4. Discussion

In this study, we investigated the efficacy of the combined administration of Shinbaro and celecoxib in inhibiting articular cartilage degradation compared to the single treatments in a DMM-induced osteoarthritis model. Our findings indicate that the combination treatment not only attenuated the elevation of ECM-degrading enzymes in chondrocytes but also inhibited the activation of the MAPK signaling pathway, which contributes to the synthesis of these enzymes. Additionally, we observed that the combined administration of Shinbaro and celecoxib effectively reduced articular nociception and mechanical allodynia induced by DMM surgery. Furthermore, the combination therapy was found to inhibit the activity of ECM-degrading enzymes while enhancing ECM component levels. These results demonstrate the synergistic effects of Shinbaro and celecoxib in mitigating pain and cartilage degeneration in osteoarthritis, and they suggest potential molecular mechanisms underlying these therapeutic effects.

Celecoxib, a selective COX-2 inhibitor, is widely used to treat osteoarthritis due to its reduced gastrointestinal side effects compared to other NSAIDs.21 However, long-term use of celecoxib is associated with an increased risk of adverse cardiovascular effects.5 To mitigate these therapeutic limitations, combining celecoxib with low-toxicity natural extracts can potentially reduce the necessary dosage of celecoxib, thereby lowering the risk of cardiovascular complications. In this study, we found that Shinbaro, a six-herb natural extract complex, exhibited low cytotoxicity in chondrocytes and was used in osteoarthritis treatment.

Cartilage is composed of an ECM primarily made up of COL2A1 and aggrecan, which are crucial for joint function.22,23 Chondrocytes, the resident cartilage cells, respond to external stimuli via ECM component receptors, triggering the activity of ECM-degrading enzymes such as aggrecanase and collagenase, which promote cartilage degradation.23 MMP13, a key collagenase, is part of the MMP family and efficiently degrades COL2A1 and also targets aggrecan.24,25 ADAMTS5, a prominent aggrecanase, contributes to proteoglycan degradation, particularly in DMM-induced osteoarthritis models.26,27 Furthermore, intra-articular injection of small interfering RNA targeting Mmp13 and Adamts5 reduces cartilage degradation induced by DMM surgery.28 In this study, the combined treatment with Shinbaro and celecoxib was more effective than the single treatments in inhibiting the IL-1β-induced increase in MMP13 and ADAMTS5 in chondrocytes. Additionally, combined administration reduced the expression levels of MMP13 and ADAMTS5 in the cartilage of a DMM-induced osteoarthritis model.

OARSI score is useful in assessing the severity and extent of cartilage surface involvement in the progression and development of osteoarthritis.17 In this study, we divided the cartilage into four regions (medial femoral condyle, medial tibial plateau, lateral femoral condyle, and lateral tibial plateau) and analyzed the OARSI score in each region. The analysis revealed that combined administration reduced cartilage degradation in the DMM-induced osteoarthritis model.

The primary pathological mechanisms in osteoarthritis involve increased activity of ECM-degrading enzymes and inflammation.29, 30, 31 The MAPK signaling pathway plays a crucial role in these processes, particularly in the synthesis of ECM-degrading enzymes and the inflammatory response.20,32,33 Consequently, this pathway is a key target for research on the pathogenesis and treatment of osteoarthritis.34,35 Previous studies have reported that Shinbaro decreases phosphorylation of ERK, p38, and JNK in a collagen-induced arthritis model.36 In our study, the combined treatment with Shinbaro and celecoxib significantly reduced the expression levels of the MAPK signaling pathway in chondrocytes compared to either treatment alone. Furthermore, the evaluation of the expression levels of COL2A1 and aggrecan demonstrated that the combined treatment resulted in increased expression levels of COL2A1 and aggrecan in cartilage compared to single treatments. These results suggest that the combined administration of Shinbaro and celecoxib may provide an effective approach to inhibit the activity of ECM-degrading enzymes, thereby protecting ECM components and consequently protecting cartilage, compared to single-agent therapy.

Additionally, we evaluated the potential of the combined administration of Shinbaro and celecoxib to alleviate joint pain following DMM surgery by measuring articular nociception and mechanical allodynia. Consistent with our expectations, the combined treatment ameliorated articular nociception and mechanical allodynia, as observed through pain behavior tests. These findings indicate that the combined administration of Shinbaro and celecoxib not only protects ECM components through the inhibition of ECM-degrading enzymes but also contributes to the improvement of joint pain in osteoarthritis.

Interestingly, the combined treatment with Shinbaro and celecoxib resulted in a greater improvement in weight-bearing and cartilage degradation than the sum of the effects observed with each treatment individually. Moreover, Shinbaro and celecoxib exhibited distinct efficacies on different ECM proteins in the DMM-induced osteoarthritis model. Celecoxib had a more pronounced effect on the protection of aggrecan, whereas Shinbaro was more effective in preserving COL2A1. These findings suggest that the combination therapy of Shinbaro and celecoxib may have a synergistic effect. However, further studies are necessary to confirm this potential and to elucidate the underlying mechanisms.

While this study demonstrated that the combined administration of Shinbaro and celecoxib effectively inhibited cartilage degradation in osteoarthritis, there are a few limitations to consider. Although the combination therapy showed a synergistic effect compared to monotherapy, the underlying mechanisms driving this synergy were not explored in this study. Additionally, while we examined the impact on cartilage degeneration through the expression levels of ECM components and ECM-degrading enzymes, other potential mechanisms, such as inflammation and apoptosis, which also contribute to cartilage degeneration, were not investigated. Further studies are needed to address these limitations and to provide a more comprehensive understanding of the therapeutic effects. Nevertheless, as the importance of integrative medicine in the combination of oriental and western medicine in the therapy and management of patients with osteoarthritis has been highlighted,37,38 this study has the potential to contribute to the advancement of integrative medicine in osteoarthritis.

5. Conclusions

In this study, we investigated the effects of the combined administration of Shinbaro and celecoxib on osteoarthritis, along with its underlying molecular mechanisms. Our findings suggest that combination therapy could be a potential treatment option with relatively few side effects for patients with osteoarthritis. We also hope that this study contributes to expanding therapeutic options tailored to the specific environment and condition of patients with osteoarthritis.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Footnotes

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.jtcme.2025.03.004.

Appendix A. Supplementary data

The following is the Supplementary data to this article.

Multimedia component 1
mmc1.docx (106.7KB, docx)

References

  • 1.Jiang Y. Osteoarthritis year in review 2021: biology. Osteoarthr Cartil. 2022;30(2):207–215. doi: 10.1016/j.joca.2021.11.009. [DOI] [PubMed] [Google Scholar]
  • 2.Abramoff B., Caldera F.E. Osteoarthritis: pathology, diagnosis, and treatment options. Med Clin. 2020;104(2):293–311. doi: 10.1016/j.mcna.2019.10.007. [DOI] [PubMed] [Google Scholar]
  • 3.Ambrose K.R., Huffman K.F., Odom E.L., Foster A.L., Turkas N., Callahan L.F. A public health approach to osteoarthritis in the United States. Osteoarthr Cartil. 2024;32(4):406–410. doi: 10.1016/j.joca.2023.12.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Domper Arnal M.J., Hijos-Mallada G., Lanas A. Gastrointestinal and cardiovascular adverse events associated with NSAIDs. Expet Opin Drug Saf. 2022;21(3):373–384. doi: 10.1080/14740338.2021.1965988. [DOI] [PubMed] [Google Scholar]
  • 5.Dogne J.M., Hanson J., Supuran C., Pratico D. Coxibs and cardiovascular side-effects: from light to shadow. Curr Pharm Des. 2006;12(8):971–975. doi: 10.2174/138161206776055949. [DOI] [PubMed] [Google Scholar]
  • 6.Carter G.T., Duong V., Ho S., Ngo K.C., Greer C.L., Weeks D.L. Side effects of commonly prescribed analgesic medications. Phys Med Rehabil Clin. 2014;25(2):457–470. doi: 10.1016/j.pmr.2014.01.007. [DOI] [PubMed] [Google Scholar]
  • 7.Stiller C.O., Hjemdahl P. Lessons from 20 years with COX-2 inhibitors: importance of dose-response considerations and fair play in comparative trials. J Intern Med. 2022;292(4):557–574. doi: 10.1111/joim.13505. [DOI] [PubMed] [Google Scholar]
  • 8.Lee S.Y., Kwon H.K., Lee S.M. SHINBARO, a new herbal medicine with multifunctional mechanism for joint disease: first therapeutic application for the treatment of osteoarthritis. Arch Pharm Res (Seoul) 2011;34(11):1773–1777. doi: 10.1007/s12272-011-1121-0. [DOI] [PubMed] [Google Scholar]
  • 9.Kim H.W., Kwon Y.B., Ham T.W., et al. The antinociceptive and anti-inflammatory effect of ethylacetate extracts from Bang-Poong (Radix ledebouriellae) on the Freund's adjuvant-induced arthritis in rats. J Vet Sci. 2002;3(4):343–349. [PubMed] [Google Scholar]
  • 10.An X., Wang J., Xu K., Zhao R.C., Su J. Perspectives on osteoarthritis treatment with mesenchymal stem cells and Radix Achyranthis bidentatae. Aging Dis. 2024;15(3):1029–1045. doi: 10.14336/AD.2023.0817. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Kim J.K., Park S.W., Kang J.W., et al. Effect of GCSB-5, a herbal formulation, on monosodium iodoacetate-induced osteoarthritis in rats. Evid Based Complement Alternat Med. 2012;2012 doi: 10.1155/2012/730907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Kim W.K., Chung H.J., Pyee Y., et al. Effects of intra-articular SHINBARO treatment on monosodium iodoacetate-induced osteoarthritis in rats. Chin Med. 2016;11:17. doi: 10.1186/s13020-016-0089-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ha C.W., Park Y.B., Kyung H.S., et al. Gastrointestinal safety and efficacy of long-term GCSB-5 use in patients with osteoarthritis: a 24-week, multicenter study. J Ethnopharmacol. 2016;189:310–318. doi: 10.1016/j.jep.2016.05.031. [DOI] [PubMed] [Google Scholar]
  • 14.Gosset M., Berenbaum F., Thirion S., Jacques C. Primary culture and phenotyping of murine chondrocytes. Nat Protoc. 2008;3(8):1253–1260. doi: 10.1038/nprot.2008.95. [DOI] [PubMed] [Google Scholar]
  • 15.Trifan O.C., Durham W.F., Salazar V.S., et al. Cyclooxygenase-2 inhibition with celecoxib enhances antitumor efficacy and reduces diarrhea side effect of CPT-11. Cancer Res. 2002;62(20):5778–5784. [PubMed] [Google Scholar]
  • 16.Fischer A.H., Jacobson K.A., Rose J., Zeller R. Hematoxylin and eosin staining of tissue and cell sections. CSH Protoc. 2008 doi: 10.1101/pdb.prot4986. pdb prot4986. [DOI] [PubMed] [Google Scholar]
  • 17.Glasson S.S., Chambers M.G., Van Den Berg W.B., Little C.B. The OARSI histopathology initiative - recommendations for histological assessments of osteoarthritis in the mouse. Osteoarthr Cartil. 2010;18(Suppl 3):S17–S23. doi: 10.1016/j.joca.2010.05.025. [DOI] [PubMed] [Google Scholar]
  • 18.Syggelos S.A., Aletras A.J., Smirlaki I., Skandalis S.S. Extracellular matrix degradation and tissue remodeling in periprosthetic loosening and osteolysis: focus on matrix metalloproteinases, their endogenous tissue inhibitors, and the proteasome. BioMed Res Int. 2013;2013 doi: 10.1155/2013/230805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Housmans B.A.C., Neefjes M., Surtel D.A.M., et al. Synovial fluid from end-stage osteoarthritis induces proliferation and fibrosis of articular chondrocytes via MAPK and RhoGTPase signaling. Osteoarthr Cartil. 2022;30(6):862–874. doi: 10.1016/j.joca.2021.12.015. [DOI] [PubMed] [Google Scholar]
  • 20.Thalhamer T., McGrath M.A., Harnett M.M. MAPKs and their relevance to arthritis and inflammation. Rheumatology. 2008;47(4):409–414. doi: 10.1093/rheumatology/kem297. [DOI] [PubMed] [Google Scholar]
  • 21.Puljak L., Marin A., Vrdoljak D., Markotic F., Utrobicic A., Tugwell P. Celecoxib for osteoarthritis. Cochrane Database Syst Rev. 2017;5(5) doi: 10.1002/14651858.CD009865.pub2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Martel-Pelletier J., Barr A.J., Cicuttini F.M., et al. Osteoarthritis. Nat Rev Dis Primers. 2016;2 doi: 10.1038/nrdp.2016.72. [DOI] [PubMed] [Google Scholar]
  • 23.Jang S., Lee K., Ju J. Recent updates of diagnosis, pathophysiology, and treatment on osteoarthritis of the knee. Int J Mol Sci. 2021;22(5):2619. doi: 10.3390/ijms22052619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Guilak F., Nims R.J., Dicks A., Wu C.-L., Meulenbelt I.J.M.B. Osteoarthritis as a disease of the cartilage pericellular matrix. Matrix Biol. 2018;71:40–50. doi: 10.1016/j.matbio.2018.05.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Hu Q., Mjijoms Ecker. Overview of MMP-13 as a promising target for the treatment of osteoarthritis. Int J Mol Sci. 2021;22(4):1742. doi: 10.3390/ijms22041742. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Glasson S.S., Askew R., Sheppard B., et al. Deletion of active ADAMTS5 prevents cartilage degradation in a murine model of osteoarthritis. Nature. 2005;434(7033):644–648. doi: 10.1038/nature03369. [DOI] [PubMed] [Google Scholar]
  • 27.Li T., Peng J., Li Q., Shu Y., Zhu P., Hao L. The mechanism and role of ADAMTS protein family in osteoarthritis. Biomolecules. 2022;12(7) doi: 10.3390/biom12070959. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Hoshi H., Akagi R., Yamaguchi S., et al. Effect of inhibiting MMP13 and ADAMTS5 by intra-articular injection of small interfering RNA in a surgically induced osteoarthritis model of mice. Cell Tissue Res. 2017;368(2):379–387. doi: 10.1007/s00441-016-2563-y. [DOI] [PubMed] [Google Scholar]
  • 29.van der Kraan P.M. Osteoarthritis year 2012 in review: biology. Osteoarthr Cartil. 2012;20(12):1447–1450. doi: 10.1016/j.joca.2012.07.010. [DOI] [PubMed] [Google Scholar]
  • 30.Lu J., Miao Z., Jiang Y., et al. Chrysophanol prevents IL-1beta-Induced inflammation and ECM degradation in osteoarthritis via the Sirt6/NF-kappaB and Nrf 2/NF-kappaB axis. Biochem Pharmacol. 2023;208 doi: 10.1016/j.bcp.2022.115402. [DOI] [PubMed] [Google Scholar]
  • 31.Lu G., Li L., Wang B., Kuang L. LINC00623/miR-101/HRAS axis modulates IL-1beta-mediated ECM degradation, apoptosis and senescence of osteoarthritis chondrocytes. Aging (Albany NY) 2020;12(4):3218–3237. doi: 10.18632/aging.102801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Berenbaum F. Signaling transduction: target in osteoarthritis. Curr Opin Rheumatol. 2004;16(5):616–622. doi: 10.1097/01.bor.0000133663.37352.4a. [DOI] [PubMed] [Google Scholar]
  • 33.Lu J., Zhang H., Pan J., et al. Fargesin ameliorates osteoarthritis via macrophage reprogramming by downregulating MAPK and NF-kappaB pathways. Arthritis Res Ther. 2021;23(1):142. doi: 10.1186/s13075-021-02512-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Saklatvala J. Inflammatory signaling in cartilage: MAPK and NF-kappaB pathways in chondrocytes and the use of inhibitors for research into pathogenesis and therapy of osteoarthritis. Curr Drug Targets. 2007;8(2):305–313. doi: 10.2174/138945007779940115. [DOI] [PubMed] [Google Scholar]
  • 35.Zhou F., Mei J., Han X., et al. Kinsenoside attenuates osteoarthritis by repolarizing macrophages through inactivating NF-kappaB/MAPK signaling and protecting chondrocytes. Acta Pharm Sin B. 2019;9(5):973–985. doi: 10.1016/j.apsb.2019.01.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Bang J., Kim G., Young Park S., Jung H.R., Kim S.H., Kim J.M. GCSB-5 regulates inflammatory arthritis and pain by modulating the mitogen-activated protein kinase signaling pathway in a murine model of rheumatoid arthritis. Arch Rheumatol. 2023;38(4):566–578. doi: 10.46497/ArchRheumatol.2023.9643. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Jang A., Lee J., Donahue C., et al. Proceedings of the 4th Annual Jaseng Academic Conference. 2023. Perspectives and ideas to advance integrative medicine and Healthcare. [Google Scholar]
  • 38.Wang X.-F., Zuo J.-L., Li L.-J., et al. Characteristics and quality of traditional Chinese therapies and integrative medicine clinical practice guidelines for musculoskeletal disorders published in mainland China. Perspect Integr Med. 2024;3(1):7–17. doi: 10.56986/pim.2024.02.002. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Multimedia component 1
mmc1.docx (106.7KB, docx)

Articles from Journal of Traditional and Complementary Medicine are provided here courtesy of Elsevier

RESOURCES