An electrochemical aptasensor for determining fumonisin B₁: A signal-on mechanism based on target-induced conformational switching

Abstract

Fumonisin B₁ (FB₁) is a highly toxic mycotoxin commonly found in maize and other staple crops, posing significant threats to food safety and public health. There is an urgent need for the development of portable, on-site detection technologies to monitor contamination in agricultural environments and supply chains. In this study, we developed a simple, cost-effective electrochemical aptasensor for sensitive FB₁ detection. Molecular docking analyses and secondary structure predictions were employed to elucidate the signal transduction mechanism, suggesting that the sensor operates via a signal-on mechanism driven by target-induced conformational changes in a specific aptamer. The sensor fabrication involves a straightforward two-step immobilization of a ferrocene-labeled aptamer onto a gold nanoparticle-modified electrode, enabling rapid preparation without complex instrumentation. Upon FB₁ binding, the aptamer undergoes a structural shift that brings the redox tag close to the electrode surface, producing an enhanced current signal. The aptasensor exhibits excellent analytical performance, including a low detection limit of 1.58 ng/mL, a broad linear range of 2.5–175 ng/mL, and high selectivity against co-occurring mycotoxins. Application to real fungal-contaminated samples showed strong agreement with LC–MS results. These attributes, combined with simple and rapid fabrication, position this electrochemical aptasensor as a promising tool for in-field mycotoxin monitoring, fulfilling critical needs in food safety and environmental analysis.

Graphical abstract

Highlights

• •Development of a rapid, low-cost electrochemical aptasensor for the detection of fumonisin B₁, fabricated in just a few minutes without complicated processes.
• •Using molecular docking studies and secondary structure predictions to enhance the understanding of the signal transduction mechanism.
• •High analytical performance (LOD: 1.58 ng/mL) and excellent selectivity against co-occurring mycotoxins, validated with real fungal-contaminated samples.

1. Introduction

Fumonisin B₁ (FB₁), one of the most common mycotoxins produced primarily by Fusarium species, poses a significant threat to global agricultural production and food safety. (Chen et al., 2021; Marasas, 2001) Its prevalence as a contaminant in maize and other staple crops is a significant concern, (Domijan et al., 2005) resulting in substantial economic losses due to crop damage and decreased market value. Ingesting food contaminated with FB₁ can lead to a range of adverse health effects, including hepatotoxicity, nephrotoxicity, and carcinogenic effects. (Marin et al., 2013; Obafemi et al., 2025; Stockmann-Juvala & Savolainen, 2008) Due to its widespread occurrence and high toxicity, reliable and accessible detection and quantification of FB₁ are essential for ensuring food safety, protecting public health, and regulating agricultural products.

Conventional analytical techniques for FB₁ detection, such as high-performance liquid chromatography (HPLC), (Kong et al., 2013) liquid chromatography-mass spectrometry (LC-MS), (Shephard et al., 1990) and enzyme-linked immunosorbent assays (ELISA), (Batrinou et al., 2020) provide high sensitivity and specificity but often require complex sample preparation, expensive instrumentation, and trained personnel. (Vidal et al., 2013) The inherent delays and time consumption associated with laboratory-based methods limit their applicability in resource-constrained settings and for rapid in-field analysis, thereby preventing contaminated products from entering the food chain. (Singh & Mehta, 2020; Suo et al., 2023)

Electrochemical biosensors utilize the high sensitivity, simplicity, rapid detection capabilities, and cost-effectiveness of electrochemical transducers, in conjunction with the intrinsic specificity of bioreceptors, to facilitate the detection and quantification of target biomarkers. (Hosseinikebria et al., 2025; Vidal et al., 2013) Furthermore, electrochemical techniques can be easily miniaturized and integrated into portable systems, making them ideal alternatives to conventional laboratory-based methods for in-field monitoring of food safety and agricultural products. (Villalonga et al., 2022)

Aptamers are single-stranded oligonucleotides selected for their high affinity and specificity toward target molecules. (Berezovski et al., 2008) An aptamer molecule is created through an in vitro selection process using libraries of synthetic oligonucleotides, a method known as SELEX (systematic evolution of ligands by exponential enrichment). (Darmostuk et al., 2015) Aptamers offer several advantages, such as low cost, chemical stability, and ease of synthesis and modification, making them ideal biorecognition elements for a variety of biosensing platforms. (Feng et al., 2014; Gu & Kim, 2014; Yousefi et al., 2019) Aptasensors can also be easily integrated into electrochemical transducers by directly immobilizing aptamers on electrode surfaces, allowing for efficient signal transduction. (Hianik & Wang, 2009) In the case of FB₁, several DNA aptamers have been reported, varying in sequence lengths, secondary structures, and binding affinities. (Chen et al., 2014;McKeague et al., 2010; Mirón-Mérida et al., 2021) These differences reflect distinct selection strategies and assay formats. However, the literature on the FB₁ aptamer has not been consistently addressed; some studies consider a single aptamer sequence or truncated minimers as independent recognition elements, while others focus on limited sensing modalities. (McKeague et al., 2010; Mirón-Mérida et al., 2021) Notably, a comprehensive assessment of reported FB₁ aptamer-based biosensors indicates that the majority of such platforms have been developed only after 2016, (Mirón-Mérida et al., 2021) highlighting the recent rapid expansion of this field and emphasizing the need for ongoing optimization of aptamer immobilization strategies and signal transduction mechanisms.

Molecular docking and computational modeling have become invaluable tools for understanding the interactions between aptamers and their targets at the molecular level. (Meng et al., 2011) These in silico approaches provide mechanistic insights into binding sites, affinities, and conformational changes, which can be essential for the rational design and optimization of aptasensors. (Buglak et al., 2020; Navien et al., 2021) Employing molecular docking as a decision-making tool accelerates the development of biointerfaces with enhanced specificity and sensitivity, ultimately improving biosensor performance and reliability. (Khoshbin et al., 2021)

The integration of aptamers with electrochemical transducers offers distinct advantages, including simple instrumentation, high sensitivity, and compatibility with low-cost, disposable, and mass-producible electrodes, making electrochemical aptasensors ideal for portable mycotoxin detection. Moreover, incorporating in silico analyses can provide valuable insights into aptamer–target interactions, facilitating rational sensor design and enabling the simulation of molecular recognition processes prior to experimental validation, while minimizing trial-and-error, development time, and overall costs.

In this study, we present a simple and cost-effective electrochemical aptasensor for FB₁ detection, featuring clearly defined design and mechanistic characteristics. A key innovation of this work lies in the combined experimental and in silico investigation of the signal transduction mechanism, wherein molecular docking and secondary structure analyses support a target-induced, signal-on sensing behavior of the FB₁ aptamer. Additionally, the aptasensor utilizes a rapid and straightforward two-step immobilization strategy that allows for sensor fabrication within minutes, setting it apart from more complex multistep approaches reported previously. Together, the rational mechanism-oriented design and the simplified fabrication process result in a sensitive, selective, and low-cost platform, highlighting its potential for in-field mycotoxin monitoring in food safety and environmental applications.

2. Experimental

2.1. Reagents and chemicals

The FB₁-specific aptamer, featuring phosphorothioate modifications at the 5′ end and a ferrocene (Fc) tag at the 3′ end, was synthesized and HPLC-purified by Shanghai Generay Biotech Co., Ltd. (China). The detailed sequences and modifications are provided in Table 1. Fumonisin B₁ (CAS Number: 116355–83-0) was obtained from AG Scientific, zearalenone (CAS Number: 17924–92-4) from ChemFaces, HT-2 toxin (CAS Number: 26934–87-2), and beauvericin (BEA, CAS Number: 26048–05-5) from Sigma-Aldrich. Potassium ferricyanide ([Fe (CN)₆]³⁻), potassium ferrocyanide ([Fe(CN)₆]⁴⁻), hydrogen tetrachloroaurate(III) trihydrate (HAuCl₄·3H₂O), trisodium citrate, sodium dodecyl sulfate (SDS), and phosphate-buffered saline (PBS, 10 mM, pH 7.4) were purchased from Sigma-Aldrich or Merck. Ultrapure water (18 MΩ·cm) was used for all solution preparations. All chemicals were of analytical grade and used as received without further purification.

Table 1.

FB₁ aptamer sequence designed in this study.

Sequences and modifications (from 5′ to 3′)

A*A*A*AAAAAAATCGCATTACCTTATACCAGCTTATTCAATTACGTCTGCACATACCAGCTTATTCAATTAA-FC

Phosphorothioate modification is denoted by “*”.

FC: ferrocene tag.

2.2. Apparatus

Cyclic voltammetry (CV) and differential pulse voltammetry (DPV) were conducted using an Autolab PGSTAT204 (Utrecht, The Netherlands) controlled by NOVA software version 2.1.6. Electrochemical impedance spectroscopy (EIS) was performed with a Zahner PP201 potentiostat (Zahner-Elektrik, Germany). Scanning electron microscopy (SEM) images were obtained using an FEI Model Quanta 200. LC–MS analysis was performed using a Shimadzu LCMS 2010 A system (experimental details are available in the Supporting Information). The PCR amplifications were performed using a Bio-Rad Gradient Thermal Cycler (Bio-Rad, USA). All electrochemical experiments employed a conventional three-electrode system consisting of a gold working electrode (diameter: 2 mm), a platinum wire counter electrode, and an Ag/AgCl reference electrode (3 M KCl).

2.3. Preparation of FB₁ aptasensor

The working electrode was functionalized using a rapid two-step protocol previously developed by Nikbin et al. (Nikbin et al., 2024) First, the electrode was polished with a 0.5 μm Al₂O₃ suspension, rinsed with deionized water, briefly dried, and then modified by drop-casting 1–2 μL of a gelatinous AuNP pellet onto its surface. The electrode was allowed to dry at room temperature for 5 min (or more quickly using a hair dryer) before being gently washed with deionized water. In the second step, the FB₁ aptamer was immobilized using the low-pH loading method. (Karami & Hasani, 2023) A solution containing 1 μM FB₁ aptamer and 300 mM NaCl was acidified with 500 mM citrate buffer (pH 3.0), and 2–3 μL of this mixture was dropped onto the AuNP-modified electrode. After a 5-min incubation, the electrode was rinsed with distilled water to remove any excess FB₁ aptamer. Detailed experimental procedures for the synthesis and characterization of AuNPs are available in the Supplementary Information.

2.4. Electrochemical measurement conditions

All electrochemical experiments employed a conventional three-electrode system consisting of a gold working electrode (diameter: 2 mm), a platinum wire counter electrode, and an Ag/AgCl reference electrode (3 M KCl). CV experiments were performed in a 5.0 mM [Fe(CN)₆]³⁻/⁴⁻ solution prepared in 0.1 M KCl, with the potential scanned from 0 to 600 mV at a scan rate of 100 mV s⁻¹. DPV measurements were recorded in 5.0 mM [Fe(CN)₆]³⁻/⁴⁻ containing 0.1 M KCl by anodically scanning the potential from 0 to 500 mV at a scan rate of 50 mV s⁻¹. EIS measurements were conducted in 2.5 mM [Fe(CN)₆]³⁻/⁴⁻ solution with 0.1 M KCl, applying an AC perturbation of 5 mV over a frequency range from 10 mHz to 10 kHz.

2.5. Electrochemical determination of FB₁

To facilitate effective interaction between the aptamer-functionalized electrode and FB₁, an immersion-based incubation method was utilized. The prepared aptasensor was immersed in a 5 mL cryotube containing PBS buffer (10 mM, pH 7.4) supplemented with 20 mM MgCl₂ and varying concentrations of FB₁. Incubation was conducted at 45 °C for 15 min to allow sufficient binding between the mycotoxin and the aptamer. Following incubation, the electrode was gently rinsed and subsequently subjected to DPV measurements. The change in peak current signal (ΔIₚ) was calculated as the difference between the DPV peak currents recorded prior to and subsequent to incubation with FB₁.

2.6. Secondary structure prediction and molecular docking studies

The secondary structure of the FB₁-specific aptamer was predicted using the 3dRNA/DNA web server (http://biophy.hust.edu.cn/), which generates potential folding conformations based on the input nucleotide sequence. The thermodynamic stability of these structures was evaluated by calculating their free energies (ΔG) using the NUPACK web application, with the dot-bracket notation of each structure as input. For molecular docking, the three-dimensional (3D) structure of the aptamer in the signal-on conformation was obtained from the 3dRNA/DNA server in PDB format. The structure was prepared for docking by adding polar hydrogens and assigning Kollman charges using AutoDockTools (MGL Tools 1.5.7), and then saved as a PDBQT file. The ligand structure of FB₁ (PubChem CID: 2733487) was downloaded in SDF format and converted to an energy-minimized 3D PDB file using Avogadro software. After adding polar hydrogens and Gasteiger charges, the ligand was also saved as a PDBQT file. Blind docking was initially performed using AutoDock Vina to identify potential binding sites across the entire aptamer surface. The most favorable binding pocket, located near the nucleotides DA28, DG29, DC30, DT31, DT32, DC55, and DA56, was selected for focused docking with a refined grid box (22 × 25 × 23 Å, grid spacing 1.0 Å). Flexible docking was enabled by allowing torsional rotation of nitrogen atoms in the nucleobases to better simulate natural nucleotide flexibility. Binding poses and affinities were analyzed to elucidate the molecular interactions responsible for FB₁-induced conformational changes, which underlie the signal-on mechanism of the aptasensor.

2.7. Real sample preparation and analysis

Twelve weed samples, identified as potential hosts for Fusarium species, were collected from various regions and used for fungal isolation by incubating them on sterilized culture media. Each sample was cultured on sterilized rice medium and incubated at 25 °C in the dark for one week to encourage the growth of potential fumonisin-producing fungi. Among these samples, four exhibited visible fungal colonies indicative of Fusarium infection. The isolates were further analyzed by PCR using specific primers to detect the fumonisin biosynthesis genes, with amplification confirmed through gel electrophoresis. After confirming fungal growth, the cultures were dried, finely ground, and subjected to mycotoxin extraction to isolate FB₁. The purified extracts were then quantitatively analyzed using LC–MS. Detailed methodologies for PCR, mycotoxin extraction, and LC–MS analysis are provided in the Supporting Information.

3. Results and discussions

3.1. Design of aptamer for FB₁ recognition at the interface

Fortunately, significant efforts have been dedicated to identifying aptamer candidates that exhibit high specificity and binding affinity for FB₁. (Mirón-Mérida et al., 2021) In this study, we selected an aptamer sequence for designing molecular recognition at the electrode interface, which was previously validated for binding to FB₁ with low complexity and high affinity. (McKeague et al., 2010) Additionally, this sequence was adjusted by introducing minor nucleotide and chemical modifications required for immobilization on the electrode surface and for generating an electrochemical signal in the presence of FB₁. The designed aptamer consists of two functional regions: (1) a 60-nucleotide (60-nt) recognition sequence derived from the original FB₁-binding aptamer (McKeague et al., 2010) for target-specific interaction, and (2) an 8-nt polyadenine (poly-A) spacer that improves the spatial accessibility of the recognition region and enables its immobilization on the electrode surface (Table 1). The poly-A moiety is positioned at the 5′-terminus and includes phosphorothioate (PS) modifications at the first three phosphate groups, serving as an anchoring agent. PS linkage, which is not prone to disulfide formation, provides a cost-effective alternative to thiol modification, enabling rapid and stable DNA immobilization without the need for pretreatment. (Karami et al., 2021; Karami & Hasani, 2023; Nikbin et al., 2024) In addition, a ferrocene (Fc) tag is added to the 3′-terminus to act as an electroactive reporter, enabling electrochemical signal transduction upon FB₁ recognition.

3.2. Preparation of electrochemical aptasensor for FB₁

Our strategy here relies on molecular recognition at the electrode–solution interface. Therefore, the first step in preparing the FB1 biosensor is to immobilize a dense layer of aptamer on the electrode surface. A simple two-step protocol, previously developed by Nikbin et al. (Nikbin et al., 2024), was used to functionalize the electrode surfaces with the aptamer, completing the process in just a few minutes. Our strategy here relies on molecular recognition at the electrode–solution interface. Therefore, the first step in preparing the FB1 biosensor is to immobilize a dense layer of aptamer on the electrode surface. A simple two-step protocol, previously developed by our group, (Nikbin et al., 2024) was used to functionalize the electrode surfaces with the aptamer, completing the process in just a few minutes. In the first step, a layer of gold nanoparticles was deposited on the electrode surface by drop-casting to enhance the surface area for DNA immobilization. In the next step, the low-pH loading approach was employed to attachment of a dense layer of PS-DNA aptamers on the AuNP-modified electrodes. When the poly-A part is positioned as a spacer between the anchoring agent and the hybridization block at one end of the DNA (such as the designed aptamer), a parallel poly-A duplex (A-motif) can form between two parallel poly-A blocks, resulting in a T-shaped structure under acidic conditions. (Huang et al., 2016) The duplex region within the A-motif is positively charged, allowing the PS-DNA to approach the negatively charged gold surface. (Karami & Hasani, 2023) The PS groups in the A-motif structure are oriented outward from the PS backbone, making them well-suited for attachment to the AuNPs on the electrode. Following a rinse of the electrode surface with deionized water, the ambient pH returned to neutral, causing the poly A duplexes to dissociate into single-stranded PS-DANs. For a visual representation of the low-pH loading mechanism proposed for PS-DNA attachment to AuNPs, a schematic is provided in the Supplementary Materials (Fig. S2).

Morphological characterization confirmed the successful deposition of a thin layer of AuNPs on the gold electrode (AuE) surface (Fig. 1a). The SEM image of the electrode surface after AuNP deposition (AuE@AuNP) displayed a dense and uniform distribution of nanoparticles, in contrast to the smooth morphology of the bare AuE. The stepwise preparation of the aptasensor and target recognition were systematically evaluated using electrochemical techniques (Fig. 1b-c). As shown in Fig. 1b, the bare AuE (curve I) exhibited reversible redox peaks for the [Fe(CN)₆]³⁻/⁴⁻ probe with a peak-to-peak separation (ΔEp) of approximately 100 mV, while the AuE@AuNP (curve II) demonstrated a reduced ΔEp of about 80 mV and increased peak currents, attributed to enhanced electron transfer due to the surface area-to-volume ratio of AuNPs. The immobilization of aptamers on AuE@AuNP (AuE@AuNP/Aptamer, curve III) resulted in surface passivation, significantly suppressing the redox peaks of [Fe(CN)₆]³⁻/⁴⁻. This suppression occurred due to the inhibition of electron transfer caused by the insulating aptamer layer. In contrast, incubation with FB₁ (AuE@AuNP/Aptamer + FB₁, curve IV) generated a distinct oxidative peak at 420 mV (Fig. 1b, curve IV), which can be considered an electrochemical characteristic of the FC tag. Furthermore, the DPV responses confirmed the CV measurements. Fig. 1c corroborated the enhanced electron transfer for ferricyanide oxidation on the bare AuE after the deposition of AuNPs. Additionally, there was a dramatic decrease in the ferricyanide ([Fe(CN)₆]⁴⁻) oxidation peak current after the attachment of the aptamer. A low anodic peak current was observed at a more positive potential (approximately 350 mV), attributed to the oxidation of the FC tag.

Fig. 1.

Characterization of the aptasensor. (a) SEM images of the bare gold electrode (II) before and (II) after AuNP deposition. (b) Cyclic voltammograms (in 5.0 mM [Fe(CN)₆]³⁻/⁴⁻, 0.1 M KCl), (c) DPV voltammograms (in 5.0 mM [Fe(CN)₆]³⁻/⁴⁻, 0.1 M KCl), and (d) Nyquist plots illustrating the electrode modification steps. The equivalent electrical circuit model is presented above the plot (solution resistance, R_s, in series with a parallel combination of a constant phase element, CPE, and charge-transfer resistance, R_p, followed by a Warburg diffusion element, Z_w). Roman numerals denoting: (I) bare gold electrode (AuE), (II) AuNPs-modified electrode (AuE@AuNP), (III) AuE@AuNP electrode functionalized with aptamer (AuE@AuNP/Aptamer), and (IV) AuE@AuNP/Aptamer after FB₁ incubation. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

The Nyquist plots in Fig. 1d clearly indicate distinct interfacial changes. The bare AuE and AuE@AuNP (curves I and II) show two straight lines with varying slopes, indicating very low charge transfer resistance (R_ct) and efficient electron transfer. In contrast, aptamer immobilization (curve III) leads to a significantly enlarged semicircle diameter and increased R_ct, confirming aptamer-induced surface blocking. One of the most notable features of the Nyquist plots is the significant reduction in the semicircle diameter after incubating AuE@AuNP/Aptamer with FB₁ (curve IV). This reduction can be attributed to FB₁-induced conformational changes in the aptamer, which reposition the ferrocene (FC) tag closer to the AuNP surface, thereby enabling electron transfer from the FC probe to the AuE@AuNP surface. The results from the CV, DPV, and EIS measurements confirmed the successful fabrication of the aptasensor for the electrochemical detection of FB₁.

3.3. Evaluation of FB₁-induced conformational changes in the aptamer by molecular docking

Molecular modeling tools enable the prediction of optimal binding sites between an aptamer and its target ligand. (Lee et al., 2023) Therefore, the binding affinity and binding sites between FB₁ and the aptamer were analyzed computationally using molecular docking to elucidate the mechanism of conformational signal transduction. Moreover, predicting the secondary structures of the aptamer can provide critical insights into the conformational changes induced by the ligand. To begin, we used the 3dRNA/DNA web server (available at http://biophy.hust.edu.cn/) (Wang et al., 2019; Wang & Xiao, 2017) to predict potential secondary structures of the aptamer.

The aptamer is assumed to be anchored to the electrode via its 5′-end, with a ferrocene (Fc) tag attached to the free 3′-end. Of the predicted structures, two aptamer structures exhibited distinct configurations associated with signal-off and signal-on states. The aptamer structure in Fig. 2a illustrates a partially unfolded conformation with ineffective intramolecular base pairing, causing the Fc tag to remain distal from the electrode surface and resulting in the signal-off state. In contrast, the aptamer structure shown in Fig. 2a features a folded pseudo-hairpin conformation that positions the Fc tag close to the electrode. This proximity enables efficient electron transfer, corresponding to the signal-on state.

Fig. 2.

Secondary structures of aptamer conformational states predicted by the 3dRNA/DNA web server. (a) Unfolded “signal-off” state (ΔG = −1.12 kcal/mol) and (b) folded “signal-on” pseudo-hairpin (ΔG = −1.41 kcal/mol).

To evaluate thermodynamic stability, the free energy (ΔG) of these secondary structures was calculated by inputting their sequences in dot-bracket format on the Utilities page of the NUPACK web application. The results indicated that the signal-on state exhibits a lower free energy (ΔG = −1.41 kcal/mol) compared to the signal-off state (ΔG = −1.12 kcal/mol), corresponding to a stability advantage of −0.29 kcal/mol and suggesting a thermodynamic preference for the signal-on conformation. Despite the inherent preference for the folded signal-on conformation, electrochemical measurements conducted in the absence of FB₁ showed negligible background current (Fig. 1a and b, curve III). This discrepancy suggests that, under non-target conditions, the aptamers likely adopt the signal-off state due to steric hindrance caused by the dense attachment of aptamers on the electrode surface. Such tightly interwoven attachments can restrict the backbone flexibility of the vertically attached aptamers, stabilizing the unfolded conformation (signal-off state), even though it is thermodynamically less favorable.

It can be hypothesized that FB₁ binding provides an additional energy differential that helps to overcome this steric constraint. To validate this, molecular docking simulations were conducted using AutoDock Vina to evaluate the molecular interactions and binding properties between FB₁ and the aptamer.The three-dimensional (3D) aptamer structure in the signal-on conformation, previously predicted by the 3dRNA/DNA web server, was obtained in PDB format. Using MGL Tools 1.5.7, polar hydrogen atoms were added, and Kollman charges were assigned to optimize the electrostatic potential of the aptamer. The processed structure was then saved as a PDBQT file to be used as the receptor.

The 2D structure of FB₁ (PubChem CID: 2733487) was obtained in SDF format and converted into an energy-minimized 3D structure in PDB format using Avogadro software. The resulting PDB file was imported into MGL Tools to add polar hydrogens and Gasteiger charges and then saved in PDBQT format as the ligand.

Initial blind docking was conducted with a large grid box encompassing the entire aptamer to identify potential binding sites. The optimal binding site, located near nucleotides DA28, DG29, DC30, DT31, DT32, DC55, and DA56 (Fig. 3a), was selected for further refinement. A focused grid box with dimensions 22 × 25 × 23 (grid spacing = 1.0 Å) and centered at x = −21.608, y = −12.119, and z = 0.989 was defined to enhance docking accuracy. Flexible docking was implemented by allowing torsional rotations in the nitrogen atoms (N1 for cytosine and thymine, N9 for adenine and guanine) in nucleobases (linked to the C1’ of the pentose in the closed-ring structure) to better mimic natural nucleotide flexibility. (See Fig. 4.)

Fig. 3.

Molecular docking simulations of the FB₁-aptamer recognition complex. An enlarged view of (a) the binding site (nucleotides DA28, DG29, DC30, DT31, DT32, DC55, and DA56) and (b) the binding pocket and H-bonding interactions between FB₁ and specific bases in the aptamer binding site (DA28:H61 (2.1 Å), DC30:H42 (2.3 Å), and DT31:H3 (2.0 Å)). (c) AutoDock Vina poses of the FB₁-aptamer complex (binding affinity: −6.3 kcal/mol).

Fig. 4.

(a) DPV response of the electrochemical aptasensor to varying concentrations of FB₁. (b) Relationship between ΔI_p and concentrations of FB₁.

The molecular docking results showed a stable complex formation between FB₁ and the nucleotide residues of the aptamer, with a binding affinity of −6.3 kcal/mol, confirming the specificity of the interaction (Fig. 3b). As shown in Fig. 3d, three hydrogen bonds were identified: DA28:H61 (2.1 Å), DC30:H42 (2.3 Å), and DT31:H3 (2.0 Å), which stabilize the aptamer-FB₁ interactions. The strong binding affinity and specific interactions align with the hypothesis that FB₁ binding stabilizes the signal-on conformation (pseudo-hairpin) by overcoming steric hindrance from dense aptamer immobilization on the electrode. For the parental aptamer sequence without our terminal modifications, a dissociation constant (K_d) of approximately 100 nM has been previously reported, (McKeague et al., 2010) corresponding to a standard binding free energy of ΔG° ≈ −9.5 kcal/mol (calculated using the standard thermodynamic relationship ΔG° = RTlnK_d at 298 K). By contrast, molecular docking here estimated ΔG° ≈ −6.3 kcal/mol for the aptamer–FB₁ interaction. This difference (∼3 kcal/mol) is likely due to the inherent limitations of molecular docking compared to actual experimental conditions, as well as some modifications in the sequence of our aptamer. Therefore, the docking results (including the computed ΔG°) should be considered qualitative supportive evidence rather than precise quantitative predictions of affinity under laboratory conditions.

3.4. Optimization of aptasensor response conditions

After characterizing the aptasensor and elucidating the signal generation mechanism, the conditions for signal response were optimized. To ensure complete contact between the aptasensor interface and the toxin-containing buffer, an immersion-based incubation method was employed for the FB₁ recognition process. Therefore, two critical incubation-dependent parameters—temperature and time—were systematically assessed to optimize the aptasensor response.

All experiments were performed using 100 ng/mL FB₁ standard in PBS buffer (10 mM, pH 7.4) containing 20 mM MgCl₂. The signal metric parameter, ${\mathrm{\Delta I}}_{\mathrm{P}}$, was calculated as the difference between the peak current in the DPV voltammograms before incubation (blank) and after incubation: ${\mathrm{\Delta I}}_{\mathrm{P}}$=${\mathrm{I}}_{\mathrm{P}}$(FB₁) – ${\mathrm{I}}_{\mathrm{P}}$(Blank). For temperature optimization, ΔIₚ was measured at various temperatures (25–55 °C) during a fixed 20-min incubation period (Fig. S3a). The ${\mathrm{\Delta I}}_{\mathrm{P}}$ response increased from 1.2 μA at 25 °C to a maximum of approximately 2.5 μA at 45 °C; however, incubation temperatures above 45 °C significantly reduced the signal. Consequently, 45 °C was chosen as the optimal incubation temperature, followed by systematic optimization of the incubation time over a 5–30 min range. As shown in Fig. S3b, the ${\mathrm{\Delta I}}_{\mathrm{P}}$reached saturation at 15 min, with no significant increase occurring thereafter. This indicates that complete target binding equilibrium was achieved within the first 15 min. Therefore, 45 °C and 25 min were selected as the optimal incubation conditions to maximize signal generation, ensuring efficient target binding while minimizing the risk of aptamer denaturation. Representative DPV voltammograms demonstrating the aptasensor response before (Blank) and after incubation with 100 ng/mL FB₁ under optimized conditions are presented in Fig. S3c. A substantial current increase from approximately 0.6 μA (Blank) to approximately 3.2 μA after FB₁ binding directly indicates the target-induced conformational switching to the signal-on state under these conditions.

3.5. Evaluation of aptasensor performance: Sensitivity, real sample analysis, and cross-reactivity

To assess the analytical performance of the aptasensor, DPV voltammograms were recorded for serial dilutions of FB₁ standard solutions, ranging from 210 ng/mL to 0.5 ng/mL (Fig. 5a). As shown in the inset of Fig. 5a, the ΔIₚ parameter and concentration exhibited a linear relationship (R² = 0.994) within the range of 2.5–175 ng/mL, as described by the following equation:

$$\left(\mathrm{\Delta }\right){\mathrm{I}}_{\mathrm{P}}=1.99\mathrm{x}{10}^{-8}\left[\mathrm{FB}₁\right]+1.23\mathrm{x}{10}^{-8}$$

where [FB₁] is in μg/mL. The limit of detection (LOD) was established at 1.58 ng/mL, calculated using a formula based on the standard deviation of the response and the slope of a calibration curve (Taverniers et al., 2004), given by:

$$\mathrm{LOD}=3\times {\mathrm{S}}_{\mathrm{res}}/\mathrm{m}$$

where S_res is the standard deviation of the response and m is the slope of the calibration curve. This calibration curve, with its acceptable sensitivity and linear range, can provide a practical platform for the reliable quantification of FB₁ levels in real samples.

Fig. 5.

Cross-reactivity analysis of the electrochemical aptasensor for FB₁ and non-target mycotoxins (HT-2, ZEA, and BEA). The incubation process was conducted at a concentration of 100 ng/mL for both FB₁ and the non-target mycotoxins. Error bars represent the standard deviation (n = 3).

To validate the aptasensor's performance with real samples, twelve weed specimens were analyzed to identify potential hosts of fumonisin-producing fungi. The specimens were incubated on culture media for seven days at 25 °C in the dark. Initial assessments of fungal growth, based on macroscopic features (such as colony colour and texture) and microscopic characteristics (including the structure of conidiophores, conidiogenous cells, and conidia), provided evidence of a probable Fusarium infection in four of the tested samples (listed in Table S1). Subsequent PCR amplification of the fumonisin synthase gene definitively confirmed the presence of FB₁-producing Fusarium strains in these specimens (Fig. S4).

After confirming the growth of Fusarium, potential FB₁ was extracted from the cultured samples and analyzed using the LC–MS technique, which is considered a standard method for identifying and quantifying mycotoxins (Li et al., 2013). The mass spectrum of the FB₁ standard (Fig. S5) exhibited a distinct ion signal at m/z 722, corresponding to the characteristic protonated molecule of FB₁. (Churchwell et al., 1997; Gazzotti et al., 2009; Li et al., 2012) This ion signal was consistently observed in the mass spectra of both the standard and the Fusarium-cultured samples, confirming the presence of FB₁. The LC chromatograms (Fig. S6) exhibited a retention time of 2.57 min for the protonated molecular ion of FB₁. To enable quantification, a calibration curve was constructed using standard FB₁ solutions by plotting the peak area at the retention time of 2.57 min against FB₁ concentrations. The FB₁ concentrations obtained via LC–MS were subsequently regarded as accepted values for comparison with the results obtained from the developed aptasensor method (Table 2). The LC–MS quantification detected high levels of FB₁ in two samples, measuring 335.5 and 387.8 ng/mL, which exceeded the aptasensor's linear detection range of 2.5–175 ng/mL. Consequently, a threefold dilution was necessary before analysis. Table 2 displays the quantified levels of FB₁ in the real samples as measured by the developed electrochemical aptasensor. These results showed good agreement with the reference concentrations obtained by LC–MS, confirming the accuracy and reliability of the aptasensor for analyzing real samples.

Table 2.

Real sample analysis using the electrochemical aptasensor and LC–MS. (DF: Dilution factor).

Sample No.	LC–MS technique		Aptasensor		Erorr %
	Area	FB₁ Conc. (ng/mL)	DF	FB₁ Conc. (ng/mL)
1	261,353	147.3	1	152.3	3.39
2	179,893	103.7	1	99.6	3.95
3	710,592	387.8	3	125.2	3.14
4	612,911	335.5	3	114.6	2.47

The specificity of the developed aptasensor was examined by analyzing its response to mycotoxins produced by Fusarium species that may co-occur with FB₁. HT-2 toxin, zearalenone (ZEA), and beauvericin (BEA) were selected for the interference study because they are Fusarium-associated mycotoxins that naturally occur alongside FB₁ in contaminated cereal and feed samples, representing realistic potential interferents in food safety analysis. (Jestoi, 2008; Logrieco et al., 2003; Munkvold et al., 2021) The aptasensor was incubated individually in buffer solutions containing each non-target mycotoxin (HT-2, ZEA, and BEA), and the DPV response was recorded both before and after incubation. Fig. 6 displays bar graphs representing the mean I_p values for each mycotoxin, measured before (Blank) and after incubation (Target mycotoxin). The results clearly demonstrate that there is no significant difference in the DPV peak current between any of the non-target mycotoxins and their respective blanks. This finding indicates that the tested mycotoxins do not interfere with signal generation and confirms the aptasensor's high specificity for FB₁, even in the presence of structurally or biologically related compounds.

Fig. 6.

Regeneration and stability test of the aptasensor. Bars represent the peak current (Iₚ) under three conditions — blank (blue), after incubation with FB₁ (100 μg/mL, red), and after re-incubation in buffer without FB₁ at 75 °C for 20 min (yellow). Data are shown for the initial day (left cluster) and after 10 days (right cluster). Error bars represent the standard deviation (n = 3). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

The analytical performance of the proposed aptasensor was further evaluated by comparing it to conventional FB₁ detection methods. Classical HPLC-based techniques, such as HPLC-UV and HPLC-FLD, typically report limits of detection ranging from 0.01 to 50.2 μg·kg⁻¹ when applied to food and feed matrices following extraction and derivatization. (Kong et al., 2013) In contrast, ELISA-based assays often exhibit higher detection limits, approximately 200 μg·kg⁻¹. (Barna-Vetró et al., 2000; Šegvić Klarić et al., 2009) More advanced LC–MS/MS techniques can achieve significantly lower detection limits, in some cases down to sub-μg·kg⁻¹ levels; however, these approaches require expensive instrumentation, extensive sample preparation, and skilled operators. (Khan et al., 2024) In comparison, the electrochemical aptasensor developed in this work demonstrates a low LOD of 1.58 ng·mL⁻¹ under laboratory buffer conditions, highlighting its potential as a rapid, cost-effective, and screening-oriented alternative for FB₁ analysis. Nonetheless, further validation in real food matrices is necessary to fully assess its practical applicability. For a detailed comparison, refer to Table S2, which summarizes the detection limits of conventional chromatographic methods compared to the proposed electrochemical aptasensor.

3.6. Stability and regeneration of the aptasensor

To investigate whether the developed aptasensor can be reused after target binding and to assess the stability of the aptamer immobilized on the electrode surface, a regeneration-type experiment was designed. The procedure included the following steps: First, the aptasensor was incubated with FB₁ (100 μg/mL), and the peak current (I_p) was recorded. Next, after thorough washing, the electrode was re-incubated in a blank buffer at an elevated temperature (75 °C) for 20 min to promote the dissociation of the bound FB₁. Finally, I_p was measured again. The same sequence was repeated ten days later to evaluate temporal stability over the 10-day period. As shown in Fig. 6, the initial blank measurement (prior to FB₁ incubation) yielded a low baseline current. After incubation with FB₁, a significant increase in Iₚ was observed, confirming target binding. Importantly, following the high-temperature buffer incubation and wash (re- incubation step), the peak current returned nearly to the original blank level. This recovery was reproducible even after ten days, indicating that the aptamer remains stably immobilized and functional on the electrode surface, and that the binding is reversible under the regeneration conditions.

Herein, the aptamer was immobilized onto the AuNP-modified electrode through PS backbone modifications. PS-DNA has been shown to bind strongly to gold surfaces primarily via the sulfur atom, resulting in enhanced adsorption affinity and improved stability compared to non-modified oligonucleotides. (Karami & Hasani, 2023; Nikbin et al., 2024) This characteristic underpins the robustness of the aptamer‑gold connection in our biosensor design. These observations indicate that the aptasensor demonstrates promising regeneration capability and short-term stability, suggesting its potential for reuse under the tested conditions.

4. Conclusion

The present study developed a simple and cost-effective electrochemical aptasensor for the detection of FB₁, leveraging a signal-on mechanism based on target-induced conformational changes in a specific aptamer. The molecular docking study provided mechanistic insights into the signal transduction activated by the interaction between the aptamer and FB₁. The preparation process of the aptasensor is notably rapid, involving a simple two-step immobilization protocol that can be completed in just a few minutes. The aptasensor demonstrated excellent analytical performance, featuring a low limit of detection of 1.58 ng/mL, an acceptable linear range, and high specificity, effectively discriminating FB₁ from structurally related mycotoxins commonly co-produced by Fusarium species. The integration of facile fabrication, rapid and sensitive detection, high selectivity, and affordability makes this electrochemical aptasensor a promising tool for in-field toxin detection in agricultural products, contributing significantly to food safety and environmental monitoring.

CRediT authorship contribution statement

Maryam Karami Nazargahi: Writing – original draft, Visualization, Project administration, Methodology, Investigation, Data curation. Doustmorad Zafari: Writing – review & editing, Validation, Supervision. Abbas Karami: Writing – review & editing, Visualization, Conceptualization. Khosrow Chehri: Supervision. Shahrzad Nikbin: Methodology. Sadegh Khazalpour: Writing – review & editing, Supervision, Methodology.

Declaration of competing interest

The authors declare that there are no known competing financial interests or personal relationships that could have influenced the work reported in this study.

Appendix A. Supplementary data

Supplementary material

Data availability

No data were used in the research described in this article.