Skip to main content
Springer logoLink to Springer
. 2025 Sep 27;243(6):1437–1452. doi: 10.1007/s00213-025-06898-5

Effects of MMP8 inhibitors on chronic unpredictable mild stress-induced neuroinflammation and depressive-like behavior:exploring the underlying molecular mechanisms

Yan Ren 1,#, Weikang Chen 2,3,#, Jinhui Wang 2,3, Shasha Wu 4, Ting Linghu 5, Jinyin Ge 5, Ruiping Zhang 6,
PMCID: PMC13323213  PMID: 41014338

Abstract

Objective

Studies have demonstrated a close association between alterations in the immune system and major depressive disorder (MDD), with MDD potentially inducing neuroinflammation, hippocampal atrophy, and depression-like behaviors. Matrix metalloproteinase-8 (MMP8) contributes to the onset of depression, but it has not been studier yet. This study aims to investigate the mechanistic role of the MMP8 inhibitor (M8I) in alleviating depression induced by chronic unpredictable mild stress (CUMS) in rats. The objectives include evaluating the ameliorative effects of M8I on CUMS-induced depression-like behaviors and exploring its impacts on the TNF-α/TNFR1/NF-κB signaling pathway, NLRP3 inflammasome activation, expression levels of GFAP and IBA-1, oxidative stress pathways, apoptosis, regulation other neurotransmitters, and acetylcholinesterase(AChE) expression.

Methods

The CUMS model was employed to induce depressive-like behaviors in rats, followed by a one-week treatment with M8I. Behavioral tests were performed to assess depressive-like behaviors. Western blot, terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) assay, immunohistochemistry, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS), and near-infrared II (NIR-II) imaging were utilized to evaluate the expression levels of proteins involved in the TNF-α/TNFR1/NF-κB signaling pathway, NLRP3 inflammasome, GFAP and IBA-1 expression in astrocytes and microglia, oxidative stress markers (SOD, GSH, PI3K/AKT), apoptosis-related proteins (Bax, Bcl-2), as well as brain neurotransmitters regulation and AChE activity.

Results

CUMS induced depressive-like behaviors in rats, upregulated the expression of TNF-α and its associated proteins (TNFR1, NF-κB), NLRP3 inflammasome-related proteins (p-P38, caspase-1), GFAP, and IBA-1 in the hippocampal tissue, and downregulated the expression of SOD, GSH, and PI3K/AKT. Additionally, it disrupted the balance of apoptosis-related proteins (Bax, Bcl-2), brain neurotransmitters regulation, and AChE activity. Treatment with M8I reversed these alterations; however, certain neurotransmitters, such as norepinephrine and dopamine, did not fully return to normal levels.

Conclusion

M8I effectively alleviates CUMS-induced depressive-like behaviors by modulating the TNF-α/TNFR1/NF-κB signaling pathway, inhibiting the NLRP3 inflammasome activation, and suppressing astrocytes and microglia activation, thereby attenuating inflammatory responses, oxidative stress pathways, and apoptosis-related processes. These findings provide novel insights into M8I as a potential therapeutic strategy for depression and futher elucidate the molecular mechanisms underlying its anti-inflammatory effects.

Keywords: MMP8 inhibitor, Depression, Neuroinflammation, Oxidative stress, Inflammasomes

Introduction

Depression is a highly prevalent psychiatric disorder with multifactorial etiology and represents one of the leading causes of global disability(Gutiérrez-Rojas et al. 2020, Sampogna et al. 2024). Despite the availability of diverse therapeutic approaches, over one-third of patients fail to achieve complete remission with conventional antidepressants or psychotherapies due to intrinsic biological heterogeneity and other confounding factors(Rush et al. 2006). Consequently, elucidating the pathophysiological mechanisms underlying depression is critical for advancing disease understanding and developing novel therapeutic strategies. Recent studies have demonstrated that oxidative stress plays a pivotal role in various pathological processes, including major depressive disorder (MDD), cancer, Parkinson’s disease, bipolar disorder, and aging(Madireddy and Madireddy 2022, Teleanu et al. 2022, Iqbal et al. 2024, Shao et al. 2024, Yang et al. 2024). Notably, the central nervous system (CNS) is highly susceptible to oxidative damage owing to its high oxygen consumption, elevated cerebral blood flow requirements, relatively weak endogenous antioxidant defenses, and lipid-rich neuronal membranes containing abundant in polyunsaturated fatty acids. Compelling experimental evidence supports the role of oxidative stress in neurodegeneration and its mechanistic involvement in depression(Bai et al. 2022).Research has revealed a robust association between neuroinflammation and depression, characterized by elevated inflammatory biomarkers (e.g., TNF-α) and immune cell infiltration, suggesting a potential causal link between inflammatory cascades and depressive pathophysiology(Camini et al. 2017, Li et al. 2021, Guo et al. 2023, Wu and Zhang 2023). Key pathophysiological mechanisms of depression encompass dysregulation of monoaminergic neurotransmission, oxidative stress, and neuroinflammatory, collectively driving hippocampal neuronal atrophy and apoptosis(Duman 2002, Zhang et al. 2023). In addition, microglia and astrocytes play central regulatory roles in neuroinflammatory cascades by releasing pro-inflammatory cytokines, reactive oxygen species (ROS), and neurotoxic mediators such as glutamate. These processes disrupt synaptic plasticity, impair neurogenesis, and ultimately manifest as depressive-like behavioral phenotypes(Wang et al. 2022).

Several matrix metalloproteinases (MMPs) have been associated with psychiatric disorders, such as MMP1, MMP2, and MMP9, which have been associated with depressive episodes(Bobińska et al. 2016, Alaiyed et al. 2020, Bijata et al. 2022, Li et al. 2022). Notably, Flurin Cathomas et al. demonstrated that the serum expression of circulating myeloid cell-specific protease MMP8 is elevated in patients with MDD and in stress-susceptible mice following chronic social defeat stress (CSDS)(Cathomas et al. 2024). This increase results in modifications to the extracellular matrix and neurophysiological alterations within the nucleus accumbens (NAC), as well as changes in social behaviors. Depletion of MMP8 prevented stress-induced social avoidance behaviors and mitigated changes in the neurophysiology and extracellular matrix of the NAC. This finding suggests that MMP8 may regulate its expression and activity through modulation of oxidative stress-related signaling pathways. Furthermore, targeting specific MMP8 inhibitors (M8I) derived from peripheral immune cells may represent a novel therapeutic approach for the treatment of stress-related neuropsychiatric disorders. Nevertheless, the role of M8I in depression has not been fully elucidated.

Herein, we investigated the impact of MMP8 on neuroinflammation-associated depression and its underlying mechanisms. After administration of M8I in the CUMS rat model, the results demonstrated that MMP8 significantly attenuated CUMS-induced neuroinflammatory responses and depressive-like behaviors by modulating the TNF-α/TNFR1/NF-KB signaling pathway, inhibiting the activation of NLRP3 inflammasomes, and reduced the expression levels of GFAP and IBA-1 in astrocytes and microglia, oxidative stress markers (e.g., SOD, GSH) and apoptosis-related proteins (e.g., Bax, Bcl-2). These findings may provide potential therapeutic targets for patients with depression, and offer new insights into the diagnosis and effective treatment of MDD.

Experimental procedures

Animals

Adult Sprague-Dawley (SD) rats, weighing 240–300 g and aged 6–8 weeks, were purchased from Beijing Spefo Biotechnology Co., Ltd. The experimental animals were housed at the Experimental Animal Research Center of the Third Clinical Medical College of Shanxi Medical University, with three animals pre cage. They were maintained under a 12 h light/12 h dark cycle at a temperature of 18–22 °C, with ad libitum access to food and tap water throughout the study period. All experimental procedures were designed to minimize animal suffering and were conducted in strict accordance with the protocol approved by the Animal Care and Use Committee of the Third Clinical Medical College of Shanxi Medical University.(SBQLL-2024-229).

Drugs

MMP8 inhibitor (Macklin, Shanghai China), 2,4-diphenylpyranium tetrafluoroborate, α-cyano-4-hydroxycinnamic acid, acetonitrile, methanol, and anhydrous ethanol were purchased from Aladdin, Shanghai China. Environmentally friendly dewaxing solution, Tunel assay kit, hematoxylin staining solution, hematoxylin differentiate solution, hematoxylin bluing solution, and resin mounting medium were purchased from Servicebio Technology, Wuhan, China.

CUMS modeling

In this experiment, we employed a combination of stressors to mimic CUMS: 24 h of fasting and water deprivation, 24 h of exposure to wet bedding, 24 h of circadian reversal, 5 min of cold water swimming at 4 ℃, and 2 min of tail pinching. Stress manipulations were administered daily between 9:00 and 11:00, with no consecutive application of the same stressor to prevent rats from anticipating the onset of stress and developing adaptive responses. The model was maintained for a continuous 4-week period and subsequently evaluated.

Behaviors analysis

Behavioral tests included the Open Field Test (OFT) and the Sucrose Preference Test (SPT), with all experimental rats tested in the same sequence.

Open field test (OFT)

OFT has been widely employed as a reliable method to assess depressive - like and anxiety - like behaviors. Each rat was individually placed in the center of a white Plexiglas box with dimensions 100 × 100 × 40 cm. The floor of the arena was partitioned into four identical squares. The rats were allowed to explore the field freely for 5 min. The test room was illuminated dimly. The number of line crossings and rearings was automatically recorded over 5 min by the video tracking system (SMART video tracking system, MoblieDatum, China). All behaviors were automatically recorded using a video camera positioned above the arena. After each test, the apparatus was cleaned with 70% ethanol to eliminate scent clues.

Sucrose preference test (SPT)

and the amount of liquid consumed from each bottle was recorded over a 12-hour period (liquid consumption = starting weight - remaining weight). The sucrose preference rate for each rat (%) was calculated as follows: [(1% sucrose solution consumption (mL)/(1% sucrose solution consumption (mL) + regular drinking water consumption (mL)] × 100%. A decrease in the sucrose preference rate indicates anhedonia, a core symptom of depressive disorders.

Evaluating SPT using the methods described earlier. To minimize novelty-induced anxiety, rats were acclimatized to the experimental setup prior to testing. During the initial 24 h period, each cage was provided with two bottles containing 1% sucrose solution. In the subsequent 24 h period, one bottle of regular drinking water and one bottle of 1% sucrose solution were placed in each cage. Following a 24 h period of water deprivation, the formal experiment began: two water bottles, matched in appearance and capacity, were placed in each cage, one containing regular drinking water and the other containing 1% sucrose solution. Each rat was individually housed, and the amount of liquid consumed from each bottle was recorded over a 12 h period (liquid consumption = starting weight - remaining weight). The sucrose preference rate for each rat (%) was calculated as follows: [(1% sucrose water solution consumption (mL)/(1% sucrose solution consumption (mL) + regular drinking water consumption (mL)] × 100%. A decrease in sucrose preference rate indicates anhedonia, a core symptom of depressive disorders.

Experimental design for drug treatment

The experimental animals were randomly assigned into three groups (n = 3 per group): normal saline-treated group (PBS), CUMS-treated group (CUMS), and CUMS + matrix metalloproteinase 8 inhibitor-treated group (M8I, 3.5 mg/kg). The CUMS model was established first, and its validity was evaluated using behavioral tests such as the OFT and SPT. Subsequently, M8I (3.5 mg/kg) was dissolved in PBS containing 10% DMSO and intraperitoneally administered three times per week for seven consecutive days. Body weights were recorded weekly during the 31-day experimental period (between 9 a.m. to 1 p.m.). At the end of the experiment, the rats were euthanized using an approved method. The brains were perfused with sterile PBS and rapidly stored at −80 °C for subsequent analysis.

Determination of SOD and GSH content

Superoxide dismutase (SOD) and reduced glutathione (GSH) levels were quantified using commercially available assay kits (Nanjing Jiancheng Bioengineering Institute, catalog number A001-3 for SOD and A006-2-1 for GSH). The absorbance for GSH was measured at 450 nm, while the absorbance for SOD activity was measured at 405 nm, both using a microplate reader (Bio-Rad-Benchmark, USA).

Quantitative reverse transcription-PCR

Fresh or frozen rat brain tissues were collected and cut into 1–3 mm pieces using tissue shears, and transferred to 1.5 mL EP tubes. Total RNA was extracted by adding 0.5–1 mL of Trizol reagent (TransGen, China). The quality of the RNA was assessed using a NanoVue Plus Spectrophotometer (Biochrom, UK). Subsequently, qPCR was performed on a CFX96 Real-Time PCR Detection System (Bio-Rad, USA). GADPH, encoding 3-phosphoglyceraldehyde dehydrogenase, was used as the reference gene for data normalization. qPCR experiments were conducted using the primers listed in Table 1. The fold changes in the expression levels of the indicated genes were calculated using the 2^-(ΔΔCt) method.

Table 1.

RT-qPCR primers

Primers Sequences (5’−3’)
MMP8 AGGATCAGTGGAGTGAGAGAG
CAAGGTATTGGAGGAGATGCTC
TNF-α CCGAGTGACAAGCCTGTAG
CAATGATCCCAAAGTAGACCT
GADPH GTGGAGTCATACTGGAACATGTAG
AATGGTGAAGGTCGGTGTG

Immunohistochemical staining

First, the rat brains were fixed and embedded. After sectioning, the slices were sequentially processed as follows: 10 min in Eco-friendly dewaxing solution I, 10 min in Eco-friendly dewaxing solution II, 10 min in Eco-friendly dewaxing solution III, 5 min in anhydrous ethanol (three changes),, and then washed with distilled water. Subsequently, the sections were naturally cooled following repair. The slides were washed three times with PBS (pH 7.4) on a decolorizing shaker for 5 min each time. Blocking was performed by adding drops of BSA (10% donkey serum for goat-derived primary antibodies and 3% BSA for other origins) and incubating for 30 min. Prepared primary antibodies [glial fibrillary acidic protein (GFAP, GB12090) and ionized calcium-binding adaptor molecule (IBA-1, GB113502)] were added, and the slices were incubated overnight at 4 °C in a humidified chamber. The sections were then incubated with the corresponding secondary antibody for 50 min at room temperature in the dark, followed by three washes with PBS. DAPI staining was performed for 10 min at room temperature in the dark. Images were captured and the ratio of positive cells was analyzed using AIpathwell software (Servicebio, China).

Western blotting

Rat left hypothalamic tissue was collected and placed in a homogenization container, protein lysate containing protease inhibitors was added. The mixture was homogenized on ice. After centrifugation, the supernatant was collected for protein quantification using a BCA kit. Denatured samples (boiled at 100 °C for 5 min) were resolved by SDS-PAGE and then transferred onto nitrocellulose membranes. The membranes were blocked with skimmed milk in TBST (Tris-buffered saline with 0.1% Tween 20) and incubated overnight at 4 °C with the primary antibodies (Table 2). The following day, the membranes were incubated with secondary antibodies (diluted 1: 1000) for 1 h at room temperature. For detection, the ECL Super Signal Chemiluminescent Kit was used according to the manufacturer’s instructions. Blots were visualized using ChemiDoc MP imaging System (Bio-red). Band intensities were quantified densitometrically using Image J software.

Table 2.

Detailed antibody information

Antibody Company Lot Number Dilute Source
PI3K ABclonal A0982 1/5000 Rabbit
p-PI3K ABclonal AP0427 1/1000 Rabbit
p-AKT ABclonal AP1068 1/5000 Rabbit
p-NF-KB ABclonal A0124 1/1000 Rabbit
TNFR1 ABclonal A1540 1/1000 Rabbit
NLRP3 ABclonal A5652 1/1000 Rabbit
p-P38 ABclonal A0526 1/1000 Rabbit
Caspase-1 ABclonal A16792 1/1000 Rabbit
Bcl-2 ABclonal A11025 1/1000 Rabbit
Bax ABclonal A11931 1/1000 Rabbit
β-Actin ABclonal AC006 1/1000 Rabbit

Targeted Matrix-Assisted laser desorption/ionization Time-of-Flight mass spectrometry (MALDI-TOF MS) analysis

MALDI-TOF MS analysis was performed according to a previous study. Briefly, an aliquot of sample was taken and derivatization by adding 2,4-diphenylpyranosyltetrafluoroborate (TMP-TFB, 4 mg/mL in 70% methanol). The derivatized sample was then mixed with a matrix solution α-cyano-4-hydroxycinnamic acid (CHCA, 10 mg/mL in 70% acetonitrile with 0.4% trifluoroacetic acid). To ensure sufficient reaction between the derivatization reagent and the sample, The mixture was incubated in 50% methanol for 30 min. The prepared samples were then spotted onto the MALDI target plate. A droplet of substrate solution was first applied and allowed to dry. The target plate was dried naturally or using a drying device to accelerate crystallization of the sample and matrix. Finally, the dried target plate was introduced into the MALDI-TOF MS instrument for analysis.

Data analysis

The results of the statistical analyses, including exact p-values, degrees of freedom, and the number of animals or replicates per experiment, were detailed in the figure legends. Statistical analyzed were performed using SPSS Statistics 27 (IBM, USA) and GraphPad Prism 9.5 software. Randomization methods were not employed. Western blot bands and morphological data were analyzed using Image J and Image Lab software (Image J 1.30). Data distribution was assumed to be normal and this assumption was formally tested using normality tests. One-way ANOVA followed by Tukey’s multiple comparison test was used to compare more than two sets of data. Two-way ANOVA was utilized for baseline and behavioral studies to assess drug interactions. All data are presented as mean ± SEM. Statistical significance was set at p < 0.05. (*: P < 0.05;**.P < 0.001..***.P < 0.0001..****.P < 0.00001).

Results

M8I attenuated CUMS-induced depression-like behaviors

The success of the depression model in rats can be evaluated by assessing depressive-like behaviors and physiological features, including open field test (OFT) for locomotor activity and anxiety-like behavior, sucrose preference test (SPT) for anhedonia (a core symptom of depression), and body weight monitoring for metabolic alterations. Collectively, these measures validate the establishment of the depressive phenotype. The OFT serves as a critical assay for evaluating general locomotor activity, exploratory drive, and response to novel environments. It captures aspects of core depressive symptoms such as psychomotor retardation and anhedonia (specifically, reduced interest). The SPT is one of the most direct and specific behavioral metrics for assessing anhedonia, which is a hallmark feature of depression. Body weight change is a somatic symptom included in the diagnostic criteria for depression and functions as an objective, quantifiable physiological biomarker of a depression-like state. The concurrent significant alterations in these three parameters (i.e., reduced activity, diminished sucrose preference, and weight loss) provide mutually reinforcing evidence, substantially enhancing the specificity and reliability of classifying an animal as exhibiting a depression-like state. As shown in Fig. 1, compared to the control group, CUMS-treated rats exhibited a significant reduction in body weight, decreased preference for a 1% sucrose solution, and reduced total distance traveled in the OFT. These results indicate that the CUMS protocol successfully induced depressive-like behaviors in rats. Given that whether MMP8 expression is upregulated in CUMS rats remains unexplored, we performed RT-qPCR to assess MMP8 levels in the brains of CUMS rats.

Fig. 1.

Fig. 1

Assessment of depression-like behaviors in rats: (A) Body weight status of control rats and CUMS-exposed rats during the modeling period. Data are presented as mean ± SEM (n = 7). Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test, * p < 0.05; (B) Total locomotor distance traveled by control and CUMS rats in the open field test after modeling completion, indicative of anxiety-like behaviors. Data are presented as mean ± SEM (n = 7). Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test, ****p < 0.0001; (C) Sucrose preference test results demonstrating anhedonia levels in rats. Data are represented as mean ± SEM (n = 7). Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test, ***p < 0.001

As shown in Fig. 2A, CUMS rats exhibited significantly higher MMP8 expression compared to control rats, indicating that CUMS induces MMP8 upregulation. Subsequently, CUMS rats received daily intraperitoneal injections of M8I (3.5 mg/kg; chemical structure shown in Fig. 3, administered according to the protocol described by Wang et al.) for one week. Behavioral assessments, including SPT and OFT, were conducted in control, CUMS, and CUMS + M8I groups. Figure 2B and C demonstrate that M8I administration significantly increased sucrose preference and total locomotor distance in CUMS rats, effectively reversing CUMS-induced anhedonia, anxiety-like behavior, and hypoactivity. These findings confirm that MMP8 inhibition alleviates depression-like behaviors.

Fig. 2.

Fig. 2

(A) MMP8 expression levels in the hippocampal tissues of control rats and CUMS (Chronic Unpredictable Mild Stress) rats. Quantitative data are represented as mean ± SEM (n = 3). Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test (*p < 0.05). (B) Sucrose preference test results reflecting anhedonia levels. Data are presented as mean ± SEM (n = 7 for control group, n = 3 for CUMS group). Statistical significance was determined using a two-tailed unpaired Student’s t-test (****p < 0.0001). (C) Total locomotor distance in the OFT, serving as an indicator of anxiety-like behaviors. Data are shown as mean ± SEM (n = 7 for control group, n = 3 for CUMS group). Statistical analysis was carried out using a two-tailed unpaired Student’s t-test (****p < 0.0001)

Fig. 3.

Fig. 3

Chemical structure of MMP8 inhibitors, C17H18N2O5S

M8I regulated oxidative stress signaling

Oxidative stress is associated with a variety of pathological processes. The production of reactive oxygen species (ROS) can activate multiple signaling pathways(Yoon et al. 2002). MMP8 may be involved in the regulation of oxidative stress by affecting these pathways(Winer et al. 2018). This suggests that MMP8 may regulate its expression and activity through the modulation of oxidative stress signaling-related signaling pathways.

Changes in the levels of glutathione (GSH) and superoxide dismutase (SOD) are important indicators for assessing the state of oxidative stress. As demonstrated in Figs. 4A and B, CUMS rats exhibited significant reduced hippocampal SOD activity and GSH content compared to control rats, indicating increased oxidative stress in the CUMS group. While M8I trearment partially restored SOD and GSH levels in CUMS rats, these values were still lower than those in the control group. As shown in Figs. 4C and D, the protein expression of PI3K, p-PI3K, AKT and p-AKT was markedly decreased in the hippocampus of CUMS rats, demonstrating inhibition of the PI3K/AKT signaling pathway. This molecular evidence further corroborates the heightened oxidative stress status in CUMS-treated rats. Notably, M8I intervention effectively upregulated the expression of total PI3K and AKT proteins in CUMS rats. Taken together, these findings demonstrate that M8I alleviates depression-like behaviors by mitigating oxidative stress through reactivation of the PI3K/AKT pathway in the hippocampus of depressive rats.

Fig. 4.

Fig. 4

(A) Hippocampal SOD activity analysis. CUMS rats exhibited significantly reduced SOD levels compared to control rats, which were effectively reversed by M8I treatment. Data are presented as mean ± SEM (n = 3). Statistical significance was determined by two-tailed unpaired Student’s t-test, ****p < 0.0001. (B) Hippocampal GSH content measurement. CUMS-induced GSH depletion was ameliorated by M8I administration. Data are presented as mean ± SEM (n = 3). Statistical analysis was performed using a two-tailed unpaired Student’s t-test, ****p < 0.0001. (C) and (D) Representative Western blot images showing hippocampal PI3K, p-PI3K, AKT, and p-AKT protein expression. CUMS downregulated the protein levels of PI3K, p-PI3K, AKT, and p-AKT, whereas M8I treatment restored their expression. (E)、(F) Quantitative analysis of PI3K, p-PI3K, AKT, and p-AKT expression from panels C and D. Protein levels were normalized to total PI3K and AKT protein levels (n = 3). Data are presented as mean ± SEM (n = 3) Statistical significance was determined by two-tailed unpaired Student’s t-test, ****p < 0.0001

M8I attenuated CUMS-induced neuroinflammation

There is a close association between inflammation and depression, with an increasing body of evidence suggesting that inflammation may serve as one of the important mechanisms underlying the development and progression of depression. Elevated levels of inflammatory markers, such as tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and C-reactive protein (CRP), have been consistently observed in most patients. These elevated inflammatory markers are positively correlated with the severity of depression symptoms. When inflammatory factors penetrate the brain, they activate astrocytes and microglia, thereby inducing neuroinflammation. This neuroinflammation subsequently leads to neuronal damage, impaired salience network function, and reduced neurogenesis, all of which are closely linked to the pathological mechanisms of depression.

As shown in Fig. 5, RT-qPCR analysis revealed that CUMS-treated animals exhibited significantly increased levels of the pro-inflammatory cytokine TNF-α, while M8I treatment markedly reduced CUMS-induced cytokine production. Furthermore, Western blot analysis of downstream proteins of in the TNF-α ignaling pathway, including TNFR1 and NF-κB, demonstrated that CUMS-treated rats exhibited enhanced expression of TNFR1 and p-NF-κB proteins. Notably, these increases were significantly reversed following M8I administration. These findings indicate that CUMS treatment significantly enhanced NF-κB phosphorylation, whereas M8I administration attenuated this effect, suggesting that M8I can inhibit the TNF-α/TNFR1/NF-κB signaling pathway and reduce the production of inflammatory cytokines.

Fig. 5.

Fig. 5

M8I Attenuates Depression-Associated Inflammatory Responses; (A) Western blot analysis revealed upregulated hippocampal tumor necrosis factor receptor 1 (TNFR1) 、nuclear factor-kappa B (NF-κB) and phosphorylated NF-κB (p-NF-κB) expression in CUMS rats compared to controls. (B) Quantitative analysis of hippocampal NF-κB and p-NF-κB protein levels from panel A, normalized to total NF-κB protein levels. Data are presented as mean ± SEM (n = 3). Statistical significance was determined by a two-tailed unpaired Student’s t-test, ****p < 0.0001. (C) Quantitative densitometry of TNFR1 levels normalized to GAPDH. Data expressed as mean ± SEM (n = 3). Statistical significance was determined by a two-tailed unpaired Student’s t-test, ***p < 0.001, ****p < 0.0001; (D) RT-qPCR analysis demonstrated elevated hippocampal TNF-α mRNA levels in CUMS rats. Data expressed as mean ± SEM (n = 3). Statistical significance: ****p < 0.0001 (two-tailed unpaired t-test)

In neuroinflammation, immune cells such as microglia and astrocytes are activated, promoting or inhibiting neuroinflammation responses through the releasing of soluble factors. To investigate the roles of microglia and astrocytes in CUMS-induced neuroinflammation, we assessed the expression of glial activation markers GFAP (for astrocytes) and IBA-1 (for microglia) using immunofluorescence analysis. As shown in Fig. 3E, compared with the control group, the CUMS group exhibited increased activation of both microglia and astrocytes in the hippocampal DG region and CA1-3 subfields. However, treatment with M8I significantly reduced the density of these activated glial cells. These results suggest that M8I suppresses neuroinflammatory responses and attenuates reactive gliosis by modulating inflammatory mediators Figure 6.

Fig. 6.

Fig. 6

The immunofluorescence imaging of rat brain tissues in Control, CUMS, and M8I groups demonstrated significantly elevated expression of IBA-1 (red) and GFAP (green) in the dentate gyrus (DG) region of CUMS-exposed rats, where the total positive cell ratio in the hippocampus was, control (IBA-1, 14.94%)(GFAP, 19.99%), CUMS(IBA-1,, 24.07%)(GFAP, 36.50%), M8I(IBA-1,, 17.78%)(GFAP, 29.10%)

M8I attenuated CUMS-induced activation of inflammasomes

In recent years, accumulating evidence has underscored the NLRP3 inflammasome as a pivotal target in neuroinflammation research, particularly due to its close association with the pathogenesis and progression of depression. Therefore, we investigated the expression levels of NLRP3 and its associated proteins, p38 and Caspase-1. The NLRP3 inflammasome, a multi-protein complex, plays a critical role in the immune system by recognizing diverse pathogen-associated molecular patterns (PAMPs) and damage-associated molecular patterns (DAMPs), thereby triggering inflammatory responses. To evaluate the expression of proteins involved in these signaling pathways, Western blot analysis was performed. As shown in Fig. 7, compared to the control group, the CUMS group exhibited significantly elevated expression levels of NLRP3, Caspase-1, P38 and phosphorylated p38 (p-p38). However, M8I treatment markedly attenuated these CUMS-induced changes, suggesting that M8I may exert anti-inflammatory effects by modulating the inflammasome signaling pathway. In summary, these findings suggest that M8I mitigates inflammatory responses by inhibiting NLRP3 and its downstream signaling molecules, which contributes to its antidepressant efficacy.

Fig. 7.

Fig. 7

M8I Attenuates the Effect of CUMS on Inflammasome Activation. (A) Western blot analysis of rat hippocampal tissue proteins demonstrated elevated expression of NLRP3 and Caspase-1 in CUMS-exposed rats, which was reduced by M8I treatment. (C)、(D) Quantitative data from (A) showing increased intensities of NLRP3 and Caspase-1. NLRP3 and Caspase-1 levels were normalized to GAPDH. Data are presented as mean ± SEM (n = 3) and analyzed by two-tailed unpaired Student’s t-test, ***p < 0.001, ****p < 0.0001. (B) Western blot analysis revealed increased expression of P38 and p-P38 in the hippocampus of CUMS rats. (F) Quantitative analysis of hippocampal P38 and p-P38 protein expression from panel B. Protein levels were normalized to total P38 protein levels. Data are expressed as mean ± SEM (n = 3) and analyzed by two-tailed unpaired Student’s t-test, ****p < 0.0001

M8I reduced CUMS-induced neuronal apoptosis

The above experiments have demonstrated that M8I exhibits promising antioxidant and anti-inflammatory effects. To further elucidate its effects, an investigation was conducted to explore its influence on cellular apoptosis in rat brain tissue. This focus is justified by the well-documented link between apoptosis and depression, which has been increasingly elucidated in recent studies. In patients with depression, increased neuronal apoptosis is commonly observed in the brain, particularly in regions associated with emotion and cognition, such as the hippocampus and prefrontal cortex (Lucassen et al. 2006, Peng et al. 2020). Neuronal apoptosis in these regions may lead to reduced neuron numbers and functional abnormalities, thereby contributing to depressive symptoms. Notably, patients with depression, hippocampal volume is typically reduced, which is closely associated with neuronal apoptosis. The hippocampus plays a crucial role in emotion regulation and memory formation, and its impairment may exacerbate depressive symptoms. Furthermore, certain antidepressant drugs can protect neurons by upregulating anti-apoptotic proteins (e.g., Bcl-2) or suppressing pro-apoptotic proteins (e.g., Bax) (Durham et al. 2015, Li et al. 2021).

Researchers evaluated the expression of Bcl-2 and Bax using Western blot analysis. As shown in Figs. 8A and B, compared to the control group, the CUMS group exhibited elevated Bax expression and reduced Bcl-2 levels, indicating that CUMS induces apoptosis, while M8I treatment restored these protein levels to baseline. Furthermore, apoptotic cells were identified via TUNEL staining to detect DNA fragmentation in nuclei. In Fig. 8E, the CUMS group displayed a significantly higher proportion of TUNEL-positive cells (1.79%) compared to the control group, suggesting enhanced apoptosis under pathological conditions. In contrast, the M8I-treated group showed a lower proportion of TUNEL-positive cells (0.70%), demonstrating that M8I may exert a significant anti-apoptotic effect on neuronal cells and could serve as a potential therapeutic agent to mitigate CUMS-induced neurocellular damage.

Fig. 8.

Fig. 8

Effect of M8I on CUMS-Induced Neuronal Apoptosis in Rat Brains. (A) Western blot analysis revealed increased expression of the pro-apoptotic protein Bax in hippocampal tissues of CUMS rats, whereas M8I treatment significantly attenuated Bax expression. (C) Quantitative analysis of Bax intensity (normalized to GADPH) confirmed its upregulation in CUMS rats. Data are presented as mean ± SEM (n = 3). Statistical significance (****p < 0.0001) was determined by two-tailed unpaired Student’s t-test. (B) Western blotting demonstrated reduced levels of the anti-apoptotic protein Bcl-2 in CUMS rat hippocampi, which were restored by M8I administration. (D) Quantification of Bcl-2 intensity (normalized to GADPH) validated its downregulation in the CUMS group. Data are expressed as mean ± SEM (n = 3). Statistical analysis (****p < 0.0001) was performed using a two-tailed unpaired Student’s t-test. (E) Representative TUNEL staining images of rat brain tissues, with blue signals indicating apoptotic cells (TUNEL-positive nuclei), and the positive cell rate of brain tissue (CA1) in the Control group was 0.23%, with an H-Score of 0.46. The positive cell rate of CUMS was 1.79%, with an H-Score of 3.75. The positive cell rate of the M8I group was 0.70%, with an H-Score of 1.41

Effects of M8I on other neurotransmitters

Given the well-documented anti-apoptotic effects of M8I, this study further investigates its influence on cerebral neurotransmitters. Neurotransmitters, which mediate signaling between neurons, play pivotal roles in regulating mood, cognition, and behavior. Dysregulation of these neurotransmitters has been implicated in the pathogenesis of depression, including monoamine neurotransmitter imbalances such as serotonin (5-HT), norepinephrine (NE), and dopamine (DA) (Hamon and Blier 2013, Haleem 2019). Additionally, other neurotransmitters, including γ-aminobutyric acid (GABA) (Luscher et al. 2023), glutamate (Glu) (Liu et al. 2021), and acetylcholine (Ach)-a key cholinergic neurotransmitter involved in the cholinergic-adrenergic imbalance hypothesis of depression-are also associated with depressive episodes (Wang et al. 2021). Studies have demonstrated that 5-hydroxyindoleacetic acid (5-HIAA), a metabolite closely linked to 5-HT metabolism and reflective of its in vivo levels, serves as a biomarker for depression (Faustman et al. 1990).

Mass spectrometry data acquired via MALDI-TOF MS were processed using FlexImaging to generate two-dimensional spatial maps (Figs. 9 and 10).In imaging mass spectrometry, color indicates the distribution of a particular molecule (m/z value) on the surface of a tissue or sample, and a color gradient (blue→yellow→red) is used to indicate the strength of the signal, with red representing a high-intensity signal, and blue representing a low-intensity. Results demonstrated that CUMS rats exhibited reduced levels of 5-HT, GABA, NE, DA, and 5-HIAA, alongside elevated Glu and Ach levels—consistent with findings in depressed patients and behavioral observations of anhedonia and hypoactivity in CUMS rats(Krishnan and Nestler 2008, Salas et al. 2008, Dagytė et al. 2011, Haider et al. 2014, Suarez-Lopez et al. 2019). Following M8I treatment, partial restoration of 5-HT, GABA, NE, Ach, Glu, DA and 5-HIAA levels was observed.These findings suggest that M8I may alleviate depressive-like behaviors by modulating specific neurotransmitterss.

Fig. 9.

Fig. 9

Effects of M8I on other neurotransmitters. A: Distribution of 5-HT in different experimental groups; B: Distribution of GABA in different experimental groups; C: Distribution of NE in different experimental groups; D: Distribution of Ach in different experimental groups; E: Distribution of Glu in different experimental groups; F: Distribution of DA in different experimental groups; G: Distribution of 5-HIAA in different experimental groups

Fig. 10.

Fig. 10

Neurotransmitter analysis in rat brains (M8I): Blue bars: Normal rats vs. CUMS rats, Red bars: M8I-treated rats vs. CUMS rats

Discussion

Recent studies have explored the correlation between MMP8 and the pathological progression of mental disorders. Specifically, MMP8 has been found to be associated with the onset of depression. MMP8 is a protease primarily derived from neutrophils and monocytes, involved in extracellular matrix (ECM) degradation, inflammatory regulation, and immune responses(Cathomas et al. 2024). MMP8 inhibitors, by specifically blocking its activity, have demonstrated therapeutic potential in various diseases. The CUMS model employs diverse and unpredictable mild stressors (e.g., circadian rhythm disruption, food/water deprivation, damp bedding, social isolation, etc.) to simulate long-term daily stress events faced by humans (e.g., work pressure, interpersonal tension, etc.)(Antoniuk et al. 2019). This model is characterized by high etiological fidelity, broad phenotypic coverage, and strong mechanistic relevance, making it a standard paradigm for studying antidepressant mechanisms and drug interventions. Therefore, the CUMS model was selected as the experimental subject in this study. The experimental results demonstrate that M8I ameliorates CUMS-induced depression-like behaviors, significantly reducing the levels of inflammatory factors such as TNF-α, TNFR1, NF-κB, NLRP3, caspase-1, and P38, while increasing the levels of antioxidative stress markers GSH, SOD, PI3K, and AKT. Additionally, M8I modulates the expression of apoptosis-related proteins (Bax and Bcl-2) and neurotransmitters (5-HT, GABA, NE, Ach, Glu, DA, and 5-HIAA).Using experimental techniques such as RT-qPCR, Western blot, TUNEL, immunohistochemistry, and MALDI-TOF MS, this study validated the mechanistic basis of M8I’s ameliorative effects on CUMS-induced depression-like behaviors.

The pathogenesis of depression is closely associated with neuroinflammation, oxidative stress, apoptosis, and neurotransmitter imbalance, which have been shown to induce hippocampal damage in rats subjected to CUMS. The hippocampus plays a pivotal role in learning, memory, and emotional regulation, and extensive research has demonstrated that its structural and functional abnormalities are integral to the pathophysiology of depression(Liu et al. 2017). Therefore, the present study focused on the hippocampus.

TNF-α, a pivotal pro-inflammatory cytokine, plays a crucial role in the neuroinflammatory pathology of depression. By binding to its primary receptor, TNFR1, TNF-α recruits downstream adaptor proteins to activate the canonical NF-κB signaling pathway(Xu et al. 2020), which is central to cellular activation and pro-inflammatory responses. Previous studies have indicated that TNFR1 is directly implicated in the development of depressive-like behaviors; for instance, intracerebral injection of TNF-α exacerbates despair-like behaviors in mice, whereas TNFR1 knockout confers an antidepressant effect(Gao et al. 2024). Importantly, it has also been established that the CUMS model can induce inflammation and depressive-like behaviors by activating the TNF-α/TNFR1 signaling pathway in microglia, leading to increased phosphorylation and nuclear translocation of NF-κB(Lu et al. 2018, Xu, Piao et al. 2020, Jia et al. 2024). The NLRP3 inflammasome is a cytosolic multiprotein complex typically primed by NF-κB-mediated transcriptional upregulation of NLRP3 and pro-IL-1β. Activated NLRP3 recruits the adaptor protein ASC and pro-caspase-1, facilitating the autoproteolytic activation of pro-caspase-1 into caspase-1(Fu and Wu 2023). Active caspase-1 then proteolytically processes pro-IL-1β and pro-IL-18, leading to the maturation and secretion of the potent pro-inflammatory cytokines IL-1β and IL-18(Chen et al. 2020, Batsukh et al. 2022).The P38 signaling pathway also plays a critical role in inflammatory regulation. P38 can not only be activated by TNF-α (upstream of NF-κB) and downstream products of NLRP3(Chen et al. 2006, Kodali et al. 2023), but it also modulates NF-κB activity and the assembly/function of the NLRP3 inflammasome through multiple mechanisms, such as regulating transcription factor activity and mRNA stability, ultimately promoting inflammation and depression-like behaviors.Consistent with these findings, our study demonstrated that CUMS exposure significantly upregulated the expression of TNF-α and its receptor TNFR1 in the rat hippocampus, and activated the downstream transcription factor NF-κB. Concurrently, we observed markedly increased expression of P38 and caspase-1, effector proteins downstream of the NLRP3 inflammasome. This was accompanied by an upregulation of the astrocyte marker GFAP and the microglial marker IBA-1, collectively suggesting that CUMS-induced depressive-like behavior is closely linked to neuroinflammation mediated by glial cell hyperactivation in the hippocampus.

Neuroinflammation is often accompanied by oxidative stress and apoptotic dysregulation. Oxidative stress is a pathophysiological state characterized by an imbalance between the generation and elimination of ROS within the body, often triggered by various harmful stimuli. This imbalance leads to the excessive accumulation of ROS, subsequently causing cellular and tissue damage. GSH and SOD are crucial antioxidants that effectively reduce intracellular ROS levels(Bai et al. 2021, Niu et al. 2021). PI3K represents a critical family of lipid kinases that plays a central role in fundamental cellular processes, including cell growth, proliferation, differentiation, metabolism, survival, and response to external stimuli(Ersahin et al. 2015). PI3K is typically activated at the plasma membrane by various receptors, such as Receptor Tyrosine Kinases (RTKs) and G-protein Coupled Receptors (GPCRs). AKT, also known as Protein Kinase B (PKB), is a key downstream effector in the PI3K signaling pathway and one of its most vital kinase targets.The activation cascade begins when activated PI3K generates the second messenger phosphatidylinositol (3,4,5)-trisphosphate (PIP3) at the plasma membrane. This recruits AKT to the membrane, where it is subsequently phosphorylated and fully activated by phosphoinositide-dependent kinase 1 (PDK1) and mTOR Complex 2 (mTORC2)(Bamodu et al. 2020). Once activated, AKT phosphorylates a multitude of downstream substrates, thereby regulating diverse cellular functions like the cell cycle, protein synthesis, glucose metabolism, and apoptosis.AKT is widely regarded as a critical promoter of cell survival, primarily by inhibiting apoptosis (for instance, through the phosphorylation and inactivation of pro-apoptotic proteins like Bax, or by inhibiting members of the caspase family) and promoting cell growth(Simonyan et al. 2016). Furthermore, activated AKT can upregulate the expression of enzymes involved in glutathione synthesis, such as glutathione synthetase. This demonstrates that the PI3K/AKT pathway can enhance the synthesis of GSH and boost the activity of other antioxidant enzymes like SOD, thereby effectively scavenging ROS and mitigating oxidative stress-induced cellular damage. In the present study, the expression levels of the antioxidants SOD and GSH were significantly decreased in the hippocampus of CUMS rats, whereas the pro-apoptotic protein Bax was upregulated and the anti-apoptotic protein Bcl-2 was downregulated, leading to an elevated Bax/Bcl-2 ratio. Furthermore, the critical PI3K/AKT cell survival pathway was inhibited, further exacerbating neuronal damage(Zhuang et al. 2019, Zhang et al. 2023).

Glu, the primary excitatory neurotransmitter, and GABA, the major inhibitory neurotransmitter(Chen et al. 2023), collectively form the foundation of brain activity. The precise balance between excitation and inhibition is critical to prevent pathological hyperexcitation (e.g., epilepsy) or excessive suppression. The monoamine neurotransmitters—5-HT, NE, DA—play a central role in mood regulation(Blier 2016), and their collective dysregulation constitutes the pathophysiological basis of many affective disorders, such as depression, anxiety disorders, and bipolar disorder. DA is essential for motor control (e.g., Parkinson’s disease), but its function is finely modulated by ACh, GABA, and Glu. For instance, the balance between DA and ACh in the basal ganglia is crucial for smooth motor execution(Krok et al. 2023)0.5-HIAA, the major metabolite of 5-HT(De Giovanni et al. 2022), serves as a biomarker reflecting the activity of the serotonergic system.Our investigation also revealed that CUMS induced dysregulation across multiple neurotransmitter systems in the brain, with abnormal levels of 5-HT, GABA, NE, Ach, Glu, DA, and the 5-HT metabolite, 5-HIAA.

Notably, following treatment with M8I, the aforementioned series of pathophysiological alterations induced by CUMS—including inflammation (involving the TNF-α/TNFR1/NF-κB pathway), oxidative stress, apoptosis, and neurotransmitter imbalance—were all significantly reversed and restored to normal levels.

Conclusion

In summary, our data demonstrate that M8I effectively mitigates CUMS-induced depressive-like behaviors by modulating the TNF-α/TNFR1/NF-κB signaling pathway, inhibiting the NLRP3 inflammasome and the activation of astrocytes and microglia, and suppressing neuroinflammation, oxidative stress, and apoptosis. These findings suggest that M8I may represent a promising novel therapeutic target for the treatment of depression, providing a scientific basis for its potential clinical application.

Author contributions

R.Z. conceived and designed the study; W.C., H.J. and H.L completed the experimental component. W.C.,Y.R. and H.J. analyzed the data and wrote the first draft of the manuscript, and Y.R., S.W. and J.G. revised the manuscript.

Funding

This work has been financially supported by the National Key R&D Program of China, 2023YFC3402800, National Natural Science Foundation of China (No: 82120108016, 82071987), Key Laboratory of Nano-imaging and Drug-loaded Preparation of Shanxi Province (No: 202104010910010), Science and Technology Activities of Overseas Students in Shanxi Province (No.20240055);Natural Applied Basic Research Program of Shanxi Province (No:202403021211045).

Data availability

All data used during the study appear in the submitted article.

Declarations

Competing interests

All authors declared that there is no conflict of interset.

Ethical approval

Not applicable.

Consent to participate

Not applicable.

Consent for publication

I, Yan Ren, hereby declare that I agree to the publication of the research findings presented in this manuscript entitled “Effects of MMP8 inhibitors on chronic unpredictable mild stress -induced neuroinflammation and depressive-like behavior: exploring the underlying molecular mechanisms” in the Psychopharmacology. I have carefully read and understood the submission guidelines and requirements of the journal.

I certify that the data, figures, and images presented in this manuscript are original or have been authorized and licensed legally. I guarantee that ethical standards have been followed in animal experiments.I hereby declare that I have made every effort to avoid errors and misconduct in this research and that the results presented in this manuscript are truthful and reliable.

I also declare that I will not be held responsible for any negative consequences resulting from the publication of this manuscript.I hereby declare that I have made every effort to avoid errors and misconduct in this research and that the results presented in this manuscript are truthful and reliable. I also declare that I will not be held responsible for any negative consequences resulting from the publication of this manuscript.

Please feel free to contact me at renyan_sxpph@sxmu.edu.cn for further information or clarification.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Yan Ren and Weikang Chen To whom co-first author should be addressed.

References

  1. Alaiyed S, McCann M, Mahajan G, Rajkowska G, Stockmeier CA, Kellar KJ, Wu JY, Conant K (2020) Venlafaxine stimulates an MMP-9-dependent increase in excitatory/inhibitory balance in a stress model of depression. J Neurosci 40(22):4418–4431 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Antoniuk S, Bijata M, Ponimaskin E, Wlodarczyk J (2019) Chronic unpredictable mild stress for modeling depression in rodents: meta-analysis of model reliability. Neurosci Biobehav Rev 99:101–116 [DOI] [PubMed] [Google Scholar]
  3. Bai R, Guo J, Ye XY, Xie Y, Xie T (2022) Oxidative stress: the core pathogenesis and mechanism of Alzheimer’s disease. Ageing Res Rev 77:101619 [DOI] [PubMed] [Google Scholar]
  4. Bai L-L, Zhang L-Q, Ma J, Li J, Tian M, Cao R-J, He X-X, He Z-X, Yu H-L, Zhu X-J (2021) DIP2A is involved in SOD-mediated antioxidative reactions in murine br ain. Free Radic Biol Med 168:6–15 [DOI] [PubMed] [Google Scholar]
  5. Bamodu OA, Chang H-L, Ong J-R, Lee W-H, Yeh C-T, Tsai J-T (2020) Elevated PDK1 expression drives PI3K/AKT/MTOR signaling promotes radia tion-resistant and dedifferentiated phenotype of hepatocellular carcin oma. Cells 9(3):746 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Batsukh S, Oh S, Rheu K, Lee B-J, Park C-H, Son KH, Byun K (2022) Rice germ ameliorated chronic unpredictable mild stress-induced depres sive-like behavior by reducing neuroinflammation. Nutrients 14(24):5382 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bijata M, Bączyńska E, Müller FE, Bijata K, Masternak J, Krzystyniak A, Szewczyk B, Siwiec M, Antoniuk S, Roszkowska M, Figiel I, Magnowska M, Olszyński KH, Wardak AD, Hogendorf A, Ruszczycki B, Gorinski N, Labus J, Stępień T, Tarka S, Bojarski AJ, Tokarski K, Filipkowski RK, Ponimaskin E, Wlodarczyk J (2022) Activation of the 5-HT7 receptor and MMP-9 signaling module in the hippocampal CA1 region is necessary for the development of depressive-like behavior. Cell Rep 38(11):110532 [DOI] [PubMed] [Google Scholar]
  8. Blier P (2016) Neurobiology of depression and mechanism of action of depression treat ments. J Clin Psychiatry 77(3): e319 [DOI] [PubMed]
  9. Bobińska K, Szemraj J, Czarny P, Gałecki P (2016) Role of MMP-2, MMP-7, MMP-9 and TIMP-2 in the development of recurrent depressive disorder. J Affect Disord 205:119–129 [DOI] [PubMed] [Google Scholar]
  10. Camini FC, da Silva Caetano CC, Almeida LT, de Brito Magalhães CL (2017) Implications of oxidative stress on viral pathogenesis. Arch Virol 162(4):907–917 [DOI] [PubMed] [Google Scholar]
  11. Cathomas, F., H.-Y. Lin, K. L. Chan, L. Li, L. F. Parise, J. Alvarez, R. Durand-de Cuttoli, A. V. Aubry, S. Muhareb, F. Desland, Y. Shimo, A. Ramakrishnan, M. Estill, C. Ferrer-Pérez, E. M. Parise, C. M. Wilk, M. P. Kaster, J. Wang, A. Sowa, W. G. Janssen, S. Costi, A. Rahman, N. Fernandez, M. Campbell, F. K. Swirski, E. J. Nestler, L. Shen, M. Merad, J. W. Murrough and S. J. Russo (2024). “Circulating myeloid-derived MMP8 in stress susceptibility and depressi on.” Nature626(8001): 1108–1115. [DOI] [PMC free article] [PubMed]
  12. Chen, J.-Y., K. Wu, M.-M. Guo, W. Song, S.-T. Huang and Y.-M. Zhang (2023). “The PrL < sup > Glu→avBNST < sup > GABA</sup > circuit rapidly modulates depression-like behaviors in male mice.” iScience26(10): 107878. [DOI] [PMC free article] [PubMed]
  13. Chen, S., C. Tang, H. Ding, Z. Wang, X. Liu, Y. Chai, W. Jiang, Y. Han and H. Zeng (2020). “Maf1 Ameliorates Sepsis-Associated Encephalopathy by Suppressing the N F-<i > k</i > B/NLRP3 Inflammasome Signaling Pathway.” Frontiers in immunology11: 594071. [DOI] [PMC free article] [PubMed]
  14. Chen, S.-E., B. Jin and Y.-P. Li (2006). “TNF-alpha regulates myogenesis and muscle regeneration by activating p 38 MAPK.” American journal of physiology. Cell physiology292(5): C1660-1671. [DOI] [PMC free article] [PubMed]
  15. Dagytė G, Den Boer JA, Trentani A (2011) The cholinergic system and depression. Behav Brain Res 221(2):574–582 [DOI] [PubMed] [Google Scholar]
  16. De Giovanni, M., H. Tam, C. Valet, Y. Xu, M. R. Looney and J. G. Cyster (2022). “GPR35 promotes neutrophil recruitment in response to serotonin metabol ite 5-HIAA.” Cell185(5): 815–830.e819. [DOI] [PMC free article] [PubMed]
  17. Duman, R. S. (2002). “Synaptic plasticity and mood disorders.” Mol Psychiatry7 Suppl 1: S29-34. [DOI] [PubMed]
  18. Durham E, Jen S, Wang L, Nasworthy J, Elsalanty M, Weinberg S, Yu J, Cray J (2015) Effects of citalopram on sutural and calvarial cell processes. PLoS One 10(10):e0139719 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Ersahin T, Tuncbag N, Cetin-Atalay R (2015) The PI3K/AKT/mTOR interactive pathway. Mol Biosyst 11(7):1946–1954 [DOI] [PubMed] [Google Scholar]
  20. Faustman WO, Faull KF, Whiteford HA, Borchert C, Csernansky JG (1990) CSF 5-HIAA, serum cortisol, and age differentially predict vegetative and cognitive symptoms in depression. Biol Psychiatry 27(3):311–318 [DOI] [PubMed] [Google Scholar]
  21. Fu J, Wu H (2023) Structural mechanisms of NLRP3 inflammasome assembly and activation. Annu Rev Immunol 41:301–316 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Gao, M., Y. Song, Y. Liu, Y. Miao, Y. Guo and H. Chai (2024). “TNF-α/TNFR1 activated astrocytes exacerbate depression-like behavior i n CUMS mice.” Cell death discovery10(1): 220. [DOI] [PMC free article] [PubMed]
  23. Guo B, Zhang M, Hao W, Wang Y, Zhang T, Liu C (2023) Neuroinflammation mechanisms of neuromodulation therapies for anxiety and depression. Transl Psychiatry 13(1):5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Gutiérrez-Rojas L, Porras-Segovia A, Dunne H, Andrade-González N, Cervilla JA (2020) Prevalence and correlates of major depressive disorder: a systematic review. Braz J Psychiatry 42(6):657–672 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Haider S, Saleem S, Perveen T, Tabassum S, Batool Z, Sadir S, Liaquat L, Madiha S (2014) Age-related learning and memory deficits in rats: role of altered brain neurotransmitters, acetylcholinesterase activity and changes in antioxidant defense system. Age (Dordr) 36(3):9653 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Haleem DJ (2019) Targeting serotonin1A receptors for treating chronic pain and depression. Curr Neuropharmacol 17(12):1098–1108 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Hamon M, Blier P (2013) Monoamine neurocircuitry in depression and strategies for new treatments. Prog Neuropsychopharmacol Biol Psychiatry 45:54–63 [DOI] [PubMed] [Google Scholar]
  28. Iqbal MJ, Kabeer A, Abbas Z, Siddiqui HA, Calina D, Sharifi-Rad J, Cho WC (2024) Interplay of oxidative stress, cellular communication and signaling pathways in cancer. Cell Commun Signal 22(1):7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Jia Z, Yu W, Li X, Dong T, Wang X, Li J, Yang J, Liu Y (2024) Du-moxibustion ameliorates depression-like behavior and neuroinflammat ion in chronic unpredictable mild stress-induced mice. J Affect Disord 358:211–221 [DOI] [PubMed] [Google Scholar]
  30. Kodali, M., L. N. Madhu, R. L. Reger, B. Milutinovic, R. Upadhya, J. J. Gonzalez, S. Attaluri, B. Shuai, D. L. G. Gitai, S. Rao, J. M. Choi, S. Y. Jung and A. K. Shetty (2023). “Intranasally administered human MSC-derived extracellular vesicles inh ibit NLRP3-p38/MAPK signaling after TBI and prevent chronic brain dysf unction.” Brain, behavior, and immunity108: 118–134. [DOI] [PMC free article] [PubMed]
  31. Krishnan V, Nestler EJ (2008) The molecular neurobiology of depression. Nature 455(7215):894–902 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Krok AC, Maltese M, Mistry P, Miao X, Li Y, Tritsch NX (2023) Intrinsic dopamine and acetylcholine dynamics in the striatum of mice. Nature 621(7979):543–549 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Li H, Sheng Z, Khan S, Zhang R, Liu Y, Zhang Y, Yong VW, Xue M (2022) Matrix metalloproteinase-9 as an important contributor to the pathophysiology of depression. Front Neurol 13:861843 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Li S, Sun Y, Song M, Song Y, Fang Y, Zhang Q, Li X, Song N, Ding J, Lu M, Hu G (2021) NLRP3/caspase-1/GSDMD-mediated pyroptosis exerts a crucial role in astrocyte pathological injury in mouse model of depression. JCI Insight. 10.1172/jci.insight.146852 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Li W, Ali T, He K, Liu Z, Shah FA, Ren Q, Liu Y, Jiang A, Li S (2021) Ibrutinib alleviates LPS-induced neuroinflammation and synaptic defects in a mouse model of depression. Brain Behav Immun 92:10–24 [DOI] [PubMed] [Google Scholar]
  36. Liu J, Han YS, Liu L, Tang L, Yang H, Meng P, Zhao HQ, Wang YH (2021) Abnormal Glu/mGluR(2/3)/PI3K pathway in the hippocampal neurovascular unit leads to diabetes-related depression. Neural Regen Res 16(4):727–733 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Liu, W., T. Ge, Y. Leng, Z. Pan, J. Fan, W. Yang and R. Cui (2017). “The Role of Neural Plasticity in Depression: From Hippocampus to Prefr ontal Cortex.” Neural plasticity2017: 6871089. [DOI] [PMC free article] [PubMed]
  38. Lu, Y., X. Xu, T. Jiang, L. Jin, X.-D. Zhao, J.-H. Cheng, X.-J. Jin, J. Ma, H.-N. Piao and L.-X. Piao (2018). “Sertraline ameliorates inflammation in CUMS mice and inhibits TNF-α-in duced inflammation in microglia cells.” International immunopharmacology67: 119–128. [DOI] [PubMed]
  39. Lucassen, P. J., V. M. Heine, M. B. Muller, E. M. van der Beek, V. M. Wiegant, E. R. De Kloet, M. Joels, E. Fuchs, D. F. Swaab and B. Czeh (2006). “Stress, depression and hippocampal apoptosis.” CNS Neurol Disord Drug Targets5(5): 531–546. [DOI] [PubMed]
  40. Luscher B, Maguire JL, Rudolph U, Sibille E (2023) GABA(A) receptors as targets for treating affective and cognitive symptoms of depression. Trends Pharmacol Sci 44(9):586–600 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Madireddy S, Madireddy S (2022) Therapeutic interventions to mitigate mitochondrial dysfunction and oxidative stress-induced damage in patients with bipolar disorder. Int J Mol Sci. 10.3390/ijms23031844 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Niu, B., K. Liao, Y. Zhou, T. Wen, G. Quan, X. Pan and C. Wu (2021). “Application of glutathione depletion in cancer therapy: Enhanced ROS-b ased therapy, ferroptosis, and chemotherapy.” Biomaterials277: 121110. [DOI] [PubMed]
  43. Peng Z, Zhang C, Yan L, Zhang Y, Yang Z, Wang J, Song C (2020) EPA is more effective than DHA to improve depression-like behavior, glia cell dysfunction and hippcampal apoptosis signaling in a chronic stress-induced rat model of depression. Int J Mol Sci. 10.3390/ijms21051769 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Rush AJ, Trivedi MH, Wisniewski SR, Nierenberg AA, Stewart JW, Warden D, Niederehe G, Thase ME, Lavori PW, Lebowitz BD, McGrath PJ, Rosenbaum JF, Sackeim HA, Kupfer DJ, Luther J, Fava M (2006) Acute and longer-term outcomes in depressed outpatients requiring one or several treatment steps: a STAR*D report. Am J Psychiatry 163(11):1905–1917 [DOI] [PubMed] [Google Scholar]
  45. Salas R, Main A, Gangitano DA, Zimmerman G, Ben-Ari S, Soreq H, De Biasi M (2008) Nicotine relieves anxiogenic-like behavior in mice that overexpress the read-through variant of acetylcholinesterase but not in wild-type mice. Mol Pharmacol 74(6):1641–1648 [DOI] [PubMed] [Google Scholar]
  46. Sampogna G, Toni C, Catapano P, Rocca BD, Di Vincenzo M, Luciano M, Fiorillo A (2024) New trends in personalized treatment of depression. Curr Opin Psychiatry 37(1):3–8 [DOI] [PubMed] [Google Scholar]
  47. Shao X, Wang Y, Geng Z, Liang G, Zhu X, Liu L, Meng M, Duan L, Zhu G (2024) Novel therapeutic targets for major depressive disorder related to oxidative stress identified by integrative multi-omics and multi-trait study. Transl Psychiatry 14(1):443 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Simonyan L, Renault TT, Novais MJdC, Sousa MJ, Côrte-Real M, Camougrand N, Gonzalez C, Manon S (2016) Regulation of Bax/mitochondria interaction by AKT. FEBS Lett 590(1):13–21 [DOI] [PubMed] [Google Scholar]
  49. Suarez-Lopez JR, Hood N, Suárez-Torres J, Gahagan S, Gunnar MR, López-Paredes D (2019) Associations of acetylcholinesterase activity with depression and anxiety symptoms among adolescents growing up near pesticide spray sites. Int J Hyg Environ Health 222(7):981–990 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Teleanu DM, Niculescu AG, Lungu II, Radu CI, Vladâcenco O, Roza E, Costăchescu B, Grumezescu AM, Teleanu RI (2022) An overview of oxidative stress, neuroinflammation, and neurodegenerative diseases. Int J Mol Sci. 10.3390/ijms23115938 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Wang H, He Y, Sun Z, Ren S, Liu M, Wang G, Yang J (2022) Microglia in depression: an overview of microglia in the pathogenesis and treatment of depression. J Neuroinflammation 19(1):132 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Wang S, Leri F, Rizvi SJ (2021) Anhedonia as a central factor in depression: Neural mechanisms revealed from preclinical to clinical evidence. Prog Neuropsychopharmacol Biol Psychiatry 110:110289 [DOI] [PubMed] [Google Scholar]
  53. Winer A, Adams S, Mignatti P (2018) Matrix metalloproteinase inhibitors in cancer therapy: turning past failures into future successes. Mol Cancer Ther 17(6):1147–1155 [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Wu A, Zhang J (2023) Neuroinflammation, memory, and depression: new approaches to hippocampal neurogenesis. J Neuroinflammation 20(1):283 [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Xu X, Piao H-N, Aosai F, Zeng X-Y, Cheng J-H, Cui Y-X, Li J, Ma J, Piao H-R, Jin X, Piao L-X (2020) Arctigenin protects against depression by inhibiting microglial activa tion and neuroinflammation via HMGB1/TLR4/NF-κB and TNF-α/TNFR1/NF-κB pathways. Br J Pharmacol 177(22):5224–5245 [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Yang J, Luo J, Tian X, Zhao Y, Li Y, Wu X (2024) Progress in understanding oxidative stress, aging, and aging-related diseases. Antioxidants 13(4):394 [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Yoon SO, Yun CH, Chung AS (2002) Dose effect of oxidative stress on signal transduction in aging. Mech Ageing Dev 123(12):1597–1604 [DOI] [PubMed] [Google Scholar]
  58. Zhang K, Wang F, Zhai M, He M, Hu Y, Feng L, Li Y, Yang J, Wu C (2023) Hyperactive neuronal autophagy depletes BDNF and impairs adult hippocampal neurogenesis in a corticosterone-induced mouse model of depression. Theranostics 13(3):1059–1075 [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Zhang Q, Yao M, Qi J, Song R, Wang L, Li J, Zhou X, Chang D, Huang Q, Li L, Wang N (2023) Puerarin inhibited oxidative stress and alleviated cerebral ischemia-r eperfusion injury through PI3K/Akt/Nrf2 signaling pathway. Front Pharmacol 14:1134380 [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Zhuang, Y., H. Wu, X. Wang, J. He, S. He and Y. Yin (2019). “Resveratrol Attenuates Oxidative Stress-Induced Intestinal Barrier Inj ury through PI3K/Akt-Mediated Nrf2 Signaling Pathway.” Oxidative medicine and cellular longevity2019: 7591840. [DOI] [PMC free article] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data used during the study appear in the submitted article.


Articles from Psychopharmacology are provided here courtesy of Springer

RESOURCES