Establishment and application of a rapid and visual detection method for Mycoplasma pneumoniae using enzymatic recombinase amplification combined with lateral flow dipstick

Highlights

• • Scientific questions

  Mycoplasma pneumoniae (MP) infection is a common respiratory disease, necessitating rapid, simple, and accurate detection methods for clinical diagnosis, particularly in resource-limited settings. However, conventional detection methods either rely on complex equipment or are time-consuming, limiting their applicability in point-of-care testing (POCT).

• • Evidence before this study

  MP is a major pathogen causing community-acquired pneumonia, particularly in children and adolescents. Quantitative polymerase chain reaction (qPCR) is the current gold standard for MP detection due to its high sensitivity and specificity, but it requires sophisticated equipment, skilled personnel, and a relatively long turnaround time. Although enzymatic recombinase amplification (ERA) coupled with lateral flow dipstick (LFD) has been widely used for rapid pathogen detection, an optimized ERA-LFD assay with high performance and POCT applicability for MP has yet to be established.

• • New findings

  In this study, an ERA-LFD assay was developed for rapid detection of MP. This assay specifically detects the target pathogen at 37 °C within 15 minutes, with results directly readable by the naked eye without additional equipment. The limit of detection (LoD) is 10 copies/μL, and no cross-reactivity with other common respiratory pathogens was observed. Clinical validation using patient samples showed high sensitivity, specificity, and 98.734% agreement with qPCR.

• • Significance of the study

  This assay serves as an ideal POCT tool, especially for resource-limited and primary healthcare settings, offering a practical and efficient method for rapid MP detection to facilitate timely treatment and disease control.

Abstract

Mycoplasma pneumoniae (MP) is a key pathogen of respiratory tract infections, and the development of rapid, sensitive, and simple point-of-care testing (POCT) methods is of great clinical significance. In this study, enzymatic recombinase amplification (ERA) was combined with a colloidal gold-based lateral flow dipstick (LFD) to establish a novel MP detection method. Specific primers targeting the P1 protein gene were designed, with the downstream primer and probe labeled with biotin and 6-carboxyfluorescein (FAM) at their 5' ends, respectively, and the primer pair combinations, reaction temperature, and time were optimized to construct the ERA-LFD method. The detection performance for different MP strains was evaluated using reference samples and compared with a commercial fluorescent quantitative polymerase chain reaction (qPCR) kit. Subsequently, specificity, sensitivity, and clinical applicability were assessed using clinical specimens. The results showed that the target gene fragment of MP could be successfully amplified at 37 °C within 15 min, and the ERA amplification products could be visualized on the colloidal gold LFD by the naked eye. The limit of detection (LoD) of the assay was as low as 10 copies/μL, which was 1,000-fold more sensitive than conventional PCR, with no cross-reactivity to nucleic acids from other common respiratory pathogens. Evaluation of 158 clinical samples using qPCR as the gold standard demonstrated that the method achieved 98.0% sensitivity, 100.0% specificity, 98.7% overall agreement, and a Kappa value of 0.973. Collectively, this study developed a simple, rapid, and sensitive MP detection method that is suitable for both routine clinical applications and POCT scenarios.

1. Introduction

Mycoplasma pneumoniae (MP) is a major etiological agent of human mycoplasma pneumonia [1], including atypical pneumonia, and various respiratory conditions, such as bronchitis, bronchiolitis, pharyngitis, and asthma, particularly in children and certain young adults [2]. MP infection can affect tissues and organs outside the respiratory system, resulting in complications such as myocarditis, nephritis, and meningitis [3]. MP is transmitted via respiratory droplets and has an incubation period of 1–3 weeks [4]. The community-acquired pneumonia (CAP) associated with MP can manifest in epidemic cycles every 4–7 years [5]. In 2023, MP re-emerged globally with widespread outbreaks; notably, concurrent epidemics occurred in 10 countries [6]. Due to the non-specific clinical symptoms of MP infection, it is frequently misdiagnosed as bacterial or viral upper respiratory tract infections [7]. Therefore, a rapid and highly specific detection method is required to accurately diagnose MP-related diseases.

The techniques currently used for detecting MP include culture, serological assays, and nucleic acid amplification tests. Isolation and culture of MP is a conventional diagnostic method. The presence of MP is indicated by a color change in the culture medium induced by its metabolites [8]. Owing to its limited enzymatic repertoire, MP requires highly nutritious media, such as specialized enriched broth or agar. Therefore, its growth cycle may extend to several weeks[9], [10]. Consequently, MP isolation is time-consuming and insensitive and is therefore not recommended for routine diagnosis. For MP detection, the most reliable serological method is to demonstrate a fourfold or higher increase in antibody titer between paired serum samples collected 2–3 weeks apart, with concurrent testing for IgM and IgG. However, this approach is unsuitable for the early detection of an MP infection [11]. Polymerase chain reaction (PCR) is the most widely used nucleic acid amplification technique, enabling rapid detection with high sensitivity and specificity. However, it is not suitable for point-of-care testing (POCT) due to its dependence on relatively expensive equipment and skilled personnel [12], [13].

Isothermal amplification is an emerging detection method that enables specific deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) amplification at a constant temperature, including loop-mediated isothermal amplification (LAMP), recombinase-aided amplification (RAA) [14], and recombinase polymerase amplification (RPA) [15]. The RPA reaction system comprises three key proteins (recombinase, recombinase loading factor, and single-stranded binding protein), as well as the amplification template, primers, and other essential reaction components [16]. The basic reaction process of RPA [17], [18] is as follows: Initially, the recombinase binds to RPA primers to form a recombinase–primer complex. This complex then searches for homologous sequences in the double-stranded DNA template. Upon recognition of homologous sequences, the complex invades the template to form a D-loop structure, initiating strand displacement. To stabilize the displaced strand and prevent branch migration from dislodging the invading primer, single-stranded binding proteins bind to the displaced DNA. The recombinase subsequently dissociates from the complex. In the presence of dNTPs, DNA polymerase binds to the 3'–OH terminus of the primer and mediates strand extension, producing a new complementary strand. Repeated cycles of these steps result in exponential amplification of the target DNA region. It exhibits high specificity and sensitivity, along with a short reaction time, simple operation, low instrumental demands, and no requirement for thermal cycling [19], [20]. Enzymatic recombinase amplification (ERA) is an advanced derivative of RPA that enhances reaction efficiency by optimizing the molecular structure and catalytic activity of system enzymes [21], [22]. Leveraging a similar core mechanism, ERA allows efficient in vitro amplification of target nucleic acids under isothermal conditions [23]. ERA amplicons can be detected by agarose gel electrophoresis, real-time fluorescence, or lateral flow dipstick (LFD). Lateral flow (LF) technology relies on antigen–antibody binding or hybridization between nucleic acid probes and target sequences. In this technique, separation is accomplished through capillary action of sample components [24], [25], with visual results obtainable within 5 min. The ERA-LFD requires no complex equipment and can be performed under isothermal conditions using simple portable heaters or water baths, offering rapid visual readout, simplicity, and cost-effectiveness.

The ERA-LFD can be used to detect various pathogens, including methicillin-resistant Staphylococcus aureus (MRSA) and human papillomavirus (HPV) [26], [27], [23], [28], [29]. Isothermal amplification techniques have also been applied for MP detection, such as the RPA-LFD assay, RPA-clustered regularly interspaced short palindromic repeats (CRISPR) platform, and dual ERA-CRISPR associated proteins 12 (Cas12) system [1], [7], [30], [31], [32]. However, these detection methodologies have inherent limitations, including high reagent costs, reliance on specialized instrumentation, and prolonged turnaround times. In contrast, ERA enhances the RPA system through rational optimization of enzyme molecular structures and kinetic properties. This method achieves rapid, efficient and sequence-specific recognition of MP targets, which provides a solid theoretical and technical basis for the establishment of a time-saving, simple-operated POCT strategy.

In this study, a visual method was developed for the rapid, accurate, and specific detection of MP by combining ERA technology with LFD. The main aims of this approach are to provide technical support for POCT and offer a valuable reference for rapidly detecting other pathogens.

2. Materials and methods

2.1. Strains and samples

Clinical MP nucleic acid samples were obtained from the Beijing Friendship Hospital in Beijing, China. National reference samples (including inactivated bacteria of MP strain 16–734, strain S355, strain 10–980, and strain FH 2009) for detecting MP were supplied by the National Institutes for Food and Drug Control of China. Samples of Streptococcus pneumoniae, Klebsiella pneumoniae, Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Chlamydia pneumoniae, Chlamydia psittaci, Legionella pneumophila, Mycobacterium tuberculosis, Influenza A virus (IAV), Influenza B virus (IBV), respiratory syncytial virus (RSV), human adenovirus (HAdV), and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) were obtained from Nanjing Bioengineering (Gene) Technology Center for Medicines, China.

2.2. Nucleic acid extraction

Total nucleic acids from viral and clinical samples were extracted using the MiniBEST Viral RNA/DNA Extraction Kit (TAKARA, Japan). Total nucleic acid extraction was performed strictly according to the manufacturer’s protocol. For clinical samples with a volume < 200 μL, the volume was adjusted to 200 μL with phosphate buffered saline (PBS) or RNase-free ddH₂O, Buffer viral genome extraction (VGB), proteinase K, and carrier RNA were added, mixed thoroughly, and incubated at 56 °C for 10 min. After incubation, 100% ethanol, buffer RWA, and buffer RWB were added to the lysate, mixed thoroughly by pipetting, and centrifuged. Subsequently, RNase-free H₂O was added, followed by incubation at room temperature for 5 min and centrifugation to elute DNA/RNA.

Genomic DNA was extracted from MP and other pathogens using the MiniBEST Universal Genomic DNA Extraction Kit (TAKARA, Japan). The sample was centrifuged at 12,000 revolutions per minute (rpm) for 2 min, and the supernatant was discarded. Subsequently, 180 μL of Buffer GL, 20 μL of Proteinase K, and 10 μL of RNase A were added, mixed thoroughly by pipetting, and incubated in a water bath at 56 °C for 10 min. Then, 200 μL of buffer GB and 200 μL of 100% ethanol were added and mixed thoroughly by pipetting, followed by centrifugation at 12,000 rpm for 2 min and discarding of the filtrate. Next, 500 μL of buffer WA and 700 μL of buffer WB were sequentially added to the column, each followed by centrifugation at 12,000 rpm for 1 min and removal of the filtrate. A total of 100 μL of elution buffer was added to the center of the column membrane, followed by standing at room temperature for 5 min. DNA was finally eluted by centrifugation at 12,000 rpm for 2 min. All nucleic acid samples were either analyzed immediately or stored at –80 °C until use.

2.3. Primers and probe design

The genome sequence of MP was obtained from the National Center for Biotechnology Information (NCBI) database (GenBank accession No.: NC_000912.1). The region spanning nucleotides 184,754–185,504 of the MP genome, which encodes the P1 adhesion protein, was selected as the target sequence. This sequence was synthesized and cloned into the pUC57 plasmid to construct a standard positive plasmid, pUC57-MP, by GenScript Inc. (Nanjing, China).

Based on the design principles for ERA primers and test strip-type probes, six pairs of forward and reverse primers and one probe were designed using Primer Premier 5.0 software, and they were validated using the Oligo 7.0 software. A biotin molecule was conjugated to the 5′ end of the ERA reverse primer to facilitate visual detection using the ERA-LFD test strip. In this study, the ERA probe (46–52 bp) was labeled with a 6-carboxyfluorescein (FAM) fluorophore at the 5' end and modified with a C3 spacer at the 3' end to prevent non-specific extension by DNA polymerase. A tetrahydrofuran (THF) residue was incorporated at position 31–37 from the 5' end of the probe, which acts as the specific recognition and cleavage site for the structure-specific nuclease [21], [33]. Following specific hybridization between the probe and the target amplicon, the nuclease is activated to cleave the probe precisely at the THF residue. This cleavage removes the 3'-terminal C3 spacer block, allowing DNA polymerase to extend the cleaved probe. Together with the biotin-labeled reverse primer, this process generates dual-labeled amplicons carrying FAM at one end and biotin at the other, thereby facilitating subsequent visual detection using LFD [18].

To determine sample sensitivity, PCR primers targeting the conserved region were designed using Primer Premier 5.0 software. The primers and probes were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). The sequences are presented in Table 1.

Table 1.

Primers and probes designed for the ERA or PCR assay.

Primers and probes	Sequence (5′-3′)	Primer length (bp)
F185	AATGATGTGGTGGGGGTTGGTCGACTTTCT	30
F178	TACGGGGAATGATGTGGTGGGGGTTGGTCG	30
F167	CCTAATACTAATACGGGGAATGATGTGGTG	30
R325	Biotin-CACGCTTTGTGGACCAGTGTCAGCTGTTTG	30
R347	Biotin-TTTGGTCAGGAGACTTGAACTTCACGCTTT	30
R385	Biotin-ATCGGTGACTGGGTGGGTAAACAAGCGGT	29
ERA-probe	FAM-CGATGTTGATGGTATTGTACGCACCC CACTC-[THF]-CTGAACTGTTAGAT-C3 spacer	45
PCR-F	CAACAACCTCGCGCCTAATA	20
PCR-R	GGGTGCGTACAATACCATCAA	21

Abbreviations: ERA, Enzymatic recombinase amplification; PCR, Polymerase chain reaction; FAM, 6-carboxyfluorescein; F, forward primer; R, reverse primer; bp, base pair.

2.4. Screening of optimal primers via gel electrophoresis and lateral flow test

The optimal primers were screened via the ERA assay using the constructed standard positive plasmid, pUC57-MP, as the template. The assay was performed adhering to the guidelines provided by the Basic Enzymatic Recombinant Isothermal Amplification Kit (GenDx, China). Nine pairs of forward and reverse primers were generated through the pairwise combination of three forward primers with three reverse primers. Reaction mixtures were prepared according to the manufacturer's instructions, comprising 2.5 μL of forward primer [10 μmol (M)], 2.5 μL of reverse primer (10 μM), 5 μL of template, 20 μL of rehydration buffer, 2 μL of activator, 18 μL of RNase-free ddH₂O, and a freeze-dried tablet containing the basic amplification reagent. The reaction mixture was incubated in a water bath at 37 °C for 30 min. After incubation, the amplified products were analyzed via 2% agarose gel electrophoresis, and the results were visualized using a gel imaging system.

The optimal primers were also screened by conducting the ERA-LFD assay. The reaction system was prepared following the instructions provided with the ERA Test Paper Nucleic Acid Amplification kit (GenDx, China). This reaction system consisted of 2.1 μL of forward primer (10 μM), 2.1 μL of reverse primer (10 μM), 0.6 μL of probe (10 μM), 5 μL of template, 20 μL of rehydration buffer, 2 μL of activator, 18.2 μL of RNase-free ddH₂O, and a freeze-dried tablet containing the amplification reagent. The reaction mixture was incubated in a water bath at 37 °C for 30 min. After incubation, the products were detected using LF test strips, and the results were interpreted by naked-eye readout.

2.5. Optimization of detection method conditions

The established MP ERA-LFD method was implemented, using the optimal primers, to optimize the amplification temperature. The amplification temperature was systematically varied at 35 °C, 36 °C, 37 °C, 38 °C, 39 °C, and 40 °C. After 30 min of incubation, the products were analyzed using LFD, and the temperature that yielded the most distinct bands at the T line was considered to be the optimal temperature. Each experiment was conducted in triplicate to ensure that the data were reliable. To optimize the amplification time, the ERA-LFD assay was performed with the ERA amplification duration adjusted to 5, 10, 15, 20, and 25 min. The amplification time that produced the most prominent band was considered to be the optimal duration.

2.6. Sensitivity and specificity of the ERA-LFD assay

To determine the sensitivity of the ERA-LFD assay, a serial 10-fold dilution of the positive plasmid was performed to achieve concentrations ranging from 1 to 10⁸ copies/μL. Following the experimental procedure, the color development was observed on the LF strips to determine the limit of detection (LoD) . Additionally, conventional amplification was conducted via PCR using the same templates to compare the sensitivity between the two methodologies. The primers used for PCR are presented in Table 1.

To determine specificity, the ERA-LFD detection method was used with nucleic acids from various templates, including Streptococcus pneumoniae, Klebsiella pneumoniae, Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Chlamydia pneumoniae, Chlamydia psittaci, Legionella pneumophila, Mycobacterium tuberculosis, IAV, IBV, RSV, HAdV, SARS-CoV-2, and MP.

2.7. Validation of the ERA-LFD assay using national reference samples

The national reference samples (inactivated MP bacteria) were serially diluted and then used for extracting nucleic acids. The dilutions and their extracted nucleic acids were used as templates in the established ERA-LFD assay and quantitative polymerase chain reaction (qPCR) assay with the MP Nucleic Acid Detection Kit (Macro & Micro-Test, China).

2.8. Evaluation of the ERA-LFD assay using clinical samples

A total of 158 nucleic acid samples were tested using both ERA-LFD and qPCR assays with the MP Nucleic Acid Detection Kit (Macro & Micro-Test, China) for comparative analysis.

2.9. Statistical evaluation

The detection performance of the ERA-LFD assay was rigorously evaluated by statistical comparison with qPCR (used as the reference standard). Sensitivity, specificity, positive agreement rate, and negative agreement rate of the newly developed ERA-LFD method were calculated using a 2 × 2 contingency table. Furthermore, the Kappa consistency test was conducted to assess the concordance between the detection results of the two methods. All statistical analyses were performed using R software (version 4.4.1).

3. Results

3.1. Screening of the optimal primers for the ERA assay

Nine sets of forward and reverse primers were designed based on the conserved sequence of the MP P1 protein. Agarose gel electrophoresis of ERA amplicons showed that the band from primer pair F185R347 appeared at the expected position without any non-specific bands (Fig. 1A), indicating specific amplification of the target gene by this primer pair. ERA amplicons were also evaluated using LFD strips. The results demonstrated a distinct band for primer pair F185R347, with excellent amplification efficiency (Fig. 1B). Thus, F185R347 was identified as the optimal primer pair for the ERA-LFD detection method.

Fig. 1.

The MP ERA primer pairs were screened by gel electrophoresis (A) and LFD (B) analysis of the amplified products. A) Lanes 1–9 show the agarose gel electrophoresis detection results of ERA using primer pairs F185R325, F178R325, F167R325, F185R347, F178R347, F167R347, F185R385, F178R385, and F167R385. B) Lanes 1–9 show the detection results of ERA using primer pairs F185R325, F178R325, F167R325, F185R347, F178R347, F167R347, F185R385, F178R385, and F167R385. Abbreviations: MP, Mycoplasma pneumoniae; ERA, Enzymatic recombinase amplification; LFD, lateral flow dipstick; Lane M, DL 2000 deoxyribonucleic acid (DNA) marker; Lane N, negative control; bp, base pair.

3.2. Optimization of reaction conditions for the ERA–LFD method

The amplification temperature for MP detection using the ERA-LFD method was optimized with the confirmed optimal primer pair. At 35–40 °C, the test line (T-line) developed clear colored bands (Fig. 2A). Given the rapid T-line development at 37 °C, coupled with advantages including rapid clinical testing and energy efficiency, 37 °C was identified as the optimal reaction temperature. Subsequently, MP detection was performed using the ERA-LFD method under the aforementioned optimal conditions, and amplification time was optimized by testing durations of 5, 10, 15, 20, 25, and 30 min. At an amplification time of 15 min, the detected bands were prominent and bright (Fig. 2B), indicating that 15 min was the optimal reaction time.

Fig. 2.

The reaction conditions were optimized for the ERA-LFD method. A) Optimization of reaction temperature for the ERA-LFD method. Strips 1–6 correspond to ERA reaction with amplification temperatures of 35 °C, 36 °C, 37 °C, 38 °C, 39 °C, and 40 °C. B) Optimization of reaction time for the ERA-LFD method. Strips 1–6 correspond to ERA reaction with reaction times of 30, 25, 20, 15, 10, and 5 min. Abbreviations: ERA, enzymatic recombinase amplification; LFD, lateral flow dipstick; Lane N, negative control.

3.3. Sensitivity and specificity of the ERA-LFD assay

In the sensitivity analysis, 10-fold serial dilutions of the MP standard positive plasmid were evaluated simultaneously using the ERA-LFD assay and conventional PCR. The ERA-LFD method exhibited a LoD of 10 copies/μL, with distinct and bright bands (Fig. 3A). In contrast, agarose gel electrophoresis results of conventional PCR amplicons showed an LoD of 10⁴ copies/μL (Fig. 3B). These findings indicated that the ERA-LFD method is 1,000-fold more sensitive than conventional PCR for MP detection.

Fig. 3.

Sensitivity and specificity analysis of the ERA-LFD assay. A) Sensitivity analysis of the ERA-LFD method. Lanes 1–10 correspond to the ERA-LFD assay using templates of MP-positive plasmid with concentrations of 10⁻¹, 10⁰, 10¹, 10², 10³, 10⁴, 10⁵, 10⁶, 10⁷, and 10⁸ copies/μL, respectively. B) Detection results of the conventional PCR assay using the same concentrations of MP-positive plasmid as used in A. C) Specificity analysis of the ERA-LFD assay. Strips 1–14 correspond to the results of the ERA-LFD in detecting Streptococcus pneumoniae, Klebsiella pneumoniae, Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Chlamydia pneumoniae, Chlamydia psittaci, Legionella pneumophila, Mycobacterium tuberculosis, IAV, IBV, RSV, HAdV, SARS-CoV-2, respectively. Abbreviations: ERA, enzymatic recombinase amplification; LFD, lateral flow dipstick; MP, Mycoplasma pneumoniae; Lane M, DL 1000 DNA marker; Lane P, positive control; Lane N, negative control; IAV, Influenza A virus; IBV, Influenza B virus; RSV, respiratory syncytial virus; HAdV, human adenovirus; SARS-CoV-2, severe acute respiratory syndrome coronavirus 2.

For specificity analysis, nucleic acids extracted from Streptococcus pneumoniae, Klebsiella pneumoniae, Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Chlamydia pneumoniae, Chlamydia psittaci, Legionella pneumophila, Mycobacterium tuberculosis, IAV, IBV, RSV, HAdV, SARS-CoV-2 and MP were evaluated using the ERA‑LFD assay. Only MP produced a positive result, while all other tested bacteria and viruses were negative (Fig. 3C).

3.4. Validation of the ERA-LFD assay using reference samples

Reference samples of various MP strains were used, including one sample of strain 16–734, two samples of strain S355, one sample of strain 10–980, and two samples of strain FH 2009, with and without nucleic acid extraction, to validate the established ERA-LFD assay. Both the ERA-LFD assay developed in this study and the commercial qPCR assay effectively detected both inactivated bacteria and extracted nucleic acids from all six samples (Fig. 4). These findings indicate that the ERA-LFD assay can rapidly and accurately detect different strains of MP regardless of the nucleic acid extraction status.

Fig. 4.

Validation of the ERA-LFD assay using national reference samples. A–D) The detection results of the inactivated MP bacteria by qPCR and ERA-LFD methods. A) The qPCR detection results of the six different MP samples. B) The ERA-LFD detection results of the six different MP samples are illustrated, where lanes 1–6 correspond to the detection results of strain 16–734, strain S355, strain 10–980, strain FH 2009, strain FH 2009, and strain S355. C) The qPCR detection results of serially diluted inactivated MP bacteria are shown, with lanes 1–6 corresponding to the detection results of 10⁰-10⁵ dilutions, respectively. D) The ERA-LFD detection results of the inactivated MP at different gradient concentrations are presented, where lanes 1–6 correspond to the detection results of 10⁰-10⁵ dilutions, respectively. E–H) show the detection results of the extracted MP nucleic acid by qPCR and ERA-LFD methods. E) The qPCR detection results of nucleic acid from six different MP samples. F) The ERA-LFD detection results of six different MP samples are illustrated, where lanes 1–6 correspond to the detection results of strain 16–734, strain S355, strain 10–980, strain FH 2009, strain FH 2009, and strain S355. G) The qPCR detection results of serially diluted MP nucleic acid are presented, with lanes 1–6 corresponding to the detection results of MP nucleic acid at 10⁰-10⁵ dilutions. H) The ERA-LFD detection results of serially diluted MP nucleic acid are shown, where lanes 1–6 correspond to MP nucleic acid at 10⁵–10⁰ dilutions. Abbreviations: ERA, enzymatic recombinase amplification; LFD, lateral flow dipstick; MP, Mycoplasma pneumoniae; qPCR, quantitative polymerase chain reaction; Lane P, positive control; Lane N, negative control.

When results were validated using inactivated bacteria without nucleic acid extraction, both the ERA-LFD and qPCR assays exhibited equivalent sensitivity for serially diluted MP solutions (Fig. 4C and 4D), with both methods successfully detecting MP as low as a 10⁴-fold dilution. For the detection of extracted nucleic acids (Fig. 4G), qPCR detected the 10-fold diluted sample with a cycle threshold (Ct) value < 38. However, for the 10²-fold diluted sample, the assay yielded a Ct value > 38, which was defined as negative per the kit instructions. Similarly, the ERA-LFD assay detected the 10-fold diluted sample, albeit with a weak positive band (Fig. 4H). These results demonstrate that the ERA-LFD assay has sensitivity comparable to that of qPCR.

3.5. Evaluation of the ERA–LFD assay using clinical samples

The performance of the ERA-LFD assay was evaluated using 100 clinical positive samples and 58 negative samples. All positive samples were previously tested for the presence of MP via qPCR assays. The established ERA-LFD assay successfully detected 98 positive samples, whereas two samples with low pathogen loads (Ct values of 36.8 and 35.6, respectively) tested negative (Fig. 5, Table S1). All 58 negative samples yielded negative results (Fig. 5).

Fig. 5.

Validation of the ERA-LFD assay using clinical samples. Lanes 1–100 show the detection results for positive samples; lanes 101–158 show the results for negative samples. Abbreviations: ERA, enzymatic recombinase amplification; LFD, lateral flow dipstick; MP, Mycoplasma pneumoniae; Lane P, positive control; Lane N, negative control.

The sensitivity and specificity of the ERA-LFD assay were 98% and 100%, respectively (Table 2). The results of a paired Chi-square test showed that the difference between the ERA-LFD assay and the gold standard qPCR method was not significant (P = 0.4795). The ERA-LFD assay exhibited high consistency with qPCR, yielding an overall agreement of 98.734%, a Youden's index of 0.98, and a Kappa value of 0.973.

Table 2.

Comparison of the performance of ERA-LFD and qPCR assays for the detection of clinical samples.

ERA-LFD	qPCR, n			Sensitivity (%)	Specificity (%)	PPV (%)	NPV (%)	OA (%)	K
	Positive	Negative	Total
Positive	98	0	98	98.000	100.000	100.000	96.667	98.734	0.973
Negative	2	58	60
Total	100	58	158

Abbreviations: ERA, enzymatic recombinase amplification; LFD, lateral flow dipstick; qPCR, quantitative polymerase chain reaction; PPV, positive predictive value; NPV, negative predictive value; OA, overall agreement; K, Kappa statistic.

4. Discussion

Rapid detection methods based on ERA isothermal amplification technology have been developed in recent years and applied to various pathogens. However, for detecting MP, only ERA-CRISPR systems have been reported using either portable fluorometers or via visual observation using LFD [34]. The requirement for Cas proteins renders these approaches relatively expensive. Therefore, this study developed a direct ERA-LFD detection method that enables rapid, convenient, and highly sensitive diagnosis of the MP P1 gene with no cross-reactivity with other detected pathogens.

The ERA reaction demonstrated high efficiency across 35 °C–40 °C. At 37 °C, the test line developed rapidly, balancing convenience with energy requirements; thus, 37 °C was established as the optimal reaction temperature. This finding is consistent with the operating conditions of the MP-RPA-CRISPR[30], ERA-CRISPR/Cas12a [7], and RPA-LFD systems [1]. Moreover, compared to the stringent requirements of MIRA-qPCR [35] and Rapid-Cycle PCR [36], the proposed method makes it more suitable for on-site operation due to its tolerance to temperature fluctuations. Distinct bands observed at 15 min indicate optimal performance. This duration is comparable to that of the dual ERA/CRISPR-Cas12a system [34], faster than the duration of RPA-LFD (25 min) [1] and real-time fluorescent RPA (20 min) [31], and significantly shorter than the duration of LAMP (1 h) [37], CHA-FICA (1 h) [38], MP-LAMP-NAL (50 min) [39], real-time fluorescent MCDA (40 min) [40], and CRISPR-Cas12a (40 min) [41].

The reaction conditions were systematically optimized to establish an optimal assay with a LoD of 10 copies/μL, representing a 1,000-fold improvement in sensitivity over conventional PCR. Compared with other rapid MP detection methods, including the smartphone‑based ERA-LFS integrated device (SELID) [33], RPA-LFD [1], and RPA-CRISPR-Cas12a [42], the proposed method showed comparable sensitivity, while exhibiting higher sensitivity than the ERA/CRISPR-Cas12a-LFD system [7], [34]. No cross-reactivity with other pathogens was observed, confirming the high specificity of the assay.

To ensure the reliability of assay performance evaluation, four reference MP strains were selected for testing: strain 16‑734, strain S355, strain 10‑980, and strain FH 2009. These strains represent the major genetic types (type 1/2) and macrolide resistance phenotypes of MP [43], [44], [45]. Evaluation using reference standards demonstrated that the LoD of ERA-LFD was comparable to that of qPCR, regardless of nucleic acid extraction. The inactivation process likely facilitates nucleic acid release, effectively acting as a crude extraction step, indicating that the ERA-LFD system has inhibitor tolerance comparable to the qPCR system. Successful detection of various MP strains validated this observation. Clinical performance analysis of 158 samples, using a commercial qPCR kit as the comparator, showed high consistency between the two methods. The ERA-LFD assay achieved a specificity of 100.0%, sensitivity of 98.0%, overall agreement of 98.734%, and a Kappa value of 0.973. Two qPCR-confirmed positive samples yielded false-negative results with ERA-LFD; these samples had high Ct values (>35), indicating low bacterial loads. In contrast, ERA-LFD exhibited excellent performance with samples having moderate Ct values—these samples typically represent the primary focus of clinical attention, as they are associated with a higher risk of transmission or active infection. The high specificity ensures the reliability of positive results, effectively avoiding misdiagnosis. The clinical applicability of the proposed method is comparable to amplification-free CRISPR-Cas12a detection [41] and superior to the MP RPA-LFD method [1].

The established ERA-LFD assay is a more cost-effective alternative to isothermal amplification methods coupled with CRISPR systems [30], [42]. It features a wide operational temperature range (35 °C–40 °C) and only requires simple heating equipment (e.g., a water bath or heating block), thereby obviating the need for expensive thermal cyclers [36]. Moreover, the integration of LFD technology enables visual result interpretation, eliminating the requirement for fluorescence detection equipment that is necessary for methods such as real-time fluorescent RAA [46]. All reagents can be pre-stored, requiring only the addition of samples and water, making the assay ideal for resource-limited settings—including remote rural clinics, regions with unstable infrastructure, and field hospitals—where sophisticated equipment and a stable power supply are unavailable. However, the clinical positioning of this method requires clarification. Although the LoD of ERA-LFD is 10 copies/μL, which is higher (i.e., poorer sensitivity) than that of qPCR (0.2 copies/μL), it functions as a highly efficient qualitative screening tool. It may produce false-negative results for samples with extremely low pathogen loads, such as those obtained from the very early stages of infection or asymptomatic carriers. Therefore, if clinical suspicion remains high despite negative ERA-LFD results, confirmation via qPCR is recommended. qPCR remains the gold standard for monitoring convalescent patients and evaluating treatment efficacy, where precise quantitative data are required. In contrast, the rapidity and portability of the ERA-LFD assay make it ideal for mass screening and POCT, allowing for the rapid identification of moderate-to-high pathogen loads to facilitate timely isolation and intervention.

This study has several limitations. First, assay validation in this study was performed using only purified nucleic acids rather than primary clinical specimens (e.g., sputum, throat swabs). Although the established assay demonstrated favorable analytical performance with purified nucleic acids, its diagnostic performance and robustness against matrix interference in real-world clinical settings remain to be further validated. Second, given multiple genetic variants of MP, the established assay only targets conserved sequences and has not been validated against different MP strains and genotypes, making it difficult to confirm its applicability to diverse circulating strains. To address these shortcomings, future studies will include additional validation experiments and further technical system optimization to enhance the method’s scientific rigor, practicality, and experimental support for clinical translation. Third, to further enhance the robustness and applicability of the established method for routine clinical practice, subsequent studies will focus on systematic evaluations of inter-batch reproducibility, inter-operator variability, and reagent stability under diverse storage conditions. In addition, this study lacks integration between nucleic acid extraction and amplification; future work should optimize this process to improve sensitivity for low-load samples. Furthermore, further validation in larger cohorts—including more convalescent patients and diverse sample types (e.g., sputum, bronchoalveolar lavage fluid) [47] — should be performed to verify the consistency between results obtained with the newly developed assay and qPCR. We also aim to explore the combined application of this assay with other clinical indicators and evaluate incubation using body heat to facilitate instrument-free POCT.

In conclusion, this study established a rapid ERA-LFD assay for detecting various MP strains. Optimizing reaction temperature and time enabled rapid, sensitive, and specific MP detection using this assay. These findings indicate that the method could be developed into a robust tool for rapid MP detection in primary hospitals, outpatient clinics, and on-site settings, significantly expanding the application scope of MP nucleic acid detection.

Ethics statement

All studies involving the collection and testing of human clinical samples were reviewed and approved by the Ethics Committee of Nanjing Bioengineering (Gene) Technology Center for Medicines (Approval No. [2025]33).

Supplementary data

The following are the Supplementary data to this article:

Supplementary Data 1

Detection results of qPCR and ERA-LFD for 158 clinical samples.