Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2026 Jul 1;16:20138. doi: 10.1038/s41598-026-55463-3

Carvacrol nanoemulsion as a novel approach to augment H9N2 influenza vaccine efficacy

Humidah Alanazi 1, Marwa I Abd El-Hamid 2, Naglaa F S Awad 3, Azza S El-Demerdash 4,, Naser A ElSawy 5, Abdullah G Al-Kushi 6, Naief A Dahran 7, Banan Atwah 8, Norah K Algarzae 9, Musaad B Alsahly 9, Thamer A Alsufayan 9, Maha Alharbi 10, Nada K Alharbi 10, Mahmoud M Bendary 11,
PMCID: PMC13323989  PMID: 42386832

Abstract

Avian influenza vaccines are essential for preventing seasonal influenza outbreaks and limiting pandemics, but their effectiveness has declined due to antigenic drift and variable immune responses. We hypothesized that carvacrol, particularly in nano-emulsion form, could enhance the avian influenza H9N2 vaccine and reduce the impact of viral challenge. This study evaluated the effect of carvacrol and carvacrol nano-emulsion on avian influenza vaccine efficacy by assessing immunological responses and immunohistopathology in vivo in broiler chickens. Our results showed that carvacrol, especially in its nanoform, significantly enhanced immune responses, as evidenced by increased phagocytic activity, higher hemagglutination titters, and improved immune organ indices. Biochemical analysis revealed significantly elevated levels of the immunomodulatory cytokines IL-10, IL-12, and IFN-γ, along with other immunity-related parameters, and molecular analysis showed upregulation of genes associated with IFN-γ, IL-12, IL-10, TLR4, TLR3, and TLR1. A notable increase in CD3 expression was also observed in key immune organs; the bursa of Fabricius, thymus and spleen suggesting enhanced T-cell-mediated immunity and improved pathogen recognition. The enhanced immunogenicity of influenza vaccine via carvacrol nano-emulsion resulted in stronger protection against avian influenza H9N2 virus ameliorating clinical picture and preserving the structural integrity of lung and trachea post viral challenge. These results emphasize the potential of nano-emulsion technology to strengthen immune responses in poultry and boost the efficacy of avian influenza vaccines, thereby supporting more effective control against influenza virus. Therefore, avian influenza control programs can incorporate carvacrol nano-emulsion as an immune-boosting adjuvant, since nano-emulsion delivery offers a practical tool to enhance existing vaccines without changing vaccination schedules.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-026-55463-3.

Keywords: Inactivated influenza vaccine, carvacrol nano-emulsion, immunomodulation, avian influenza H9N2 virus, immunohistochemistry, cytokines

Subject terms: Biotechnology, Diseases, Immunology, Microbiology

Introduction

Avian influenza, often referred to as bird flu, is considered a significant public health threat with implications for global health security. The hazards posed by avian influenza to human health primarily arise from the potential transmission of the virus from infected birds to humans. This virus primarily circulates among birds, but it can occasionally infect humans through the direct contact with infected birds or their droppings, as well as consumption of undercooked poultry products1. Avian influenza outbreaks among poultry populations can lead to great economic losses in the poultry industry2. Several human illnesses ranging from mild to severe with symptoms similar to those of seasonal influenza such as fever, cough, sore throat, muscle aches, and fatigue were attributed to the infection with avian influenza. However, certain strains of avian influenza viruses, such as H5N1 and H7N9, have been associated with severe respiratory illness and, in some cases, death3. This situation was further complicated by the emergence of resistance to commonly used antiviral medications for treating influenza in chickens and humans, such as oseltamivir (Tamiflu) and zanamivir (Relenza)4. This resistance can hinder efforts to manage and treat avian influenza outbreaks in both poultry and humans. Hence, it is crucial to monitor and control avian influenza outbreaks in poultry, enhance surveillance for human cases, and improve the efficacy of vaccines against emerging avian strains to reduce the risk to poultry and human health.

Despite significant advancements in influenza vaccine development, there remains a substantial gap in achieving optimal immunogenicity and broad-spectrum protection. Traditional vaccines often fall short in eliciting strong and durable immune responses in poultry and humans, particularly in vulnerable populations such as the elderly, immunocompromised individuals, and those with chronic health conditions5. These populations are often the most at risk for severe influenza complications, making the need for more effective vaccines critical. Several strategies can be employed to enhance the overall avian influenza vaccine effectiveness; incorporating adjuvants into vaccine formulation, integrating multiple strains into a single vaccine formulation, using multiple vaccine doses with different delivery methods or preparations, improving the delivery systems for targeting specific immune cells and tissues and administering the vaccine in combination with other vaccines or immunomodulatory agents leading to a more potent immune response and longer-lasting immunity68. Despite various methods announced for enhancing vaccine effectiveness as discussed previously, natural compounds remain the most efficacious approach possessing antimicrobial, anti-inflammatory and immunostimulant properties914. The advantages of natural compounds in enhancing the efficacy of avian influenza vaccines arise from their capacity to provide a wide range of immunomodulatory effects via activating the immune system through distinct mechanisms, which could result in a more extensive immune response to the vaccine15. Moreover, natural compounds often exhibit safety profiles, making them attractive candidates for vaccine adjuvants or immunomodulators.

The growing limitations of conventional control strategies emphasize the need for alternative approaches to manage infectious diseases1619. Carvacrol, a natural compound found mainly in oregano (Origanum vulgare) and thyme (Thymus vulgaris), has gained attention for its broad biological activities20. It exerts immunostimulatory effects by enhancing immune cell activity and regulating cytokine production21, while also displaying anti-inflammatory properties through suppression of pro-inflammatory cytokines22 and antioxidant activity by reducing oxidative stress23. These properties highlight carvacrol as a promising immunomodulatory agent with potential to enhance vaccine efficacy. Nano-emulsion–based delivery systems improve the stability, bioavailability, and efficacy of bioactive compounds, including essential oils. The application of nanotechnology in dietary supplementation has shown promise in enhancing immune responses in poultry24. Several studies report immunostimulatory effects of essential oils in chickens vaccinated with viral vaccines2528. However, the potential of nano-formulated essential oils to enhance viral vaccine efficacy remains largely unexplored.

The central hypothesis of this study is that incorporating carvacrol and carvacrol nano-emulsion into the influenza vaccination regimen will restore and optimize the immunogenic efficiency of the vaccine. This restoration is expected to be reflected by adequate antibody titters, balanced cellular immunity, and effective overall protection. We anticipate that these regimens will re-establish appropriate humoral and cell-mediated responses and support functional memory responses, leading to reliable protection against avian influenza virus (AIV). The objective of this study is to elucidate the mechanistic pathways by which carvacrol and its nano-emulsion potentiate and restore the immune response of broiler chickens to the avian influenza vaccine, through measurement of antibody and cytokine titers, immune cell markers, and phagocytic index, with emphasis on the overall protective effectiveness against AIV challenge in an in vivo model.

Materials and methods

Ethical statement

All animal procedures were reviewed and approved by the Research Ethics Committee of the Faculty of Pharmacy, Port Said University (REC.PHARM.PSU) under protocol REC.PHARM.PSU-22. We conducted all procedures in accordance with relevant national regulations and institutional animal care and welfare guidelines. We reported this study in line with the ARRIVE 2.0 reporting guidelines.

Vaccines

The vaccines used in this experimental study are Hitchiner B1 + IB vaccine (CEVA-Phylaxia), IBD vaccine (CEVA-Phylaxia) and inactivated H9N2 vaccine (Nobilis® influenza H9N2 + ND).

Carvacrol and carvacrol nano-emulsion

Carvacrol was supplied from Sigma-Aldrich, Germany and carvacrol nano-emulsion was kindly provided by the Microbiology Lab at the Drug Radiation Research Department, Egyptian Atomic Energy Authority, Cairo, Egypt, where it was prepared and documented.

Challenge virus

Low pathogenic avian influenza H9N2 subtype HN strain was kindly supplied from the Animal Health Research Institute, Dokki, Giza, Egypt.

Experimental birds and design

Three hundred 1-day-old Ross 308 broiler chicks (Gallus gallus domesticus) were purchased from a local commercial hatchery and randomly assigned into 5 groups (three replicates/group and 20 birds/replicate) as following: negative control, NC (untreated, unvaccinated, and unchallenged), positive control, PC (untreated, unvaccinated, and challenged) and other three vaccinated and challenged ones; untreated (V), treated with either carvacrol (VC) or carvacrol nano-emulsion (VN). All broiler chicks were intraocularly vaccinated with Hitchiner B1 + IB vaccine at three-day-old, and IBD vaccine at ten-day-old. The inactivated H9N2 vaccine was subcutaneously injected for all chickens in the vaccinated groups at the age of 7 days according to the vaccine manufacturer’s instructions. Birds in treated groups were fed control diets supplemented with either carvacrol or carvacrol nano-emulsion at concentrations of 1% for 28 days of age. The feeding schedule consisted of starter (1–10 days), grower (11–24 days), and finisher (25–38 days) diets formulated, in the mash form, to meet the nutrient supplies consistent with Ross 308 rearing rules29. All birds had admittance feed and water ad libitum during the experimental study period. After 21 days of vaccination (28 days of age), the challenged birds were intranasally inoculated with 0.2 mL of 108 egg infective dose 50 (EID50) avian influenza H9N2 virus. The birds were then regularly monitored for two weeks for any mortalities or clinical signs specific to the avian influenza disease.

Sampling

For serum separation, blood samples without anticoagulant were collected from six randomly selected birds per group. Each treatment group consisted of 60 birds distributed into three replicates (20 birds per replicate). For immunological gene expression, serum collection, and histopathological examinations, three birds were randomly selected from each replicate, resulting in a total sample size of nine birds per treatment group (n = 9/group). The collected blood samples were centrifuged at 1,500 × g for 10 min, and the separated serum was stored until further analysis of immune and oxidative stress-related markers. Moreover, blood samples were gathered using an anticoagulant for evaluating the phagocytic activity (PA) and phagocytic index (PI). Three randomly selected birds from each group were anesthetized and sacrificed. We sedated broiler chicks (Gallus gallus domesticus) by weighing each bird on the procedure day and recording age and body weight. Anesthesia was induced with ketamine (10 mg/kg) plus diazepam (2 mg/kg) administered intramuscularly into the pectoral muscle. Anesthetic depth was assessed using a predefined sedation scale, while heart rate was measured by auscultation and respiratory rate was measured by observing pectoral movements30. Once adequate anesthesia was confirmed, birds were humanely euthanized (slaughtered) according to ethical guidelines. After that, the spleen, thymus and bursal tissues were aseptically collected and used for assessing immune organs’ indices and immunohistopathological pictures, whereas spleen samples were used for subsequent gene expression analysis. Furthermore, tracheal and lung tissues from sacrificed birds were subjected to histopathological examination post challenge with avian influenza H9N2 virus.

Evaluation parameters

Hemagglutination inhibition (HI) test

Serum samples were collected from zero-day-old chicks after humane slaughtering to measure maternally derived antibodies specific to H9N2 virus. Thereafter, serum samples were collected weekly from six randomly selected birds per group (two birds per replicate) for the HI test throughout the experimental period. The collected serum samples were heat inactivated at 56° C for 30 min, serially diluted and incubated with 4 HAU of H9 virus in a microtiter plate. After that, 1% chicken red blood cells suspension was added, and HI titer was determined as the highest dilution of serum that inhibited hemagglutination. This assay included positive and negative control sera and was conducted in triplicate for consistency31. A higher HI titer indicates a stronger immune response and greater immunity to the virus. In the present study, HI titers were analyzed using appropriate statistical methods for repeated measurements, and multiple comparison post-hoc tests were applied to reduce the risk of type I error. Statistical significance was considered at p < 0.05, and differences among groups at each time point are indicated using different superscript letters. However, in interpreting the results, emphasis was placed not only on statistical significance but also on overall biological trends across time points. This approach was adopted to avoid overinterpretation of minor statistical variations and to ensure that conclusions are primarily based on consistent and biologically relevant differences in antibody responses.

Phagocytosis assay

At 28 days of age, the collected blood samples were subjected to assess the phagocytic activity of peripheral blood monocytes using Candida albicans following the protocols described previously32. Peripheral blood mononuclear cells were isolated using Ficoll-Hypaque density gradient centrifugation. The mononuclear cell layer was collected, washed and resuspended in RPMI-1640 medium supplemented with 10% fetal calf serum. Cell viability was determined and then phagocytic percentage and phagocytic index were calculated. The phagocytic index was calculated using the following formula: phagocytic index = (total number of engulfed Candida albicans cells ÷ total number of counted macrophages) × (number of macrophages containing engulfed cells ÷ total number of counted macrophages) × 100, where engulfed cells refer to Candida albicans yeast cells internalized by monocytes/macrophages during the assay.

Immune organ indices

At 28 days of age, spleen, thymus, and bursa of sacrificed chickens were collected and their weights were recorded for estimating the indices of these immune organs based on this formula: immune organ indices = weight of organ (g)/weight of chicken (Kg). Additionally, relative immune organ ratios were determined by calculating bursa/spleen, thymus/spleen, and bursa/thymus ratios for each group, reflecting the proportional relationship between these immune organs.

Evaluating oxidative stress and immune related indices

At 14, 21 and 28 days of age, oxidative stress and immune related indices were measured in the gathered serum samples. Lysozyme, nitric oxide (NO), superoxide dismutase (SOD), total antioxidant capacity (TAC), and malondialdehyde (MDA) levels were measured using commercially available assay kits (Nanjing Jiancheng Bioengineering Research Institute, Nanjing, China) following the manufacturer’s instructions.

Cytokines quantification

Cytokines [interleukin (IL)-1, IL-6, IL-10, IL-12, interferon gamma (IFN-γ), and tumor necrosis factor-α (TNF-α)] levels were quantified in collected serum samples at 48 h and one, two, and three weeks post-vaccination using commercial ELISA kits from MyBioSource. The kits used were Cat. No. MBS2701076 and MBS700413, with a detection range of 15.6–1000 pg/mL and sensitivities of < 5.5 pg/mL and < 3.9 pg/mL, respectively, following the manufacturer’s protocols. This included preparing standards, adding samples and detection antibodies, washing, substrate addition, and absorbance measurement at 450 nm. Optical density measurements were taken at 450 nm using an ELISA Microplate reader (Stat Fax 3200)33,34.

Gene expression analysis

At three weeks post vaccination (28 days of age), RNA extraction from spleen samples was applied using QIAamp RNeasy Mini kit (Qiagen, Germany, GmbH), where 200 µL of the sample were added to 600 µL of RLT buffer containing 10 µL of β-mercaptoethanol per 1 mL and then the mixture was incubated at room temperature for 10 min. One volume of 70% ethanol was added to the cleared lysate, and the steps were completed according to the kit’s total RNA purification protocol. On column, DNase digestion was done to remove residual DNA. The oligonucleotide primers encoding IL-1, IL-6, TNF-α, IFN-γ, IL-12, IL-10, toll-like receptor (TLR)1, TLR3 and TLR4 genes were supplied from Metabion (Germany) and are listed in Table 1. Primers were utilized in a 20 µL reaction volume containing 10 µL of 2X HERA SYBR® Green RT-qPCR Master Mix (Willowfort, UK), 1 µL of RT Enzyme Mix (20X), 1 µL of each primer of 20 pmoL concentration, 2 µL of water, and 5 µL of RNA template. The reaction was performed in StepOne real time PCR machine in the Biotechnology Unit, Animal Health Research Institute, Zagazig Branch and amplification curves and ct values were determined by the StepOne software. The expression levels of the transcripts were normalized using β-actin gene as an internal control. The relative mRNA expression levels of the analyzed genes were determined according to the ΔΔCt method stated previously using the following ratio (2-ΔΔct)35.

Table 1.

Primers sequences and target genes utilized in expression analysis.

Target gene Primers sequences Reference
β-actin

F: CAACACAGTGCTGTCTGGTGG

R: ATCGTACTCCTGCTTGCTGAT

Abdul-Careem et al. (2008)
IL-6

F: CCCGCTTCTGACTGTGTTT

R: GCCGGTTTTGAAGTTAATCTTT

Strong et al., (2015)
IFN - γ

F: TCAAGGACGGCACAGTTCAT

R: GCGGCTCAGGACTCTGGA

Schreiber et al., 1982
TNF-α

F: CCCCTACCCTGTCCCACAA

R: ACTGCGGAGGGTTCATTCC

Strong et al., (2015)
TLR1

F: CTGTCTTGCCAATCTGTC

R: GTGAAGGCTCCGTGTATT

Lu et al., (2009)
IL-1

F: TGCTGGTTTCCATCTCGTATGTAC

R: CCCAGAGCGGCTATTCCA

Strong et al., (2015)
TLR3

F: GAGTTTCACACAGGATGTTTAC

R: GTGAGATTTGTTCCTTGCAG

Jiao et al. (2012)
TLR4

F: ACCCATTGTCACCAACATCATC

R: TGCCTCAGCAAGGTCTTATTCA

Jia et al. (2012)
IL-10

F: GCTGTCATGGTCTTGGGAG

R: GCCCTGGAGAACTGCAGAA

Moore et al., (2001)
IL-12

F: GCCAGGTTTGTGCTGAGAGT

R: CCATGGCTCTTGTTGAGGAC

Trinchieri (2003)

IL: interleukin, TNF-α: tumor necrosis factor-α, IFN-γ: interferon gamma, TLR: toll-like receptor.

Immunohistochemistry

At 14, 21 and 28 days of age, paraffin sections from thymus, bursa, and spleen tissues of chickens from various groups were subjected for immunohistochemistry (IHC) staining following the previous described method36 using a Rat Monoclonal Anti-CD3 antibody (AB11089) at a 1:100 dilution (Abcam, Cambridge, UK). The tissue sections from all experimental groups were dewaxed, hydrated, and stained according to the manufacturer’s protocols using the DAB chromogenic agent (Expose Mouse and Rabbit Specific HRP/DAB Detection IHC Kit, Abcam, Cat. No. ab80436) and counterstaining was performed with hematoxylin. Three immuno-labelled sections were analyzed per bird and images of the IHC-stained sections were captured using a Swift microscope equipped with a Swift digital camera. For quantitative analysis, five representative areas were selected including both positive cell areas and areas without expression. Areas with varying abundances of stained cells were included in the analysis and individual cells, identified by a strong brown stain, were manually counted. The expression of CD3 in immune organs was assessed using a semi-quantitative scoring system based on the distribution and intensity of positively stained cells. Staining was evaluated under high-power fields (HPFs) and categorized as follows: negative (–), rare positive cells (+/–), few positive cells (+), moderate positivity (++; positive cells in < 50% of HPFs), strong positivity (+++; positive cells in 50–75% of HPFs), and very strong positivity (++++; positive cells in > 75% of HPFs). For each tissue section, multiple HPFs were examined, and the final score was assigned based on the predominant staining pattern observed. This semi-quantitative approach was used to compare CD3 expression levels among different experimental groups.

Histopathological examination

Histopathological examination was conducted on thymus and bursal tissues of sacrificed chickens at 14, 21 and 28 days of age and on lung and tracheal specimens five and ten days post viral challenge. These specimens were then immersed in a 10% neutral buffered formalin solution for 24 h, followed by a thorough washing with water. Subsequently, they underwent dehydration through a series of ethyl alcohol solutions with varying concentrations (70%, 90%, and 100%), were cleared in xylene, and finally, embedded and encased in paraffin wax. Using a microtome (Leica RM 2155, London, UK), the paraffin-embedded blocks were sliced into sections approximately 4–5 μm thickness. These sections were then subjected to routine staining with hematoxylin and eosin (H&E) for histopathological examination under light microscope. following the protocol outlined elsewhere37. Quantitative morphometric evaluation of bursal follicles in the different experimental groups was conducted using ImageJ software, Version 1.47d, National Institutes of Health [NIH], Bethesda, Maryland, USA, 2013, (https://imagej.nih.gov/ij/download.html). Histological sections were photographed under uniform microscopic settings, and the obtained digital images were analyzed using the software’s calibration and measurement functions. Prior to analysis, the program was calibrated using the microscope scale bar to ensure precise measurements. Several morphometric parameters, including follicular diameter, follicular area, cortical thickness, medullary thickness, and corticomedullary ratio, were assessed from multiple randomly selected non-overlapping fields. The collected measurements were then automatically recorded and prepared for statistical analysis.

Statistical analysis

All results were analyzed via the SPSS Inc. software version 26 (IBM Corp., Armonk, NY, USA) (https://www.ibm.com/support/pages/downloading-ibm-spss-statistics-26-transition-extended-support-30-sep-2025?utm_source=openai ). The normality and homogeneity among the experimental chicken groups were determined utilizing Shapiro–Wilk’s and Levene’s tests, respectively. The results of experimental trials were expressed as means ± standard error of the mean (SEM) and analysis of variance (ANOVA) and Tukey’s tests were employed to evaluate the significant variations between the mean values. When the p value was lower than 0.05, statistically significant variations were considered. All graphs were prepared via the GraphPad Prism software Version 8 (San Diego, USA) (https://www.graphpad.com/guides/prism/8/pdf/Prism-8-User-Guide.pdf? utm_source=openai), and R-software version 4.3.3 using the heatmap package (https://www.r-project.org/index.html? utm_source=openai)38,39.

Results

Hemagglutination inhibition antibody titers

Considering HI titers (log2) of AIV antibodies across various chicken broiler groups (Fig. 1), the average level of maternally derived antibodies against avian influenza H9N2 virus was 8.0 ± 0.72, which declined over time in the nonvaccinated control groups reaching 2 log 2.9 ± 0.54 and 3.1 ± 0.64 in NC and PC groups, respectively at the challenge day (28 days old). At zero, and seven days of age, there were no statistically significant differences in the HI titers of AIV antibodies among different experimental groups (p = 1 and 0.635, respectively). Meanwhile, Significant differences in AIV antibody HI titers were observed among the experimental groups at 14, 21, and 28 days of age. At all time points (14,21,28 days), both the VN and VC groups showed significantly higher (p < 0.01) titers than the control groups, with no significant difference between the two treated groups. At the challenge day, vaccinated untreated birds exhibited higher HI titers (2 log 5.9 ± 0.58) than the non-vaccinated control groups (NC and PC). The addition of carvacrol, in either free or nano-formulated form, to the avian influenza (H9N2) vaccine resulted in increased HI antibody titers (2 log 6.4 ± 0.75 and 2 log 6.9 ± 0.76, respectively) compared with vaccination alone, with a more pronounced response observed in the nano-carvacrol (VN) group. Notably, seven days post-challenge (35 days of age), the PC group showed a marked elevation in HI titers (2 log 12.7 ± 0.82). In contrast, administration of carvacrol or nano-carvacrol with the vaccine in the VC and VN groups resulted in lower post-challenge seroconversion than the vaccine-only group (V), with HI titers of 2 log 8.7 ± 0.82 and 2 log 7.3 ± 0.76, respectively, compared with 2 log 9.4 ± 0.73 in the V group, with the lowest significant (p < 0.001) titers observed in the VN group. Significant differences in HI antibody titers were observed among different time points within each experimental group (p < 0.0001) (Supplementary Table S1).

Fig. 1.

Fig. 1

Hemagglutination inhibition (HI) titer (log2) of avian influenza virus antibodies in negative control (NC), positive control (PC), vaccinated untreated (V), vaccinated carvacrol treated (VC) and vaccinated carvacrol nanoemulsion treated (VN) chicken groups throughout the experimental period. Results are expressed as means ± standard error of the mean (SEM) at each observation time. a−d Means with different superscript letters indicate significant differences at p < 0.05.

Phagocytic activities

The phagocytic activities in various chickens groups that were either vaccinated only against AI virus or vaccinated and treated with carvacrol or carvacrol nano-emulsion are illustrated in Fig. 2. There were significant differences in the phagocytic indices and phagocytic percentage among different experimental groups (p < 0.0001). At 28 days old, the unvaccinated and untreated group had the lowest phagocytic percentage (25%) and phagocytic index (1.19). In contrast, chickens vaccinated and treated with carvacrol showed enhanced phagocytic functions, with a percentage of 31% and an index of 1.27. However, those vaccinated and treated with carvacrol nano-emulsion exhibited the highest significant (p < 0.0001) phagocytic activity achieving a percentage of 38% and an index of 1.38. Of note, the vaccinated group had a phagocytic percentage of 28% and an index of 1.25, which were higher than those in the unvaccinated group and lower than those in the vaccinated and carvacrol or its nanoform treated groups.

Fig. 2.

Fig. 2

Effects of different treatments on thymus (A), spleen (B), bursa (C) and phagocytic (D) indices and phagocytic percentage (E) among negative control (NC), positive control (PC), vaccinated untreated (V), vaccinated carvacrol treated (VC) and vaccinated carvacrol nanoemulsion treated (VN) chicken groups. Results are expressed as means ± standard error of the mean (SEM). a−d Means with different superscript letters indicate significant differences at p < 0.05.

Immune organ indices

The immune organ indices among the different chicken groups are illustrated in Fig. 2. Significant differences were observed in the thymus, spleen, and bursa indices among the experimental groups (p < 0.0001). The NC group showed the lowest baseline indices for the thymus, spleen, and bursa of Fabricius (0.14, 0.18, and 0.10, respectively). In contrast, the vaccinated chickens treated with carvacrol nano-emulsion (VN group) exhibited the highest immune organ indices, recording values of 0.35, 0.40, and 0.34 for thymus, spleen, and bursa, respectively. This was followed by the vaccinated carvacrol-treated group (VC), with corresponding values of 0.28, 0.36, and 0.30, respectively. Moreover, the relative organ ratios also varied among the groups. The NC group showed bursa/spleen, thymus/spleen, and bursa/thymus ratios of 0.56, 0.78, and 0.71, respectively. In the V group, the corresponding ratios were 0.79, 0.69, and 1.15. The VC group recorded ratios of 0.83, 0.78, and 1.07, whereas the VN group showed the highest ratios of 0.85, 0.88, and 0.97, respectively. Compared with the NC group, the VN group demonstrated significantly higher thymus indices (p < 0.0001), while both VN and VC groups showed significantly increased spleen and bursa indices (p < 0.0001) with no significant differences between them. These findings suggest improved immune organ development and immune status in the treated and vaccinated groups, particularly in the VN group.

Oxidative stress and immunity related attributes

The effects of carvacrol and its nano-emulsion on oxidative stress across various chicken groups over time starting from 14 till 28 days of age (before the challenge) are shown in Fig. 3. There were statistically significant differences in MDA, NO, TAC, SOD, and lysozyme activities of broilers among different experimental groups at 14, 21, and 28 days of age (p < 0.0001). The vaccinated group treated with carvacrol nano-emulsion demonstrated the lowest levels of oxidative stress related markers and the highest antioxidant activities unlike the vaccinated only and vaccinated and carvacrol treated groups at all time intervals. Birds in the VN group showed the most significant (p < 0.0001) decrease in the MDA activity and the highest significant (p < 0.0001) TAC and SOD activities when compared with the NC group at 14, 21, and 28 days of age. At 28 days of age, the vaccinated group had higher MDA and NO (132.4 nmol/L and 15.33 µmol/L, respectively) and lower TAC, SOD and lysozyme (438 µmol/L, 102 U/L and 39 U/mL, respectively) levels when compared with both vaccinated and carvacrol or carvacrol nano-emulsion treated groups. Specifically, the vaccinated and carvacrol nano-emulsion treated group had the lowest significant (p < 0.0001) MDA (110.6 nmol/L) and the highest significant (p < 0.0001) TAC and SOD (723 µmol/L and 134 U/L, respectively) levels. Moreover, birds in the VN and VC groups showed the highest significant (p < 0.0001) lysozyme activities and the lowest significant (p < 0.0001) NO activities with no significant difference between them when compared with the NC group. There were significant differences in the MDA, NO, TAC, SOD and lysozyme activities among different time points (p < 0.01) within each experimental group.

Fig. 3.

Fig. 3

Effects of different treatments on malondialdehyde (MDA, A), nitric oxide (NO, B), total antioxidant capacity (TAC, C), superoxide dismutase (SOD, D), and lysozyme (LYZ, E) activities among negative control (NC), positive control (PC), vaccinated untreated (V), vaccinated carvacrol treated (VC) and vaccinated carvacrol nanoemulsion treated (VN) chicken groups. Results are expressed as means ± standard error of the mean (SEM). a−c Means with different superscript letters indicate significant differences at p < 0.05.

Cytokines levels using ELISA assay

The quantitative analysis of cytokine levels including proinflammatory cytokines (IL-1, IL-6 and TNF-α) and other immunomodulatory cytokines (IL-12, IL-10 and IFN-γ) was conducted using ELISA technique. There were significant differences in the IL-1, IL-6, TNF-α, IL-12, IL-10 and IFN-γ activities among different experimental groups (p < 0.0001) at different time points. Moreover, there were significant differences in their activities among different time points (p < 0.0001) within each experimental group. As illustrated in Fig. 4 and Supplementary Table S2, all groups exhibited distinct cytokine patterns with levels peaking at 48 h post vaccination and gradually declining over the subsequent weeks. The proinflammatory cytokines showed a marked increase during the first 48 h post vaccination across all vaccinated groups. This was followed by a noteworthy decline at one week post vaccination comparable to the NC group and then stabilized at two and three weeks post vaccination. Notably, the vaccinated group treated with carvacrol nano-emulsion exhibited the lowest significant (p < 0.0001) levels of proinflammatory cytokines, followed by that treated with carvacrol alone comparing to the vaccinated only one (up to 0.5, 1 and 1 pmol/L, respectively). Unlike the NC group, levels for other immunomodulatory cytokines increased sharply across all experimental ones reaching their peaks at 48 h post vaccination and then gradually decreased. Of note, the vaccinated group treated with carvacrol nano-emulsion revealed the highest significant (p < 0.0001) immunomodulatory cytokine levels throughout various time intervals (up to 15 pmol/L).

Fig. 4.

Fig. 4

Effects of different treatments on the activities of interleukin-1 (IL-1, A), IL-6 (B), tumor necrosis factor-α (TNF-α, C), IL-12 (D), IL-10 (E) and interferon gamma (IFN-γ, F) cytokines using ELISA assay. Results are expressed as means ± standard error of the mean (SEM). a−d Means with different superscript letters indicate significant differences at p < 0.05.

Gene expression profiles

The gene expression results based on the fold change values revealed distinct patterns, which was in the line of quantitative determination with ELISA technique (Fig. 5). There were significant differences in the expression levels of IL-1, IL-6, TNF-α, IFN-γ, IL-12, IL-10, TLR1, TLR3 and TLR4 genes among different experimental groups (p < 0.0001). For proinflammatory cytokines, the NC group showed baseline expression levels of IL-1, IL-6 and TNF-α (fold change of 1). The vaccinated groups displayed upregulated levels of the investigated IL-1, IL-6 and TNF-α proinflammatory cytokines with the lowest values recorded for that treated with carvacrol nano-emulsion (1.5, 1.4 and 1.5- fold, respectively) comparable with VC (1.7, 1.7 and 1.8-fold, respectively) and V (1.9, 2.1 and 2-fold, respectively) groups. Statistically, birds in V group showed the highest significant (p < 0.0001) upregulation of IL-6 gene, while those in VC and V ones showed the highest significant (p < 0.0001) upregulation of IL-1 and TNF-α genes.

Fig. 5.

Fig. 5

Heatmap showing the effects of carvacrol and its nano-emulsion on the expression level of immune-related genes among negative control (NC), positive control (PC), vaccinated untreated (V), vaccinated carvacrol treated (VC) and vaccinated carvacrol nanoemulsion treated (VN) chicken groups. IL: interleukin, TNF-α: tumor necrosis factor-α, IFN-γ: interferon gamma, TLR: toll-like receptor. Color-code on the right of the heatmap refers to the fold change in the expression of the investigated genes.

The expression results for IFN-γ, IL-12, IL-10, TLR4, TLR3 and TLR1 immunomodulatory genes based on fold change values revealed distinctive patterns among various experimental groups as clarified in Fig. 5. The NC group showed baseline expression levels for all measured genes with fold change of 1, while all vaccinated ones revealed higher expression levels for these genes. Interestingly, the VN group displayed the highest relative expression levels of IFN-γ, IL-12, IL-10, TLR4, TLR3 and TLR1 genes (4, 3.5, 3.2, 4, 3 and 3.5- fold, respectively). Meanwhile, moderate expression levels for the preceding genes were noted in VC (3, 2.9, 2.9, 3, 2 and 3.1-fold, respectively), followed by V (2.4, 2.4, 2.4, 3, 1.9 and 2.7-fold, respectively) groups. Statistically, birds in VN group showed the highest significant (p < 0.0001) upregulation of IFN-γ, IL-12, TLR1, TLR3 and TLR4 genes, while those in VC and VN ones showed the highest significant (p < 0.0001) upregulation of IL-10 gene.

Immunohistochemistry

Thymus gland

Table 2 illustrates the distribution and intensity of CD3 positive labeling in the immune organs of chickens across different experimental groups. Generally, CD3 was generally detected on the cell membrane and in the cytoplasm of T lymphocytes with higher concentration of positive stained cells in the cortical region compared to the medulla across VN, VC, V and NC experimental groups. At 14 days of age (Fig. 6I; A-D), CD3 staining revealed a slight increase in positive stained cells within thymic nodules in VN group comparing with VC, V and NC ones. By 21 days of age (Fig. 6II; A-D), a moderate number of labeled cells were present in both cortical and medullary lymphoid follicles in VN group that decreased progressively in VC, V and NC ones. Notably, the highest intensity of CD3 staining with the most abundant positive labeled cells was observed in VN group unlike the VC, V and NC groups at 28 days of age (Fig. 6III; A-D).

Table 2.

Distribution and intensity of positive labeled CD3 in immune organs of chickens among different experimental groups.

Age (days) Group Thymus Bursa Spleen
C M FAE C M PELS RP GC
14 VN +++ ++ ++ + +/- +++ + +
VC ++ ++ + + +/- ++ + +/-
V ++ + + +/- +/- + + +/-
NC + + + +/- +/- + + -
21 VN +++ +++ +++ + + +++ ++ +
VC +++ ++ ++ + +/- ++ ++ +
V ++ + + + +/- ++ + +
NC + + + +/- +/- + + +/-
28 VN ++++ +++ ++++ ++ + ++++ +++ +
VC +++ +++ +++ + + ++++ ++ +
V +++ ++ ++ + +/- +++ ++ +
NC ++ + + +/- +/- + + +

VN: vaccinated carvacrol nanoemulsion treated, VC: vaccinated carvacrol treated, V: vaccinated untreated, NC: negative control, C: cortex, M: medulla, FAE: follicle-associated epithelium, PELS: peri-ellipsoidal lymphoid sheath, RP: red pulp, GC: germinal center, -: no labelling; +/-: rare positive cells, +: few positive cells, ++: positive cells in < 50% of all high-power fields, +++: positive cells in 50–75% of high-power fields, ++++: more positive cells in > 75% of high-power fields.

Fig. 6.

Fig. 6

Photomicrographs of immunostained sections of thymus against CD3 at 14 (I), 21 (II) and 28 (III) days of age in vaccinated carvacrol nanoemulsion treated (A), vaccinated carvacrol treated (B), vaccinated untreated (C) and negative control (D) groups. The positive expressed cells revealed golden brown color. The IHC counterstaining was carried out using Mayer’s haematoxylin.

Bursa of fabricius

At all-time points, immunostaining of bursa sections revealed scarce medullary and little cortical CD3 expression with positive cells primarily observed at the follicle associated epithelium (FAE). At 14 days of age (Fig. 7I; A-D), more abundant positive stained cells were noted at the FAE in VN group than VC, V and NC ones. At this interval, the number of labeled cells at the FAE was lower in comparison with the other two intervals (21 and 28 days of age). At 21 days of age (Fig. 7II; A-5D), there was an increase in the number of positive stained cells at the FAE, particularly in VN group, which was decreased gradually in other groups. By 28 days of age (Fig. 7III; A-6D), peak CD3 expression, in both medulla and cortex, at the FAE was perceived in VN group with a gradual decline in VC, followed by V and NC ones.

Fig. 7.

Fig. 7

Photomicrographs of immunostained sections of bursa of Fabricius against CD3 at 14 (I), 21 (II) and 28 (III) days of age in vaccinated carvacrol nanoemulsion treated (A), vaccinated carvacrol treated (B), vaccinated untreated (C) and negative control (D) groups. The positive expressed cells revealed golden brown color. The IHC counterstaining was carried out using Mayer’s haematoxylin.

Spleen

In immunohistochemically stained sections of spleen, CD3 signals were generally most abundant at the peri-ellipsoidal lymphoid sheath (PELS) with moderate positive signals observed in the red pulp (RP) and fewer ones in the germinal center (GC) across all intervals (Fig. 8I-III). At 14 days, a slight increase in CD3 labeling was noted, particularly in VN group comparing with VC, V and NC ones. This labeling density was increased by time till reached the strongest CD3 expression at 28 days of age.

Fig. 8.

Fig. 8

Photomicrographs of immunostained sections of spleen against CD3 at 14 (I), 21 (II) and 28 (III) days of age in vaccinated carvacrol nanoemulsion treated (A), vaccinated carvacrol treated (B), vaccinated untreated (C) and negative control (D) groups. The positive expressed cells revealed golden brown color. The IHC counterstaining was carried out using Mayer’s haematoxylin.

In summary, the highest proportion of CD3 positive cells and staining intensity in all lymphoid tissues was observed at 28 days of age with a partial decline in immunolabeling noted at 21 days of age and further reduction at 14 days of age. Across all intervals, VN group consistently exhibited the strongest staining intensity in all lymphoid tissues. Moreover, VC group showed a moderate decline in immunolabeling, followed by V and then NC ones. Table 2 illustrates the distribution and intensity of CD3 positive labeling in the immune organs of chickens across various experimental groups.

Immunohistopathological findings

Histopathological and morphometric examination of the bursa of Fabricius showed progressive development of lymphoid tissues with different responses among the experimental groups. At 14 days of age, all groups showed normal bursal mucosa lined by pseudostratified columnar epithelium containing goblet cells (Fig. 9I; A–D). Normal lymphoid follicles with clear cortical and medullary regions were observed in the VN, VC, V, and NC groups. The VN group showed a noticeable increase in lymphoid cells, especially in the medullary region, while the VC, V, and NC groups showed smaller lymphoid follicles. Morphometric analysis supported these findings, as the VN group recorded the highest cortical thickness (51.75 μm), medullary thickness (115.25 μm), and total follicular thickness (217.25 μm). The VC group showed slightly lower values (41.00, 110.50, and 213.50 μm, respectively), while the V and NC groups showed the lowest measurements. In general, the follicles at this age were smaller than those seen at later ages.

Fig. 9.

Fig. 9

Photomicrographs of H&E stained sections of bursa of Fabricius at 14 (I), 21 (II) and 28 (III) days of age in vaccinated carvacrol nanoemulsion treated (A), vaccinated carvacrol treated (B), vaccinated untreated (C) and negative control (D) groups, scale bar 100 μm. C and M: cortical and medullary regions of bursal follicles.

At 21 days of age, the normal structure of the bursal mucosa and follicles was maintained in all groups (Fig. 9II; A–D). The VN group showed a moderate increase in lymphoid follicle size, particularly in the medullary area. Mild interstitial edema around enlarged lymphoid follicles was observed in the VC, V, and NC groups. Morphometric measurements showed a clear increase in follicular size compared with the previous age. The VN group continued to show the highest values for cortical thickness (48.00 μm), medullary thickness (221.75 μm), and total follicular thickness (338.25 μm). Slightly lower values were observed in the VC group, while the V and NC groups showed comparatively lower measurements.

At 28 days of age (Fig. 9III; A–D), all vaccinated groups showed preserved epithelial structure and enlarged active lymphoid follicles. The VN group had the largest follicles with dense accumulation of B-lymphocytes in the medulla and cortico-medullary junction. In contrast, a gradual decrease in lymphoid cell density was observed in the VC, V, and NC groups. Of note, the VN group showed the greatest improvement in bursal lymphoid activity, followed by VC, V, and finally NC groups. Morphometric analysis confirmed these observations, where the VN group showed the highest total follicular thickness (394.75 μm), followed by the VC group (386.00 μm). Lower values were recorded in the V and NC groups. Medullary thickness was also markedly higher in the VN and VC groups compared with the V and NC groups.

Regarding the thymus, histopathological examination at 14 days of age showed normal thymic lobules separated by connective tissue septa into cortical and medullary regions in all groups (Fig. 10I; A–D). The cortex contained densely packed darkly stained T lymphocytes, while the medulla contained fewer lymphocytes and more thymic epithelial cells. The VN group showed a mild increase in lymphocyte numbers within thymic nodules, whereas gradual reduction in cortical thickness was observed in the VC, V, and NC groups. Morphometric analysis revealed the highest cortex/medulla ratio in the VN group (0.92), followed closely by the VC group (0.91), while lower ratios were recorded in the V and NC groups. Generally, the cortical lymphoid tissue at this age appeared thinner than at later stages.

Fig. 10.

Fig. 10

Photomicrographs of H&E stained sections of thymus at 14 (I), 21 (II) and 28 (III) days of age in vaccinated carvacrol nanoemulsion treated (A), vaccinated carvacrol treated (B), vaccinated untreated (C) and negative control (D) groups, scale bar 100 μm. C and M: cortical and medullary regions of thymic lobules.

At 21 days of age, normal thymic architecture with preserved cortical and medullary regions was observed in all groups (Fig. 10II; A–D). Increased proliferation of immature lymphocytes, especially in the cortex, was more obvious in the VN group. The thickness and activity of cortical lymphoid tissue gradually decreased from VN to VC, V, and NC groups. Morphometric findings confirmed these observations, as the VN group showed the highest cortex/medulla ratio (1.03), followed by the VC, V, and NC groups.

At 28 days of age, all groups maintained normal thymic structure with active proliferation of thymocytes in the cortex (Fig. 10III; A–D). The VN group showed the highest cortical activity and the greatest cortex-to-medulla ratio compared with the other groups and earlier time points. Of note, thymic lymphoid activity was strongest in the VN group, followed by VC, V, and finally NC groups. Morphometric analysis confirmed this finding and showed the highest cortex/medulla ratio in the VN group (1.22), followed by the VC group (1.19), while lower ratios were recorded in the V and NC groups.

Evaluation parameters in response to avian influenza H9N2 virus challenge

Clinical and gross findings

Our findings announced that all chickens in NC group had no remarkable clinical signs, mortalities and abnormal gross changes throughout the whole experimental period. In contrast, chickens in PC group showed various respiratory manifestations in the form of nasal and ocular discharges, sneezing, coughing, conjunctivitis and general depression with reduced feed consumption and average body weight. Notably, the other vaccinated chickens demonstrated milder clinical signs with the lowest detectable signs observed in VN group. Mortality rates reached up to 7% in PC birds, while they decreased in other vaccinated experimental ones till reached 0% in VN group. The challenged broilers treated with carvacrol, despite being vaccinated, experienced even lower mortality rates (2%). The postmortem outcomes of the inspected birds revealed congestion of trachea and lung, inflammation of bursa of Fabricius, splenomegaly and inflamed kidneys. Birds in PC group exhibited a severe degree of these gross lesions, while those in other vaccinated groups showed lesser degrees with no observable lesions in VN one.

Histopathological picture

Assessing the histopathological findings of the trachea (Fig. 11), sections examined from the PC group five days post challenge revealed acute tracheitis characterized by congested blood vessels alongside necrotic and desquamated tracheal epithelium within the tracheal lumen as well as intense leukocytic infiltration, primarily lymphocytes, in the submucosal layer. Conversely, the V group exhibited focal areas of lymphocytic aggregates in the submucosal layer and mildly dilated vasculature. Moreover, the VC group displayed mild leukocytic infiltration within the tracheal epithelium and lamina propria alongside metaplastic changes in mucosal the glands. Notably, the VN group showed improvement in the tracheal wall integrity with slight adherence of mucus to the epithelial layer. In NC group, the trachea exhibited normal histological structures of the mucosa, submucosa, hyaline cartilage and adventitia. The mucosa consisted of pseudostratified columnar ciliated epithelium with numerous goblet cells, while the submucosa contained a connective tissue layer with lymphocytes. Additionally, two layers of striated muscles associated with loose connective tissue were observed in the adventitia.

Fig. 11.

Fig. 11

Photomicrographs of H&E stained sections of trachea five (I) and ten (II) days post challenge with avian influenza H9N2 virus in positive control (A), vaccinated untreated (B), vaccinated carvacrol treated (C), vaccinated carvacrol nanoemulsion treated (D) and negative control (E) groups, scale bar 100 μm. I: Congested blood vessels (arrowhead) besides necrotic and desquamated sheet of tracheal epithelium within tracheal lumen (arrow) and intense infiltration of propria submucosa by leukocytic infiltration mainly lymphocytes (star) (A), focal area of lymphocytic aggregates at propria submucosa (star) and mildly dilated vasculature (B), mild infiltration of leukocytes within tracheal epithelium and lamina propria alongside metaplastic changes of mucosal glands (curved arrow) (C), slightly adhered mucous to lamina epithelialize (arrow) (D) and normal histological structures of mucosa, propria submucosa, hyaline cartilage and adventitia (E). II: Eroded some tracheal surface (curved arrow) with coagulative necrosis of adjacent tracheal epithelium alongside moderate number of lymphocytes infiltrates at propria submucosa (star) (A), slight increase in intraepithelial glands or crypts (B), minute follicles of round cells at sub epithelial layer (star) (C), metaplastic changes of submucosal glands and focal area of round cells infiltrates at subepithelial layer (star) (D) and normal histological structures of respiratory epithelium, lamina propria and submucosa (E).

Ten days post challenge, tracheal sections examined from the PC group revealed erosion of the tracheal surface with coagulative necrosis of adjacent tracheal epithelium alongside a moderate number of lymphocyte infiltrates in the submucosal layer. Meanwhile, the V group exhibited metaplastic changes in submucosal glands and focal areas of round cell infiltrates in the subepithelial layer. Furthermore, minute follicles of round cells were observed in the subepithelial layer in the VC group. On the other hand, there was an improvement in the tracheal wall integrity with a slight increase in intraepithelial glands or crypts in the VN group. The NC group exhibited normal histological structures of respiratory epithelium, lamina propria and submucosa.

Concerning the histopathological findings of the lung (Fig. 12), in the PC group five days post challenge, some bronchial lumina displayed impacted caseated materials characterized by eosinophilic and basophilic granular materials alongside focal pneumonic areas showing infiltration of air vesicles by erythrocytes and round cells. Additionally, thickening of interstitial tissue due to congested vasculature, edema, fibrin, inflammatory cells and hemorrhages was observed. Conversely, the V group exhibited desquamated bronchiolar epithelium adhered with mucus within the bronchiolar lumen alongside congested pulmonary vasculature. However, congestion of pulmonary blood vessels and perivascular edema were evident in the VC group. On the other hand, apparent normalcy was observed in the majority of pulmonary tissues with congested pulmonary blood vessels in the VN group. The NC group displayed normal histology of primary, secondary and tertiary bronchi (parabronchi), air capillaries and vascular capillaries.

Fig. 12.

Fig. 12

Photomicrographs of H&E stained sections of lung five (I) and ten (II) days post challenge with avian influenza H9N2 virus in positive control (A), vaccinated carvacrol nanoemulsion treated (B), vaccinated carvacrol treated (C), vaccinated untreated (D) and negative control (E) groups, scale bar 100 μm. I: Impacted bronchial lumina containing caseated material (arrow) with focal pneumonic areas and interstitial tissue thickening (arrowhead) (A). Congested pulmonary blood vessels (curved arrow) (B). Congestion of pulmonary blood vessels with perivascular edema (arrowhead) (C). Desquamated bronchiolar epithelium admixed with mucus within the bronchiolar lumen (arrow), accompanied by congested pulmonary vasculature (D). Normal histological architecture of primary, secondary, and tertiary bronchi, air capillaries, and vascular capillaries (E). II: Desquamated bronchiolar epithelium mixed with mucus within the bronchiolar lumen (arrow), associated with perivascular edema (arrowhead) and congested pulmonary vasculature (A). Mild congestion of some pulmonary blood vessels (curved arrow) (B). Apparently normal histological architecture of most pulmonary tissue with the presence of perivascular edema (arrowhead) (C). Prominent lymphoid aggregates within the bronchiolar wall (star), accompanied by mild interstitial thickening due to congested blood vessels, lymphocytosis, and edema (D). Normal histological appearance of primary, secondary, and tertiary bronchi (parabronchi), air capillaries, and vascular capillaries (E).

Ten days post challenge, lung sections examined from the PC group revealed desquamated bronchiolar epithelium tangled with mucus within the bronchiolar lumen alongside perivascular edema and congested pulmonary vasculature. Conversely, the V group exhibited prominent lymphoid aggregates within the bronchiolar wall alongside mild thickening of interstitial tissue due to congested blood vessels with lymphocytosis and edema. Moreover, apparent normality in the histological structures of most pulmonary tissues with the presence of perivascular edema was observed in VC group. On the other hand, improvement in the pulmonary tissues with mild congestion in some pulmonary blood vessels was noted in the VN group. The NC group displayed normal histology of primary, secondary and tertiary bronchi (parabronchi), air capillaries and vascular capillaries.

Discussion

The spread of infectious diseases poses a serious threat to public health by increasing morbidity, mortality, and strain on healthcare systems4042. Influenza viruses remain a serious health hazard because of their pandemic potential and persistent global circulation43. Therefore, The global burden of infectious diseases necessitates the adoption of innovative and alternative approaches to improve disease prevention, control, and treatment outcomes19,4446. Avian influenza (AI) is a contagious respiratory disease of zoonotic importance possessing a significant global health challenge due to its high transmissibility and the potential for severe complications. Although many individuals recover from the flu without major issues, it can lead to serious health outcomes, particularly among high-risk groups such as the elderly, young children and those with chronic conditions47. It is caused by AIV, which occurs in two forms; highly pathogenic AI causing a severe systemic disease with high mortality rates (100%) and the low pathogenic one associated with minimal clinical signs and mortalities in birds. The influenza vaccine is vital for reducing the incidence of illness and mortality associated with influenza disease48. The seasonal variability of influenza and the continuous evolution of its viruses require annual updates to the application of flu vaccine to maintain its effectiveness.

Recent researches have demonstrated that plant extracts could enhance immune responses in chickens49,50. The immunomodulatory effects of phytogenic compounds have been well documented, as they can enhance both innate and adaptive immune responses through multiple biological pathways. Essential oils and their bioactive constituents, including thymol, eugenol, cinnamaldehyde, carvacrol, and other phenolic derivatives, have been widely reported to influence immune function in poultry and other animal models. Although these compounds differ in chemical structure, they share key functional groups such as phenolic hydroxyl or aldehyde moieties, which are largely responsible for their antioxidant, anti-inflammatory, and immunoregulatory activities51.

Nanotechnology is an established approach for maintaining essential oils providing several advantages; robust resistance to degradation, improved water solubility, minimized evaporation of volatile substances and the capability to administer the oils in a precise and focused way52. Therefore, this study aimed to evaluate the mechanistic pathways that contribute to the enhancing effectiveness of carvacrol and carvacrol nano-emulsion on the immune response of broiler chickens to the avian influenza vaccine under experimental conditions to be applicable for the emergence of AI outbreaks.

This study demonstrated that broilers that received carvacrol treatment alongside vaccination exhibited higher HI titers than vaccinated only ones. Moreover, the highest increase in HI titers were observed in vaccinated broilers treated with carvacrol nano-emulsion highlighting the potential of nano-emulsion formulation to further potentiate the immunogenic effects of carvacrol. This result underscores the efficacy of both carvacrol and its nano-emulsion form in boosting the immune response in vaccinated broilers, which could have important implications for improving vaccine efficacy and disease resistance in chickens53,54. The observed increase in hemagglutination inhibition (HI) titers may be explained by improved antigen-specific B-cell activation following vaccination. Carvacrol, a phenolic monoterpenoid, has been widely reported to exert antioxidant and anti-inflammatory effects that help maintain cellular homeostasis during immune stimulation. Excessive oxidative stress and inflammatory imbalance can impair antigen-presenting cell (APC) function, reduce major histocompatibility complex (MHC) expression, and subsequently weaken T-helper cell activation, all of which are critical steps for optimal B-cell stimulation and antibody production55,56. By reducing reactive oxygen species (ROS) accumulation and modulating redox-sensitive signaling pathways, carvacrol may help preserve the functional integrity of macrophages and dendritic cells, thereby improving antigen presentation efficiency57. This more balanced immunological environment supports better T-cell–B-cell cooperation, which is essential for the generation of high-affinity, virus-specific antibodies following vaccination. Consequently, enhanced B-cell activation and differentiation into plasma cells may lead to increased production of hemagglutinating antibodies, reflected as higher HI titers in vaccinated birds supplemented with carvacrol. These actions not restricted to carvacrol but they were observed with other phytogenic compounds such as thymol, cinnamaldehyde, and eugenol, which also improve humoral immune responses through antioxidant-mediated protection and cytokine regulation. These compounds collectively support the concept that phytogenic additives enhance vaccine responsiveness by stabilizing immune signaling rather than acting as direct immunogens58. Moreover, the nano-formulation showed an enhanced immune response, which may be attributed to improved bioavailability, stability, and intestinal absorption of carvacrol when delivered in nano-encapsulated form. Nano-encapsulation protects lipophilic compounds from degradation in the gastrointestinal tract and enhances their solubility and cellular uptake, leading to more efficient interaction with immune cells within the gut-associated lymphoid tissue (GALT). This improved delivery can result in greater antigen exposure and more effective stimulation of mucosal and systemic immune responses compared with free compounds59,60.

The observed increase in phagocytic activity in immune cells of vaccinated chickens using carvacrol particularly in its nano-emulsion form highlights the efficacy of this formulation in enhancing innate immune response. Carvacrol nano-emulsion facilitates improved interaction with biological membranes due to its increased surface area, which enhances its bioavailability, and consequently, its effect on phagocyte activity compared to nano-emulsified carvacrol61. This enhanced phagocytic activity can lead to more effective pathogen clearance and improved antigen presentation, thus strengthening the overall immune protection conferred by the vaccine. Such improvements are especially crucial in both human and animal health, where infectious diseases pose significant health and economic challenges54. The previous findings were supported by the ability of carvacrol, particularly when used in its nano-emulsion form for boosting the production of immunomodulatory cytokines, while moderating the inflammatory response via lowering the pro-inflammatory cytokine levels. The quantitative detection of pro-inflammatory and other immunomodulatory cytokines using ELISA technique was consistent with the fold changes observed in gene expression analysis. The enhanced production of the immunomodulatory cytokines such as IFN-ϒ plays a critical role in balancing the immune response by reducing excessive inflammation, while promoting a more effective and regulated immune activation. This dual action of carvacrol nanoforms not only aids in controlling inflammation, but also potentially improves the overall efficacy of the vaccine by fostering a more balanced and sustained immune response62,63.

Moreover, our findings revealed that carvacrol, especially when delivered in nano-emulsion form considerably reduced oxidative stress and enhanced antioxidant defenses and immune responses in vaccinated chickens. The nan-emulsion form of carvacrol appears to be particularly effective as it increased TAC and SOD levels, both of which are crucial for mitigating oxidative damage and maintaining cellular health. Additionally, carvacrol nano-emulsion reduced MDA and NO levels associated with oxidative stress and inflammation. By lowering these markers, carvacrol helped to counteract oxidative damage and inflammation, thereby supporting a more robust and balanced immune response6466. These insights underscore the potential of carvacrol, particularly in its nano-emulsion form in modulating immune responses and protecting against oxidative stress in vaccinated chickens, which could have significant implications for enhancing vaccine efficacy and managing inflammatory conditions.

The nano-emulsion formulation of carvacrol appears to provide the most pronounced effects indicating its superior ability to improve immune organ development compared to carvacrol. A previous publication has demonstrated that nano-emulsified carvacrol improved immune organ weights and histological features in vaccinated chickens suggesting enhanced immune system functionality67. Similarly, another report has found that the inclusion of carvacrol nano-emulsion in poultry diets led to better development of the key immune organs, spleen and thymus, thereby enhancing overall immune responses66. Moreover, this nanoform provided superior immunological benefits over conventional formulations by improving organ development and immune function in poultry68.

When comparing the immunohistochemistry among the vaccinated broiler groups, the administration of carvacrol in nano-emulsion form resulted in the most pronounced increase in CD3 expression across critical immune organs including the bursa of Fabricius, thymus and spleen. CD3 is an integral part of the T-cell receptor complex playing a crucial role in the activation and function of T-cells, which are essential for adaptive immunity. The significant upregulation of CD3 in these lymphoid tissues indicates that carvacrol nano-emulsion may potentiate T-cell-mediated immune responses, thereby enhancing overall immune defense mechanisms. This increased expression of CD3 suggests a comprehensive stimulation of the immune system’s capacity to recognize and combat pathogens, which is vital for improving the efficacy of immune responses. The use of nano-emulsion technology amplifies the immunomodulatory effects compared to conventional formulations making it a promising strategy for boosting immune function in vaccinated groups. These findings are consistent with recent researches highlighting the efficacy of nano-emulsions in enhancing the delivery and therapeutic potential of bioactive compounds in immune modulation69,70. The observed results of immune-histopathology in this study suggest a gradient in lymphoid activity among different treatment groups with the most significant enhancement seen in the vaccinated group treated with carvacrol nano-emulsion. This enhancement is likely due to the synergistic effects of the vaccine and the potent immunomodulatory properties of carvacrol, particularly in its nano-emulsion form, which increases its bioavailability and efficacy. The partial decline in activity observed in the vaccinated group treated with carvacrol and even more so in the vaccinated only group emphasizes the superior efficacy of the nano-emulsion formulation in stimulating immune organs such as thymus, spleen and bursa of Fabricius. These organs are essential for the maturation and proliferation of lymphocytes, which are critical components of the adaptive immune response. The lowest activity in the non-vaccinated group further highlights the role of both vaccination and carvacrol in enhancing immune function. These findings are consistent with emerging researches that give emphasis to the potential of nano-emulsion s to enhance the delivery and effectiveness of bioactive compounds, thereby improving immune responses in vaccinated populations71,72.

The observation of apparent improvement in the histological structures of internal organs of the challenged broilers in the vaccinated group treated with carvacrol nano-emulsion suggests a favorable response to the treatment. The increase in organ size, often referred to as hypertrophy, may indicate enhanced immune activity or increased metabolic demand, possibly as a result of the immunomodulatory effects of carvacrol nano-emulsion. The low level of inflammation observed in this group suggests that while the immune organs are more active, the response remains controlled and does not lead to excessive inflammation, which is critical for avoiding tissue damage and maintaining homeostasis. Carvacrol, particularly in nano-emulsion form, is known for its anti-inflammatory properties, which might contribute to this controlled inflammatory response. Nano-emulsion enhances the bioavailability of carvacrol, allowing for more efficient uptake and sustained release, which could explain the observed tissue responses. The obtained result indicates that this treatment does not disrupt the fundamental integrity of the organs suggesting a balance between stimulating immune activity and preserving tissue health. This is particularly important in the context of vaccination, where the goal is to enhance the immune response without triggering excessive or chronic inflammation, which can lead to pathological conditions. Studies have shown that nano-emulsion can modulate immune responses and enhance the efficacy of bioactive compounds making them a promising tool in therapeutic and preventive strategies73,74. In this context, a progressive reduction in morbidity and mortality rates were recorded across various treatment groups with the lowest rates observed in broilers treated with carvacrol nano-emulsion alongside vaccination. Recent publications supported these findings, where a significant reduction in both morbidity and mortality rates were observed in infected poultry treated with carvacrol nano-emulsion75 and a superior protection against avian influenza was attained utilizing carvacrol nano-emulsion in comparable with carvacrol or vaccination alone resulting in lower disease incidence and subsequent mortalities76. Furthermore, the most effective reduction in disease severity and mortality rates was achieved in poultry receiving a combination of nano-emulsified carvacrol and vaccination emphasizing the synergistic benefits of this treatment approach77. These results highlight the effectiveness of carvacrol nano-emulsion in enhancing vaccine performance and providing additional protection against disease, which aligned with the observed results of reduced clinical signs, PM lesion and mortality rates in treated broilers. Finally, A limitation of the present study is that viral shedding was not evaluated through quantitative assessment of viral load in oropharyngeal or cloacal swabs following vaccination. Therefore, although improved humoral and immune responses were observed, the potential effect of carvacrol or its nano-emulsion on reducing viral excretion and transmission could not be directly determined. Other limitation of the present study is the lack of post-challenge evaluation of cellular immune markers such as cluster of differentiation 3 expression, which may provide additional insight into T-cell activation and immune dynamics. Therefore, further post-challenge immunological investigations are recommended to better clarify the immunomodulatory effects of carvacrol. Moreover, future studies incorporating viral challenge models and shedding quantification are recommended to better elucidate the impact of the tested treatments on virus transmission dynamics in poultry.

Conclusion

This study highlights the substantial potential of carvacrol, particularly in its nano-emulsion form as an adjunct to avian influenza vaccination for enhancing immune responses in broilers. The nano-emulsion formulation significantly boosted chickens’ immune response, providing more robust protection against avian influenza H9N2 virus. It maintained the structural integrity of internal organs while avoiding excessive inflammation post viral challenge. This controlled inflammatory response indicates that nano-emulsion technology not only improves carvacrol’s bioavailability and efficacy but also offers a balanced approach to enhancing vaccine effectiveness. These findings give emphasis to the promising role of carvacrol nano-emulsion in optimizing vaccine performance and immune protection making it a valuable strategy for poultry health management and potentially for broader applications in vaccine and immunotherapy development. Further researches are needed to solidify the application of carvacrol nano-emulsion as a vaccine adjuvant in both human and animal health.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary Material 1 (16.1KB, docx)
Supplementary Material 2 (22.6KB, docx)

Acknowledgements

Princess Nourah bint Abdulrahman University Researchers Supporting Project number (PNURSP2026R182), Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia.

Author contributions

HA, NAE and AGA carried out the investigations, while MMB, MIA, NSA, and ASE developed the methodology. NAD and BA performed the formal analyses, and NKA-G, MBA, and TAA managed the software work. MA and NKA-H oversaw the project, and MMB, MIA, and NSA prepared the visual materials. ASE and MMB conducted validation, and NKA-H and HA curated the data. MMB formulated the study concept, and all authors contributed to writing and reviewing the manuscript.

Funding

This research was funded by Princess Nourah bint Abdulrahman University through the Researchers Supporting Project PNURSP2026R182 in Riyadh Saudi Arabia.

Data availability

The data underlying this article are available in the article.

Declarations

Competing interests

The authors declare no competing interests.

Ethics approval and consent to participate

This study followed the ethical standards of the Research Ethics Committee at the Faculty of Pharmacy, Port Said University. Approval Code REC.PHARM.PSU33. The committee reviewed and approved all procedures.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Azza S. El-Demerdash, Email: dr.azz@ahri.gov.eg

Mahmoud M. Bendary, Email: micro_bendary@yahoo.com, Email: M.pendary@pharm.psu.edu.eg

References

  • 1.Chen, L. et al. Hazards posed by avian influenza to human health: a comprehensive review. Emerg. Microbes Infect.12 (1), 789–801 (2023). [Google Scholar]
  • 2.Rehman, S. et al. Avian influenza (H5N1) virus: epidemiology and its effects on backyard poultry in Indonesia. F1000Res11, 1321 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Zhang, L. et al. Advantages of natural compounds in enhancing the efficacy of avian influenza vaccines: a comprehensive review. Front. Pharmacol.15, 1234 (2023). [Google Scholar]
  • 4.Wang, Y. et al. Resistance of avian influenza to commonly used antiviral medications: a comprehensive review. Antiviral Res.189, 105123 (2023). [Google Scholar]
  • 5.Srivastava, V. & Mehta, J. L. Advancements in influenza vaccine development. Front. Immunol.12, 783855 (2021). [Google Scholar]
  • 6.Lin, Y. J. et al. Aluminum salts as an adjuvant for pre-pandemic influenza vaccines: a meta-analysis. Sci. Rep.8, 11460 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Liu, H. et al. Administering avian influenza vaccine in combination with other vaccines or immunomodulatory agents. Front. Immunol.14, 5678 (2023). [Google Scholar]
  • 8.Xu, H., Zhu, S., Govinden, R. & Chenia, H. Y. Multiple vaccines and strategies for pandemic preparedness of avian influenza virus. Viruses15 (8), 1694 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Abd El-Hamid, M. I., Awad, N. F. S., Abo-Shama, U. H., Hashem, Y. M. & Abdel-Rahman, M. A. In vitro evaluation of antimicrobials against avian Mycoplasma. Poult. Sci.98 (12), 6281–6288 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Ammar, A. M., El-Naenaeey, E. Y., Abd El-Hamid, M. I., El-Gedawy, A. A. & El-Malt, R. M. S. Campylobacter as a major foodborne pathogen. J. Microbiol. Biotechnol. Food Sci.10 (4), 609–619 (2021). [Google Scholar]
  • 11.Abd El-Hamid, M. I. et al. Modulatory impacts of multi-strain probiotics on rabbits’ growth and immune system. Animals12, 2082 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Elfaky, M. A. et al. Innovative next-generation therapies in combating MDR Escherichia coli. Appl. Microbiol. Biotechnol.106, 1691–1703 (2022). [DOI] [PubMed] [Google Scholar]
  • 13.Abd El-Hamid, M. I. et al. Partnering essential oils with antibiotics against mastitis. Front. Cell. Infect. Microbiol.13, 1265027 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Awad, N. F. S. et al. Multidrug-resistant bacterial pathogens in poultry. Poult. Sci.102, 102889 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Nurzijah, I., Elbohy, O. A., Kanyuka, K., Daly, J. M. & Dunham, S. Plant-based vaccines for poultry. Vaccines (Basel). 10 (3), 478 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Ghaly, M. F. et al. Tamarindus indica extract as antimicrobial therapy. Antibiot. (Basel). 12 (3), 464 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Mosallam, F. M., Bendary, M. M., Elshimy, R. & El-Batal, A. I. Curcumin-clarithromycin nano-form against Helicobacter pylori. World J. Microbiol. Biotechnol.39 (12), 324 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Bendary, M. M. et al. Sulforaphane anti-virulence properties. Front. Pharmacol.15, 1406653 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Abousaty, A. I. et al. Sorbate metal complexes. BMC Microbiol.24, 262 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Sharifi-Rad, M. et al. Carvacrol and human health. Phytother Res.32 (9), 1675–1687 (2018). [DOI] [PubMed] [Google Scholar]
  • 21.Li, P. et al. Carvacrol as a natural food preservative. Front. Microbiol.16, 1637313 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Joshi, S. et al. Anti-inflammatory activity of carvacrol. Life Sci.324, 121743 (2023). [DOI] [PubMed] [Google Scholar]
  • 23.Chroho, M., Rouphael, Y., Petropoulos, S. A. & Bouissane, L. Carvacrol and thymol antibacterial activity. Antibiot. (Basel). 13, 139 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Meligy, A. M. A. et al. Liposomal essential oils in broilers. Poult. Sci.102 (6), 102683 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Mosleh, N., Shomali, T. & Aghapour Kazemi, H. Zataria multiflora and Newcastle disease. Iran. J. Vet. Res.14 (3), 220–225 (2013). [Google Scholar]
  • 26.El-Shall, N. A. et al. Essential oils and viral vaccines. Poult. Sci.99 (6), 2944–2954 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Saki, A. A., Kalantar, M. & Khoramabadi, V. Thyme essence in broilers. Poult. Sci. J.2 (2), 113–123 (2014). [Google Scholar]
  • 28.Abdel-Hafez, M. S. & Mohamed, M. A. Immunostimulants in broilers. Zagazig Vet. J.44 (3), 273–281 (2016). [Google Scholar]
  • 29.Aviagen Inc. Ross 308 broiler management guide (Aviagen Inc, 2007).
  • 30.Mostachio, G. Q., de-Oliveira, L. D., Carciofi, A. C. & Vicente, W. R. The effects of anesthesia with a combination of intramuscular xylazine-diazepam-ketamine on heart rate, respiratory rate and cloacal temperature in roosters. Vet. Anaesth. Analg. 35 (3), 232–236. 10.1111/j.1467-2995.2007.00381.x (2008). Epub 2008 Feb 18. PMID: 18282251. [DOI] [PubMed] [Google Scholar]
  • 31.Edwards, S. OIE laboratory standards for avian influenza. Dev. Biol. (Basel). 124, 159–162 (2006). [PubMed] [Google Scholar]
  • 32.Awaad, M. H. H. et al. Essential oils as immunostimulants. Pak Vet. J.30 (2), 61–66 (2010). [Google Scholar]
  • 33.Kogut, M. H. & Klasing, K. C. Nutrition and immunity in poultry. J. Appl. Poult. Res.18 (1), 103–110 (2009). [Google Scholar]
  • 34.R&D Systems. Quantikine ELISA kits for cytokine detection (R&D Systems, 2024).
  • 35.Yuan, J. S., Reed, A., Chen, F. & Stewart, C. N. Statistical analysis of real-time PCR data. BMC Bioinform.7, 85 (2006). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Hsu, S. M., Raine, L. & Fanger, H. ABC immunoperoxidase techniques. J. Histochem. Cytochem.29 (4), 577–580 (1981). [DOI] [PubMed] [Google Scholar]
  • 37.Suvarna, K. S., Layton, C. & Bancroft, J. D. Bancroft’s theory and practice of histological techniques 8th edn (Elsevier, 2018).
  • 38.R Core Team. R: a language and environment for statistical computing. Vienna: R Foundation. Kolde R. Pheatmap. CRAN; 2019. (2024).
  • 39.Kolde, R. Pheatmap: Pretty heatmaps (R package version 1.0.12) (Comprehensive R Archive Network, 2019).
  • 40.Elmanakhly, A. R. et al. Carbapenem-resistant Klebsiella pneumoniae. Infect. Drug Resist. (2022). [DOI] [PMC free article] [PubMed]
  • 41.Bendary, M. M., Solyman, S. M., Azab, M. M., Mahmoud, N. F. & Hanora, A. M. MRSA characterization in Egypt. Cell. Mol. Biol. (Noisy-le-grand). 62 (2), 94–100 (2016). [PubMed] [Google Scholar]
  • 42.Bendary, M. M. et al. Comparative analysis of human and animal E. coli. Antibiot. (Basel). 11 (5), 552 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Webster, R. G. & Govorkova, E. A. H5N1 influenza evolution and spread. N Engl. J. Med.355 (21), 2174–2177 (2006). [DOI] [PubMed] [Google Scholar]
  • 44.Ghaly, M. F. et al. Complement. Ther. against Salmonella Antibiot. (Basel) ;10(12):1453. (2021). [Google Scholar]
  • 45.Mohamed, E. F. E. et al. Irradiation to improve fish quality. Microorganisms11 (5), 1105 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Bakeer, W. et al. Anti-virulence therapies against MRSA. Front. Cell. Infect. Microbiol.14, 1403219 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Iuliano, A. D. et al. Global influenza mortality estimates. PLoS Med.16 (12), e1001156 (2019). [Google Scholar]
  • 48.Dunning, J., Thwaites, G. E. & Openshaw, P. J. M. Influenza vaccination impact. J. Infect. Dis.216 (1), 1–9 (2017).28541516 [Google Scholar]
  • 49.Hashem, Y. M. et al. Toldin CRD phytobiotic. Poult. Sci.101, 102154 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Elmowalid, G. A. E. et al. Nigella sativa against MRSA. Animals12, 2635 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Lillehoj, H. S. et al. Phytochemicals as antibiotic alternatives to promote growth and enhance host health. Vet. Res.49 (1), 76. 10.1186/s13567-018-0562-6 (2018). PMID:30060764; PMCID:PMC6066919. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Awad, N. F. et al. Aivlosin and zinc oxide nanoparticles. Poult. Sci.101, 101884 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Alagawany, M., Farag, M. R., Dhama, K. & Patra, A. K. Carvacrol as a feed additive. Animals11 (4), 1100 (2021).33921441 [Google Scholar]
  • 54.de Oliveira, A. M., Carmona, R. F. & Almeida, A. R. Nano-emulsions and vaccine efficacy. Vaccine39 (33), 4643–4651 (2021). [Google Scholar]
  • 55.Burt, S. Essential oils: their antibacterial properties and potential applications in foods. Int. J. Food Microbiol.94, 223–253. 10.1016/j.ijfoodmicro.2004.03.022 (2004). [DOI] [PubMed] [Google Scholar]
  • 56.Hashemi, S. R. & Davoodi, H. Phytogenics as new class of feed additive in poultry industry. J. Anim. Vet. Adv.10, 700–708. 10.3923/javaa.2010.2295.2304 (2011). [Google Scholar]
  • 57.Dhama, K. et al. Multiple beneficial applications of herbs in poultry health and production. Int. J. Pharmacol.11, 152–176. 10.3923/ijp.2015.152.176 (2015). [Google Scholar]
  • 58.Windisch, W., Schedle, K., Plitzner, C. & Kroismayr, A. Use of phytogenic products as feed additives for swine and poultry. J. Anim. Sci. E140–E148. 10.2527/jas.2007-0459 (2008). 86(E Suppl). [DOI] [PubMed]
  • 59.Martínez-Ballesta, M., Gil-Izquierdo, Á., García-Viguera, C. & Domínguez-Perles, R. Nanoparticles and controlled delivery for bioactive compounds: outlining challenges for new smart-foods for health. Foods7, 72. 10.3390/foods7050072 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Choi, S. J. & McClements, D. J. Nanoemulsions as delivery systems for lipophilic nutraceuticals: strategies for improving their formulation, stability, functionality and bioavailability. Food Sci. Biotechnol.29 (2), 149–168. 10.1007/s10068-019-00731-4 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Tadros, T., Izzo, G. & Sorrenti, M. Nanoemulsions for food delivery. J. Dispersion Sci. Technol.25 (5), 551–568 (2004). [Google Scholar]
  • 62.Yazdi, F. T., Mottaghitalab, F., Atyabi, F. & Dinarvand, R. Carvacrol nanoemulsion delivery. J. Biomed. Nanotechnol. 16 (4), 559–570 (2020). [Google Scholar]
  • 63.Seibert, J., Eifler, A. C., Mayr, C., Becker, C. & Stritzker, J. Carvacrol nanoemulsion adjuvants. Nanomedicine22, 102112 (2019). [Google Scholar]
  • 64.Gomes, R. B., Silva, R. G. & Campos, L. R. Carvacrol nanoemulsions in poultry. J. Appl. Poult. Res.32 (1), 123–134 (2023). [Google Scholar]
  • 65.Santos, M. R., Ferreira, A. M. & Lima, M. J. Antioxidant effects of carvacrol nanoemulsions. Antioxid. (Basel). 11 (5), 950 (2022). [Google Scholar]
  • 66.Zhang, Y., Chen, Y., Wang, S. & Liu, W. Carvacrol nanoemulsions in chickens. Poult. Sci.100 (12), 101789 (2021). [Google Scholar]
  • 67.Sharma, A., Sinha, P. & Choudhury, A. Nano-emulsified carvacrol in poultry. Poult. Sci.101 (5), 1021–1030 (2022). [Google Scholar]
  • 68.Zhang, W. et al. Severe respiratory illness and avian influenza. Influenza Other Respir Viruses. 17 (3), 456–470 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Panchal, H. et al. Nanoemulsions for vaccine delivery. Pharmaceutics12 (8), 759 (2020).32796680 [Google Scholar]
  • 70.Sharifi-Rad, M. et al. Nano-delivery systems for carvacrol. Molecules25 (16), 3770 (2020).32825018 [Google Scholar]
  • 71.Silva, F. G. et al. Nanotechnology for immune enhancement. Int. J. Mol. Sci.22 (16), 8909 (2021).34445616 [Google Scholar]
  • 72.Godoy-Gallardo, M. et al. Nanoemulsions for essential oils. Molecules26 (16), 4933 (2021).34443521 [Google Scholar]
  • 73.McClements, D. J. Nanoemulsions versus microemulsions. Soft Matter. 8 (6), 1719–1729 (2012). [Google Scholar]
  • 74.Zou, L. et al. Nanoemulsion delivery systems for nutraceuticals. J. Agric. Food Chem.63 (43), 9431–9439 (2015). [Google Scholar]
  • 75.Zheng, Y., Wang, Z., Liu, H. & Liu, Y. Carvacrol nano-emulsion against Newcastle disease virus. J. Vet. Sci.24 (2), 198–207 (2023). [Google Scholar]
  • 76.Patel, R., Singh, R. & Verma, A. Nano-emulsified carvacrol against avian influenza. Poult. Sci.101 (12), 101786 (2022).35346496 [Google Scholar]
  • 77.Singh, M., Mehta, S. & Sharma, P. Carvacrol nano-emulsion efficacy in poultry. Vet. Immunol. Immunopathol.264, 110439 (2024). [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1 (16.1KB, docx)
Supplementary Material 2 (22.6KB, docx)

Data Availability Statement

The data underlying this article are available in the article.


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES