Skip to main content
Biomolecules & Therapeutics logoLink to Biomolecules & Therapeutics
. 2026 Jun 30;34(4):866–881. doi: 10.4062/biomolther.2026.062

Behavioral and Biochemical Evaluation of a Curcumin-Loaded Nano-Liposomal Formulation in a Scopolamine-Induced Mouse Model of Cognitive Impairment

Hwa-Young Lee 1,2,†, Muhammad Kamal Hossain 2,3,4,5,†, Gi-Hyun Jang 6, Hyewon Lee 3, Yu-Mi Kim 6,*, Han-Jung Chae 1,2,3,*
PMCID: PMC13324486  PMID: 42375090

Abstract

Scopolamine-induced cognitive impairment in mice models acute cholinergic dysfunction associated with early functional features of Alzheimer’s disease (AD). This study evaluated the neuroprotective potential of curcumin-loaded nanoliposomes (Cur-NL), a bioavailable curcumin formulation, using behavioral, molecular, and biochemical approaches. Male mice received oral Cur-NL (250, 500, or 1000 mg/kg) for 30 days, followed by a single intraperitoneal injection of scopolamine (2 mg/kg). Cognitive performance was assessed by the open field test and Barnes maze. Acetylcholinesterase (AChE) activity, acetylcholine (ACh) levels, hippocampal gene expression, and reactive oxygen species (ROS) accumulation were analyzed to investigate underlying mechanisms. Cur-NL significantly improved spatial learning and memory and restored cholinergic balance by normalizing AChE activity and ACh levels. Treatment also attenuated hippocampal neuroinflammation, oxidative stress, and ROS accumulation. Cur-NL modulated genes related to amyloid processing and synaptic plasticity, suppressing App and Bace1 and upregulating Adam10 and Bdnf. Network analyses supported the involvement of cholinergic, inflammatory, and synaptic signaling pathways. These findings indicate that Cur-NL confers multitarget neuroprotection in a scopolamine-induced model and may serve as a candidate for managing early cholinergic-related cognitive decline. Important limitations should be acknowledged: curcumin concentrations in plasma and brain were not quantified, and a free-curcumin comparator was not included. The findings should therefore be interpreted as evidence of efficacy of the tested Cur-NL preparation, not as a comparative demonstration of nano-liposomal superiority over free curcumin. Direct pharmacokinetic and head-to-head comparative studies are required to establish the formulation-specific contribution of nano-liposomal delivery.

Keywords: Curcumin-loaded nano-liposome, Alzheimer’s disease, Scopolamine, Cognitive impairment, Synaptic signaling, Neuroinflammation

INTRODUCTION

Alzheimer’s disease (AD) is a progressive neurodegenerative disorder characterized by cognitive impairment, memory loss (Zverova, 2019), and pathological features, including amyloid-beta (Aβ) accumulation, oxidative stress, neuroinflammation, and synaptic dysfunction (Agostinho et al., 2010; Kamat et al., 2016). The scopolamine-induced AD model is widely used to mimic key aspects of AD pathology, particularly cholinergic deficits, oxidative stress and cognitive impairments, by blocking muscarinic ACh receptors (Li et al., 2018; Tang, 2019). This model offers a reliable platform for evaluating potential neuroprotective agents. Although scopolamine does not directly induce Aβ deposition, it has been shown to mimic AD-like neuropathology by enhancing β-secretase (BACE1) activity (Hernandez-Rodriguez et al., 2020), which promotes the cleavage of amyloid precursor protein (APP) into Aβ peptides while simultaneously impairing Aβ clearance mechanisms through cholinergic dysfunction and oxidative stress (Somin et al., 2023). This accumulation of Aβ peptides triggers neuroinflammatory responses, wherein activated microglia and astrocytes release proinflammatory cytokines such as TNF-α, IL-1β, and IL-6 (Kaur et al., 2019; Wang et al., 2015), further exacerbating neuronal injury and promoting a self-propagating cycle of inflammation. Concomitantly, these inflammatory processes are closely linked with oxidative stress, characterized by the overproduction of reactive oxygen species (ROS) and a decline in endogenous antioxidant defense systems, leading to pathological aging (Hossain et al., 2024), lipid peroxidation, protein oxidation, and DNA damage (Lugrin et al., 2014; Nita and Grzybowski, 2016), all of which contribute to neuronal degeneration. The resulting cellular damage and inflammation ultimately impair synaptic function (Tonnies and Trushina, 2017), as evidenced by the loss of key synaptic proteins such as PSD-95 and synaptophysin and a reduction in neurotrophic support through decreased BDNF levels (Luo et al., 2013), which collectively contribute to synaptic dysfunction and are strongly correlated with the cognitive and memory deficits observed in AD pathology. Furthermore, neuropathological studies have consistently shown that the hippocampus-especially the entorhinal cortex and CA1 subfield-exhibits the earliest appearance of neurofibrillary tangles and neuronal loss in AD, long before widespread neocortical involvement (Kril et al., 2002; Rao et al., 2022). This early vulnerability makes it a critical locus for therapeutic intervention. Therefore, targeting these pathological features in hippocampal tissue is a rational and high-impact approach to elucidate the potential mechanisms by which the bioactive compound may exert its disease-modulating effects in a scopolamine-induced AD model.

Curcumin, a natural polyphenolic compound derived from Curcuma longa, has been extensively studied for its anti-inflammatory, antioxidant, and neuroprotective properties (Memarzia et al., 2021). However, its clinical application is substantially limited by poor oral bioavailability, low aqueous solubility, and rapid metabolic degradation, which restrict its effective systemic and central nervous system exposure (Anand et al., 2007; Liu et al., 2016). To address these pharmacokinetic limitations, various formulation strategies have been explored, among which nano-liposomal delivery systems have shown particular promise in enhancing the stability and bioavailability of curcumin. In this context, curcumin-loaded nano-liposomes have emerged as a more stable and bioavailable formulation, providing improved protection against metabolic degradation and facilitating tissue distribution, including brain delivery (Pandey et al., 2020). Compared with the parent compound, curcumin-loaded nano-liposomes exhibit enhanced free radical scavenging activity, greater systemic stability, and improved blood–brain barrier permeability through their lipid-based delivery system (Tabanelli et al., 2021; Yakubu and Pandey, 2024). Recent studies have further demonstrated that curcumin-loaded nano-liposomes reduce oxidative damage (Girst et al., 2021), inhibit proinflammatory NF-κB signaling, and modulate synaptic and neurotrophic pathways (Sarawi et al., 2021), suggesting their potential to counteract multiple pathological processes associated with Alzheimer’s disease progression. Nevertheless, the effects of curcumin-loaded nano-liposomes on scopolamine-induced cognitive impairment, as well as their multitarget molecular mechanisms, remain insufficiently explored, particularly in studies integrating behavioral and molecular analyses. This study aimed to evaluate, through in vivo experimentation, the therapeutic potential of curcumin-loaded nano-liposome, a water-soluble formulation, in mitigating AD progression by enhancing memory performance, preserving cholinergic and synaptic integrity, and attenuating oxidative stress and neuroinflammation, thereby highlighting its promise as a multifaceted intervention for AD.

MATERIALS AND METHODS

Reagents

Scopolamine hydrobromide (#S0929) and donepezil hydrochloride (#D6821) were purchased from Sigma-Aldrich (St. Louis, MO, USA). TRIzol reagent was purchased from Invitrogen (Carlsbad, CA, USA).

Preparation of curcumin-loaded nanoliposomes

Curcumin-loaded nanoliposomes were formulated using a modified method based on a previously described protocol (Jang et al., 2024). Briefly, turmeric extract containing less than 80% curcumin and lecithin were mixed in 31.7 mL of ethanol. The mixture was heated at 70°C and stirred to generate a turmeric extract/lecithin solution. This solution was then emulsified by mixing with 357 mL of purified water and 3 g of medium-chain triglyceride (MCT) oil powder. The resulting emulsion was homogenized to produce curcumin-loaded nanoliposomes with a uniform particle size. Subsequently, maltodextrin was incorporated into the formulation, which was then spray-dried to obtain a powder containing 10.4% curcumin. The resulting curcumin-loaded nanoliposome formulation was designated as BNT-C060 (Hydrocumin™).

Animals and ethics statement

All animal experiments were approved by the Animal Experimentation Ethics Committee of JBNU Hospital (Approval No. JBUH-IACUC-2024-24) and were conducted in accordance with the guidelines of the Institutional Animal Care and Use Committee. A total of 120 male ICR mice (8 weeks old, 30-35 g) were used in this study. The experiments were conducted in two independent experimental sets, each consisting of 60 mice, and performed on different days to ensure experimental reproducibility. After one week of acclimatization and prior to treatment, mice were assigned to groups based on their locomotor activity in the Open Field Test and individual body weights and used for behavioral, biochemical, molecular, and histological analyses. Behavioral assessments were performed using separate cohorts of mice, with one set subjected to the Open Field Test and another independent set subjected to the Barnes Maze, thereby minimizing locomotor or task carryover confounds. Mice were obtained from Central Lab. Animal Inc. (Seoul, Korea) and housed under controlled environmental conditions (22 ± 2°C, 50-70% relative humidity, 12 h light/dark cycle) with ad libitum access to food and water. All mice were fed a standard commercial chow diet containing 15.2% crude protein, 4% crude fiber, 3.2% crude fat, 0.68% calcium, and 0.22% sodium (Biogenics, Daejeon, Korea) throughout the study.

Animal treatment and test schedule

After 7 days of acclimatization, all the mice were allocated to the control, scopolamine-induced AD, and Cur-NL -treated 250, 500, 1000 (mg/kg) and donepezil (3 mg/kg)-treated (as positive controls) groups according to body weight (each group, n=10). In this study, the sample size was selected on the basis of the experimental quantity requirement and the “3 R” principle (reduce, refine and replace the use of animals). From Day 1 to Day 30, the mice received daily oral administrations of Cur-NL (250, 500, or 1000 mg/kg), donepezil (3 mg/kg; positive control), or vehicle. Body weights were recorded weekly to monitor general health and ensure consistent dosing. With the exception of the OFT, all the behavioral experiments were conducted in two phases: a training phase and a test phase. On Day 30, the animals underwent the training phase of the behavioral assessments, followed by a test phase on Day 31.

On the test day, the animals were pretreated with Cur-NL or donepezil, followed by a single intraperitoneal injection of scopolamine (2 mg/kg) to induce acute and reversible cognitive impairment, a well-established model for evaluating pharmacological interventions targeting learning and memory deficits (Bartus et al., 1982; Klinkenberg and Blokland, 2010). Behavioral testing was initiated 30 min after scopolamine administration, corresponding to the peak cognitive-disrupting effects of the drug. On Day 32, the animals were euthanized, and samples were collected for downstream analyses. This included blood collection for potential biochemical markers, fresh hippocampal tissue collection for molecular studies, and whole-brain fixation in 4% PFA for histological and cryosectioning procedures. The overall treatment schedule and experimental flowchart are shown in Fig. 1.

Fig. 1.

Fig. 1

Overall treatment schedule and experimental flowchart.

Open field test (OFT)

The OFT was performed to assess spontaneous locomotor activity and exploratory behavior, and to evaluate potential anxiety- or motor-related confounds that could influence the interpretation of cognitive performance. The test was conducted in a square arena (30×30×30 cm) constructed of clear Plexiglas. The arena was placed in a quiet behavioral testing room under controlled dim illumination (approximately 30 lux at the center of the arena) to minimize stress-induced anxiety responses. Before testing, mice were acclimated to the testing room for at least 30 min. Each mouse was gently placed in the center of the arena and allowed to explore freely for a total duration of 6 min, consisting of a 1-min habituation period followed by a 5-min test period. Mouse movements were recorded using an overhead camera and analyzed using EthoVision XT video tracking software (version 16; Noldus Information Technology, Wageningen, The Netherlands). Total distance traveled, movement duration, and% activity were quantified. All behavioral assessments were conducted by an experimenter blinded to group allocation and were performed during daylight hours to minimize circadian variability. To eliminate olfactory cues between trials, the arena was thoroughly cleaned with 30% ethanol and allowed to dry before the next mouse was tested.

Barnes maze (BM) test

The BM was used to assess hippocampus-dependent spatial learning and memory while minimizing stress-related confounds. The apparatus consisted of a circular platform (91.5 cm diameter) elevated above the floor, with 20 evenly spaced holes around the perimeter, one of which led to a hidden escape box located beneath the surface. The maze was positioned in a dedicated behavioral testing room with stable distal visual cues placed on the surrounding walls. Illumination was maintained at a moderate aversive level (~200 lux at the platform surface) to motivate escape behavior without inducing excessive anxiety. To avoid experimenter bias, all behavioral testing and data analysis were performed by investigators blinded to treatment group allocation. Mice were acclimated to the testing room for at least 30 min prior to each session. Habituation and training were conducted one day prior to the experimental testing. During habituation, mice underwent two sessions. In the first session, mice were placed in an opaque start cylinder at the center of the maze for 10 s, after which the cylinder was removed and mice were allowed 1 min of free exploration. In the second session, mice were again placed in the start cylinder for 10 s, followed by gentle guidance to the escape box over 1 min. Mice remained inside the escape box for an additional 1 min to familiarize them with the location and environment. On the experimental day, mice were placed in the start cylinder for 10 s and then allowed to freely explore the maze to locate the escape box. Each trial ended when the mouse fully entered the escape box or after a maximum duration of 3 min, at which point the mouse was gently guided to the escape box. Mice were then returned to their home cages. To minimize procedural learning bias and assess acute spatial learning under pharmacologically induced cognitive impairment, the location of the escape hole in the Barnes maze was changed between the habituation and testing phases. This design ensured that task performance reflected new learning and spatial acquisition following scopolamine administration rather than retention of a previously learned location. The escape hole position was counterbalanced across experimental groups to avoid positional bias. Mouse behavior was recorded using an overhead camera and analyzed using EthoVision XT video tracking software (version 16; Noldus Information Technology, Wageningen, The Netherlands). Primary outcome measures included number of errors (nose pokes into non-target holes), number of repetitions, escape latency, and staying time in targeted quadrant. To eliminate olfactory cues, the maze surface, and the escape box was cleaned with 30% ethanol between trials and allowed to dry completely before subsequent testing. Tests were performed during daylight hours to minimize circadian variability.

Serum and tissue collection

After completion of the behavioral tests, each group of mice in each experimental set was divided into two groups: one (n=5) for collecting fresh brain samples for western blot analysis and blood samples and the other group (n=5) for cryosectioning. Blood samples were collected from the mice and centrifuged (3000×g, 10 min, 4°C) to obtain the serum. The intact fresh brain tissues of the mice were harvested by surgery, and the hippocampus region was isolated.

Preparation of brain tissue

The second group of animals (each group n=5) was anesthetized via the intraperitoneal injection of avertin (tribromoethanol; Sigma-Aldrich) at a dose of 200 mg/kg. Animals were fixed with 4% paraformaldehyde (PFA) after undergoing cardiac perfusion. The brains were removed and postfixed for 20 h at 4°C in 4% PFA solution. For cryoprotection, the postfixed brains were submerged in 30% sucrose for three days. The brains were cut in the coronal direction at a thickness of 20 µm via a CM1850 cryostat (Leica Biosystems, Germany) at 4°C. The brain sections were stored in 0.05 MPB containing 25% ethylene glycol and 25% glycerol.

Gene selection and STRING database analysis

To investigate the molecular mechanisms underlying the neuroprotective effects of curcumin-loaded nano-liposome in a scopolamine-induced AD mouse model, we selected a panel of genes associated with AD pathogenesis, neuroinflammation, synaptic plasticity, and cholinergic signaling. Specifically, targets such as tumor necrosis factor-alpha (TNF-α), interleukin-1 beta (IL-1β), interleukin-6 (IL-6), cyclooxygenase-2 (PTGS2), amyloid precursor protein (APP), β-secretase (BACE1), ADAM metallopeptidase domain 10 (ADAM10), acetylcholinesterase (ACHE), and brain-derived neurotrophic factor (Bdnf), among others, were included in the analysis (Lu et al., 2014). These targets were chosen on the basis of their established roles in AD pathology, such as amyloidogenic processing, neuroinflammation, and oxidative stress; their relevance to cognitive dysfunction in the scopolamine model; and previous evidence of modulation by polyphenolic or curcuminoid compounds. Protein‒protein interaction (PPI) networks were constructed via the STRING database (https://string-db.org/), version 12.0 (Szklarczyk et al., 2025). The selected genes were input into the STRING database to assess their interaction profiles using the following parameters: a confidence score ≥0.7 (high confidence); active interaction sources, including experiments; curated databases; co-expression, co-occurrence, and text mining; and species set to Mus musculus to align with the mouse model. To further outline the functional pathways affected by Cur-NL treatment in the scopolamine-induced mouse model, we performed Gene Ontology (GO) pathway enrichment analysis on the same set of DEGs from our STRING-based protein–protein interaction (PPI) network.

Acetylcholinesterase assay

AChE activity was determined via the method established by Ellman et al. (1961), with slight modifications. AChE activity was measured using the Acetylcholinesterase Assay Kit (Colorimetric, ab138871, Abcam) according to the manufacturer’s protocol. Briefly, 50 μL of acetylthiocholine reaction mixture was added to each well containing either the AChE standard, blank control, or test samples, resulting in a final reaction volume of 100 μL per well in a 96-well plate. The plate was incubated at room temperature for 30 min, protected from light. The absorbance was then measured at 410 nm using a microplate reader to monitor the increase in color intensity, which corresponds to AChE enzymatic activity.

Reverse transcription-quantitative PCR (RT‒qPCR)

Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and RNA purity and concentration were assessed spectrophotometrically. One microgram of total RNA was reverse transcribed into cDNA using a commercial reverse transcription kit according to the manufacturer’s instructions. qRT-PCR was performed using TB Green-based qPCR kits (TaKaRa Bio Inc., Japan, #RR420A) on an ABI PRISM 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The thermal cycling conditions were as follows: initial denaturation at 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 10 s and annealing/extension at 60°C for 30 s. Primer specificity was confirmed by melt curve analysis, which showed a single sharp peak for each primer pair. Amplification efficiencies of all primer sets were validated using standard curves generated from serially diluted cDNA and were within the acceptable range (90-110%). Relative gene expression levels were calculated using the comparative Ct (2⁻ΔΔCt) method. Glyceraldehyde-3-phosphate dehydrogenase (Gapdh) was used as the internal reference gene, and its expression stability was confirmed across experimental conditions. Primer sequences for the target genes—including acetylcholinesterase (Ache), cyclooxygenase-2 (Ptgs2), interleukin-1β (Il1b), interleukin-6 (Il6), tumor necrosis factor-α (Tnf), amyloid precursor protein (App), disintegrin and metalloproteinase domain-containing protein 10 (Adam10), beta-site amyloid precursor protein cleaving enzyme 1 (Bace1), brain-derived neurotrophic factor (Bdnf), and Gapdh—are listed in Table 1.

Table 1.

List of sequences of primers used for RT‒qPCR analysis

Targeted gene name Forward primer (5′-3′) Reverse primer (5′-3′)
Ache TTCCTTCGTGCCTGTGGTAGAC CCGTAAACCAGAAAGTAGGAGCC
Ptgs2 GCGACATACTCAAGCAGGAGCA AGTGGTAACCGCTCAGGTGTTG
Il1b TGGACCTTCCAGGATGAGGACA GTTCATCTCGGAGCCTGTAGTG
Il6 TACCACTTCACAAGTCGGAGGC CTGCAAGTGCATCATCGTTGTTC
Tnf GGTGCCTATGTCTCAGCCTCTT GCCATAGAACTGATGAGAGGGAG
App TCCGTGTGATCTACGAGCGCAT GCCAAGACATCGTCGGAGTAGT
Adam10 TGCACCTGTGCCAGCTCTGATG GATAGTCCGACCACTGAACTGC
Bace1 TGCTGCCATCACTGAATCGGAC GGAATGTGGGTCTGCTTCACCA
Bdnf GGCTGACACTTTTGAGCACGTC CTCCAAAGGCACTTGACTGCTG
Gapdh CATCACTGCCACCCAGAAGACTG ATGCCAGTGAGCTTCCCGTTCAG

Dihydroethidium (DHE) staining

Reactive oxygen species (ROS), predominantly superoxide anion (O₂•⁻), were assessed in hippocampal brain sections using dihydroethidium (DHE) staining. DHE is a cell-permeable fluorescent probe that is oxidized by superoxide to form ethidium, which intercalates into DNA and emits red fluorescence, thereby serving as an indicator of intracellular superoxide-associated oxidative stress. Briefly, mouse brains were fixed, cryoprotected, and sectioned coronally. Hippocampal sections were incubated with DHE (10 μM; D11347, Thermo Fisher Scientific, MA, USA) for 30 min at 37°C in a humidified, light-protected chamber. Following incubation, sections were washed three times with phosphate-buffered saline (PBS) and counterstained with DAPI to visualize cell nuclei. Fluorescence images were acquired using a confocal laser scanning microscope under identical acquisition settings (laser power, gain, offset, and exposure time) across all experimental groups. For qualitative assessment, representative images of the entire hippocampus and CA1 subregion were captured at consistent magnification. For quantitative analysis, regions of interest (ROIs) were manually defined within the hippocampus or CA1 region based on anatomical landmarks. DHE fluorescence intensity was quantified using ImageJ software (NIH, USA) following background subtraction. To account for potential variability in cell density and tissue thickness, DHE fluorescence intensity was normalized to the DAPI-positive nuclear area within each ROI. Normalized fluorescence values were averaged per animal and expressed as fold change relative to the control group.

Immunohistochemistry analysis

After completion of behavioral testing, mice were deeply anesthetized and transcardially perfused with cold phosphate-buffered saline (PBS), followed by fixation with 4% paraformaldehyde (PFA). Brains were carefully removed and post-fixed in 4% PFA at 4°C overnight, then cryoprotected in 30% sucrose solution until fully submerged. Fixed brain tissues were embedded in OCT compound and coronally sectioned at a thickness of 20 µm using a cryostat. Brain sections containing the hippocampus were mounted on glass slides, washed with PBS, and permeabilized with 0.3% Triton X-100 in PBS. Endogenous peroxidase activity was quenched using 0.3% hydrogen peroxide, followed by blocking with 5% normal serum in PBS to reduce nonspecific binding. Sections were then incubated overnight at 4°C with primary antibodies against PSD95 (rabbit monoclonal, #3450, 1:100; Cell Signaling Technology, Danvers, MA, USA) and Synapsin-1 (rabbit monoclonal, #5297, 1:100; Cell Signaling Technology). After washing, sections were incubated with appropriate biotinylated secondary antibodies, followed by incubation with an avidin–biotin complex solution. Immunoreactive signals were visualized using 3,3′-diaminobenzidine (DAB) as a chromogen. Sections were counterstained lightly, dehydrated through graded ethanol, cleared, and coverslipped. Immunostained sections were imaged using a bright-field microscope under identical acquisition settings. Representative images of the hippocampus and CA1 region were captured for each experimental group. The intensity and distribution of PSD95 and Synapsin-1 immunoreactivity were qualitatively assessed to evaluate synaptic integrity.

Western blot

The total protein from the hippocampus was extracted in SDS buffer supplemented with 1% protease and phosphatase inhibitor cocktails. The lysates were centrifuged at 13,000 rpm for 10 min at 4°C, and the protein concentrations were determined via a BCA protein assay kit. Next, the protein samples were separated via 5% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene difluoride (PVDF) membranes. After blocking with 5% skim milk, the membranes were incubated overnight at 4°C with primary antibodies against APP (1:1000, #76600), BACE1 (1:1000, #5606), cAMP response element-binding protein (CREB) (1:1000, #4820), p-CREB (1:1000, #9198) and postsynaptic density-95 (PSD95) (1:1000, #3450) from Cell Signaling Technology (Danvers, MA, USA), COX-2 (1:1000, sc-19999), IL-1β (1:1000, sc-52012), IL-6 (1:1000, sc-57315 ), TNF-α (1:1000, sc-52746), BDNF (1:1000, sc-546), and β-actin (1:1000, sc-69879) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA). The membrane was subsequently washed three times every 10 min with 1×TBST. Western blotting was followed by incubation with secondary antibodies conjugated to horseradish peroxidase (HRP), anti-rabbit IgG-HRP (1:5000; Enzo, Farmingdale, NY, USA, ADI-SAB-300-J), and anti-mouse IgG-HRP (1:5000; Enzo, ADI-SAB-100-J). The immunoreactive bands were developed with a chemiluminescence ECL detection system (GE Healthcare, Chicago, IL, USA).

Statistical analysis

The results are presented as the means ± SDs. Statistical significance was determined using a Student’s t test for two-group comparisons and one-way ANOVA followed by Tukey’s post hoc test for multiple group comparisons. Statistical analyses were performed using Prism 10 software, with significance denoted as (#p<0.05 compared with the control group; *p<0.05, **p<0.01, ***p<0.001 compared with the scopolamine-treated group). The sample size (n=10 per group) was determined based on prior studies using the scopolamine-induced cognitive impairment model and was sufficient to detect biologically meaningful differences with a statistical power of at least 80% at a significance level of α=0.05.

RESULTS

Curcumin-loaded nano-liposome (Cur-NL) ameliorates scopolamine-induced locomotor impairments in mice

To investigate whether AD pathology or treatments affect spontaneous movement or motor impairments, which are important for distinguishing cognitive deficits from mobility-related issues, we conducted the OFT. Reduced exploratory activity may reflect apathy or motivation deficits, which are common in individuals with AD. The OFT quantifies behaviors such as rearing, grooming, and center entries as movement duration and% activity. Cur-NL ameliorates scopolamine-induced locomotor impairments in mice. As shown in Fig. 2, scopolamine administration significantly reduced locomotor performance, as indicated by a marked decrease in total distance moved (Fig. 2A), overall activity percentage (Fig. 2B), and movement duration (Fig. 2C), compared with those of the control group. Compared with scopolamine alone, treatment with Cur-NL at doses of 250, 500, and 1000 mg/kg significantly reversed the scopolamine-induced reductions in distance moved, activity percentage, and movement duration. Notably, all the tested doses of Cur-NL exhibited efficacy comparable to that of donepezil, a standard cholinesterase inhibitor used as a positive control. These findings suggest that Cur-NL effectively counteracts the hypoactivity induced by scopolamine, indicating a potential cognition-enhancing effect.

Fig. 2.

Fig. 2

Effects of Cur-NL on scopolamine-induced locomotor alterations in the OFT. Mice were orally administered vehicle or curcumin-loaded nano-liposome at doses of 250, 500, or 1000 mg/kg daily for 30 days. Scopolamine 2 mg/kg was used to induce memory impairment and behavioral deficits. Behavioral responses were assessed using the OFT to evaluate general locomotor activity. (A) Total distance moved (cm) represents the baseline locomotor activity during the test session. (B) Total activity (% of time) indicates the proportion of time the animals engaged in active movement relative to the total duration of the test. (C) Total movement duration (s) represents the cumulative time spent in motion during the test session. Data are presented as mean ± SD. Statistical significance was determined by one-way ANOVA with Tukey’s test. ###p<0.001 vs. control group; *p<0.05, **p<0.01, ***p<0.001 vs. scopolamine group. Cur-NL; curcumin-loaded nano-liposome

Cur-NL improves spatial learning and memory in the barnes maze test in scopolamine-induced AD mice

To evaluate the therapeutic potential of Cur-NL on the cognitive deficits characteristic of AD, BM tests were conducted in scopolamine-induced AD mice. To assess spatial learning and memory, the Barnes maze (BM) test was conducted in scopolamine-induced AD mice (Fig. 3A). Scopolamine-treated mice made significantly more errors while locating the escape hole (Fig. 3B), reflecting spatial learning deficits. Cur-NL administration significantly reduced the number of errors in a dose-dependent manner. Additionally, scopolamine treatment significantly increased the number of repeated visits to incorrect holes (Fig. 3C), indicating impaired memory flexibility. Cur-NL significantly reduced these repeated visits at all doses, indicating improved cognitive flexibility and memory retention. The latency to locate the escape hole was significantly prolonged in the scopolamine group (Fig. 3D), whereas Cur-NL treatment significantly reduced this latency, further indicating enhanced learning and memory. Similarly, donepezil significantly reduced latency. Finally, the time spent in the target quadrant (Q4) during the test phase (Fig. 3E) was significantly reduced in the scopolamine-treated mice, indicating impaired memory recall. Cur-NL treatment significantly increased the time spent in the target quadrant, demonstrating improved spatial memory. Together, these results demonstrate that Cur-NL effectively improves spatial learning and memory in scopolamine-induced mice, supporting its potential as a therapeutic agent for AD-related cognitive dysfunction.

Fig. 3.

Fig. 3

Effects of Cur-NL on spatial learning and memory in the BM Test. Spatial memory performance was assessed using the BM Test after oral administration of vehicle or Cur-NL (250, 500, or 1000 mg/kg daily for 30 days). (A) Illustration of BM platform indicates the escape hole during learning and test phase. (B) Number of errors, defined as the number of incorrect hole visits before locating the escape box, was used as a measure of spatial learning ability. (C) Number of repeated visits to previously explored incorrect holes. (D) Latency time (s) to reach escape hole and (E) staying time in escape hole region (Q4) were recorded to evaluate perseverative behavior and cognitive flexibility. Data are expressed as mean ± SD. Statistical significance was determined by one-way ANOVA with Tukey’s test. ##p<0.01, ###p<0.001 vs. control group; *p<0.05, **p<0.01, ***p<0.001 vs. scopolamine group. Cur-NL; curcumin-loaded nano-liposome

Integrated molecular and network-level analysis

Protein-protein interaction (PPI) analysis using STRING revealed a densely connected network of key proteins encoded by neurodegeneration- and inflammation-related genes. The central nodes in the network included APP, IL1B (IL-1β protein), TNF (TNF-α protein), BACE1, and ACHE (AChE enzyme), which were strongly associated with inflammatory mediators (IL6, TNF, PTGS2) and the neuroplasticity-related factor BDNF (Fig. 4A). Notably, ACHE (encoding AChE) was identified as a central node within the network, exhibiting direct interactions with IL-6, PTGS2, APP, and BDNF. AChE, which is traditionally recognized for its role in hydrolyzing ACh at synaptic junctions, was found to be functionally integrated into pathways beyond neurotransmission, including neuroinflammation, amyloid processing, and apoptosis. Neuroinflammation, neurodegeneration, amyloid processing, and synaptic regulation-processes critically implicated in AD and related neurodegenerative conditions. Gene Ontology (GO) enrichment analysis of the same gene set revealed significant involvement in processes relevant to AD pathophysiology, including cytokine-mediated signaling, Aβ metabolic processes, synaptic signaling, cholinergic synapses, and the regulation of apoptotic pathways (Fig. 4B). Biological processes such as glial cell activation, IL-6 production, and the cellular response to Aβ were notably enriched and closely aligned with the known and emerging functions of AChE. These enriched pathways support the hypothesis that the therapeutic effects of Cur-NL arise from multitarget modulation across inflammatory, amyloidogenic, and synaptic networks.

Fig. 4.

Fig. 4

STRING PPI network and Gene Ontology pathway enrichment analysis. (A) Protein-protein interaction network (STRING) highlighting central targets involved in AD pathogenesis, including TNF-α, IL-1β, APP, BDNF, and ACHE. Node color intensity indicates the relative involvement of each gene in AD-related pathways. STRING network parameters included a confidence score ≥ 0.7 (high confidence), active interaction sources (experiments, curated databases, co-expression, co-occurrence, text mining), and species restricted to Mus musculus. (B) GO pathway enrichment analysis indicate probable Cur-NL -regulated targets. Bubble size indicates gene count per pathway, while color reflects significance (FDR-adjusted p-value). Enriched pathways depict key genes involved in top 20 pathways including memory-related functions.

Cur-NL restores cholinergic function in scopolamine-induced AD mice

To evaluate the neuroprotective effect of Cur-NL on the cholinergic system in scopolamine-induced AD mice, we assessed AChE activity, ACh content, and AChE mRNA expression in brain tissue. As shown in Fig. 5A, scopolamine treatment significantly increased AChE activity compared with that in the control group, suggesting enhanced degradation of ACh and impaired cholinergic neurotransmission. Treatment with Cur-NL at 250, 500, and 1000 mg/kg dose-dependently reduced AChE activity, with the 1000 mg/kg dose showing effects comparable to those of the standard cholinesterase inhibitor donepezil. Fig. 5B shows the ACh content in the hippocampal tissue. Scopolamine administration significantly reduced ACh levels, which was consistent with increased AChE activity and cholinergic dysfunction. Notably, Cur-NL significantly restored ACh levels at all the tested doses, indicating effective protection of the cholinergic system. Furthermore, as shown in Fig. 5C, Ache mRNA expression was markedly upregulated in the scopolamine-treated group compared with the control group. Cur-NL treatment led to dose-dependent suppression of Ache gene expression, with significant reductions observed at 500 and 1000 mg/kg. These findings collectively suggest that Cur-NL mitigates scopolamine-induced cholinergic dysfunction by downregulating AChE activity and gene expression and preserving ACh levels. This cholinergic modulation by Cur-NL supports the cognitive-enhancing effects observed in behavioral assessments.

Fig. 5.

Fig. 5

Effects of Cur-NL on ACh metabolism in the hippocampus. Mice were orally administered vehicle or Cur-NL at doses of 250, 500, or 1000 mg/kg daily for 30 days. (A) Acetylcholinesterase (AChE) activity was assessed as an index of ACh degradation. Scopolamine-treated mice showed significantly elevated AChE activity, indicating increased cholinergic breakdown. Cur-NL treatment significantly reduced AChE activity, suggesting preservation of cholinergic signaling. (B) ACh content was measured to evaluate neurotransmitter availability. Scopolamine administration led to a marked decrease in ACh levels, which was significantly restored by Cur-NL treatment. (C) Quantitative RT-PCR analysis of Ache. Data are presented as mean ± SD. Statistical significance was determined by one-way ANOVA with Tukey’s test. ###p<0.001 vs. control group; **p<0.01, ***p<0.001 vs. scopolamine group. Cur-NL; curcumin-loaded nano-liposome

Cur-NL attenuates scopolamine-induced neuroinflammation by suppressing proinflammatory gene expression

To investigate the anti-inflammatory effects of Cur-NL in scopolamine-induced AD mice, the mRNA expression levels of key proinflammatory markers- Il1b, Il6, Tnf, and Ptgs2-were measured in hippocampal tissue. As shown in Fig. 6A, scopolamine administration significantly elevated Ptgs2 expression compared with that in the control group, indicating enhanced neuroinflammation. Treatment with Cur-NL led to a dose-dependent reduction in Ptgs2 mRNA levels, with significant decreases observed at 500 and 1000 mg/kg. Fig. 6B shows that Il1b expression significantly increased following scopolamine treatment. Cur-NL administration, particularly at 1000 mg/kg, markedly reduced Il1b levels, whereas donepezil had similar anti-inflammatory effects. In line with these results, Fig. 6C shows that Il6 expression was significantly upregulated in the scopolamine group. Cur-NL significantly suppressed Il6 mRNA expression in a dose-dependent manner, with notable effects at 500 and 1000 mg/kg. Tnf expression was also significantly elevated in the scopolamine group. Cur-NL treatment resulted in a significant reduction in Tnf at all the tested doses (Fig. 6D), with the most pronounced effect at 1000 mg/kg. Collectively, these findings demonstrate that Cur-NL effectively attenuates neuroinflammatory responses induced by scopolamine and support its therapeutic potential in managing neuroinflammation associated with AD. To further validate the anti-inflammatory effects of Cur-NL at the protein level, the expression of COX2, IL-1β, IL-6, and TNF-α was examined in hippocampal tissues by Western blot analysis. As shown in Fig. 6E, scopolamine treatment markedly increased the protein levels of all examined proinflammatory mediators compared with those in the control group, confirming robust neuroinflammatory activation. In contrast, Cur-NL administration significantly suppressed scopolamine-induced upregulation of COX2, IL-1β, IL-6, and TNF-α in a dose-dependent manner. Densitometric quantification further demonstrated that Cur-NL significantly reduced COX2/β-actin, IL-1β/β-actin, IL-6/β-actin, and TNF-α/β-actin ratios, with the most pronounced inhibitory effects observed at doses of 500 and 1000 mg/kg (Fig. 6F). Notably, the anti-inflammatory efficacy of Cur-NL at the highest dose was comparable to that of donepezil. These protein-level findings are consistent with the mRNA expression data and further support the conclusion that Cur-NL effectively attenuates scopolamine-induced neuroinflammation in the hippocampus.

Fig. 6.

Fig. 6

Effects of Cur-NL on neuroinflammatory cytokine expression in the brain. Quantitative RT-PCR analysis of genes related to neuroinflammatory cytokine marker, (A) Ptgs2, (B) Il1b, (C) Il6, and (D) Tnf mRNA levels in brain tissue. Gene expression levels were normalized to the housekeeping gene Gapdh. (E) Representative Western blot images showing protein expression levels of COX2, IL-1β, IL-6, and TNF-α in brain tissue. β-Actin was used as a loading control. (F) Densitometric quantification of COX2, IL-1β, IL-6, and TNF-α protein levels normalized to β-actin. Data are expressed as mean ± SD. Statistical significance was determined by one-way ANOVA with Tukey’s test. ###p<0.001 vs. control group; *p<0.05, **p<0.01, ***p<0.001 vs. scopolamine group. Cur-NL; curcumin-loaded nano-liposome

Cur-NL reduces scopolamine-induced oxidative stress in the hippocampus

To investigate the effect of Cur-NL on oxidative stress in scopolamine-induced AD mice, we performed DHE staining of hippocampal brain sections, focusing on the CA1 region. DHE fluorescence intensity reflects the generation of superoxide radicals, a marker of oxidative stress. Scopolamine treatment markedly increased red fluorescence intensity in the hippocampus, particularly within the CA1 subfield, compared with that in the control group (Fig. 7A-7D), indicating a significant elevation of ROS levels consistent with the pathological features of AD. This enhanced oxidative stress aligns with the known contribution of ROS accumulation to cholinergic dysfunction and neurodegeneration in AD. Cur-NL treatment at 250, 500, and 1000 mg/kg dose-dependently reduced DHE fluorescence intensity (Fig. 7A-7D), demonstrating attenuation of ROS accumulation. The most pronounced reduction was observed at the 1000 mg/kg dose, which resulted in fluorescence levels comparable to those in the donepezil-treated group, highlighting potent antioxidant activity. These findings suggest that Cur-NL mitigates scopolamine-induced oxidative damage in the hippocampal CA1 region, thereby contributing to its neuroprotective and cognitive-enhancing effects in AD models.

Fig. 7.

Fig. 7

Cur-NL attenuates ROS accumulation in the hippocampus of scopolamine-induced memory-impaired mice. (A) Representative fluorescence images of hippocampal sections stained with dihydroethidium (DHE) to detect intracellular ROS. Scale bar=750 μm. (B) Higher-magnification images of the CA1 subregion. Scale bar=300 μm. (C, D) Quantification of DHE fluorescence intensity in the hippocampus and the CA1 subregion, expressed as fold change relative to the control group. Data are expressed as mean ± SD. Statistical significance was determined by one-way ANOVA with Tukey’s test. ###p<0.001 vs. control group; **p<0.01, ***p<0.001 vs. scopolamine group. Cur-NL; curcumin-loaded nano-liposome

Cur-NL modulates AD-related gene expression and enhances neurotrophic support

To further elucidate the molecular mechanisms underlying the neuroprotective effects of Cur-NL in scopolamine-induced AD mice, we analyzed the mRNA expression of key AD-related genes- App, Adam10, Bace1, and Bdnf-in hippocampal tissues. As shown in Fig. 8A, scopolamine administration significantly increased App mRNA levels compared with those in the control group, reflecting enhanced amyloidogenic processing. Cur-NL treatment resulted in a dose-dependent reduction in App expression, with significant decreases observed at 500 and 1000 mg/kg, similar to the donepezil-treated group. Adam10 mRNA, a marker of nonamyloidogenic App processing, was significantly decreased in scopolamine treated mice (Fig. 8B). Cur-NL restored Adam10 expression in a dose-dependent manner, with a significant increase at 1000 mg/kg, suggesting a shift toward nonamyloidogenic pathways. Bace1 mRNA, a key β-secretase involved in Aβ production, was also significantly elevated following scopolamine treatment. Cur-NL administration significantly suppressed Bace1 expression at all the tested doses (Fig. 8C), indicating the inhibition of amyloidogenic cleavage of App. Additionally, Bdnf mRNA levels (Fig. 8D) were significantly decreased by scopolamine treatment, which is consistent with impaired neurotrophic signaling and synaptic plasticity. Cur-NL markedly increased Bdnf expression at all doses, with the highest levels observed at 1000 mg/kg, paralleling the effects observed with donepezil. These data indicate that Cur-NL exerts its neuroprotective effects by reducing the expression of amyloidogenic genes (APP and BACE1), promoting nonamyloidogenic processing (Adam10), and enhancing neurotrophic support (Bdnf) (Lu et al., 2014). To further confirm the effects of Cur-NL on amyloid-related pathways at the protein level, the expression of APP and BACE-1 in hippocampal tissues was analyzed by Western blotting. As shown in Fig. 8E, scopolamine administration markedly increased the protein levels of APP and BACE-1 compared with those in the control group, consistent with enhanced amyloidogenic processing. In contrast, Cur-NL treatment significantly attenuated scopolamine-induced upregulation of both APP and BACE-1 proteins in a dose-dependent manner. Densitometric analysis revealed a significant reduction in APP/β-actin and BACE-1/β-actin ratios in Cur-NL–treated groups, with the most pronounced effects observed at 500 and 1000 mg/kg (Fig. 8F). Notably, the inhibitory effects of Cur-NL on APP and BACE-1 protein expression at the highest dose were comparable to those observed in the donepezil-treated group. These protein-level findings corroborate the mRNA expression data and further support the conclusion that Cur-NL suppresses amyloidogenic processing by downregulating APP and BACE-1 in the hippocampus.

Fig. 8.

Fig. 8

Effects of Cur-NL on amyloidogenesis-related gene expression in the brain. Quantitative RT-PCR analysis of (A) Amyloid precursor protein (App), (B) ADAM metallopeptidase domain 10 (Adam10), (C) Beta-site APP cleaving enzyme 1 (Bace1), and (D) Brain-derived neurotrophic factor (Bdnf) mRNA levels in brain tissue. Gene expression levels were normalized to the housekeeping gene Gapdh. (E) Representative Western blot images showing protein expression levels of APP and BACE-1 in brain tissue. β-Actin was used as a loading control. (F) Densitometric quantification of APP and BACE-1 protein levels normalized to β-actin. Data are expressed as mean ± SD. Statistical significance was determined by one-way ANOVA with Tukey’s test. ###p<0.001 vs. control group; **p<0.01, ***p<0.001 vs. scopolamine group. Cur-NL; curcumin-loaded nano-liposome

Cur-NL restores synaptic integrity in the hippocampus of scopolamine-treated mice

To determine whether Cur-NL improves synaptic integrity in the hippocampus, immunohistochemical analyses of the synaptic markers PSD95 and Synapsin-1 were performed. As shown in Fig. 9A and 9B, scopolamine administration markedly reduced PSD95 immunoreactivity in the hippocampus, particularly in the CA1 region, indicating synaptic disruption. In contrast, Cur-NL treatment dose-dependently restored PSD95 expression, with pronounced recovery observed at 500 and 1000 mg/kg. The highest dose of Cur-NL exhibited a synaptic-preserving effect comparable to that of donepezil. Similarly, Synapsin-1 immunoreactivity was substantially decreased in the hippocampus and CA1 region following scopolamine treatment (Fig. 9C, 9D), reflecting impaired presynaptic integrity. Cur-NL administration significantly reversed the scopolamine-induced reduction in Synapsin-1 expression in a dose-dependent manner, with marked restoration at higher doses. Notably, Cur-NL at 1000 mg/kg effectively normalized Synapsin-1 staining patterns comparable to those of donepezil-treated mice. Taken together, these findings demonstrate that Cur-NL effectively preserves both post- and presynaptic structures in the hippocampus, supporting its role in mitigating synaptic loss associated with scopolamine-induced cognitive impairment.

Fig. 9.

Fig. 9

Cur-NL restores hippocampal synaptic protein expression in scopolamine-induced mice. (A) Representative immunohistochemical images showing PSD95 expression in the hippocampus and CA1 region. (B) Quantification of PSD95 intensity in the hippocampus and the CA1 region, expressed as fold change relative to the control group. (C) Representative immunohistochemical images showing Synapsin-1 expression in the hippocampus and CA1 region Scale bars are indicated in the images. (D) Quantification of Synapsin-1 intensity in the hippocampus and CA1 region, expressed as fold change relative to the control group. Scale bars=750 μm (hippocampus) and 300 μm (CA1). Data are presented as mean ± SD. Statistical significance was determined by one-way ANOVA followed by Tukey’s post hoc test. ###p<0.001 vs. control group; **p<0.01, ***p<0.001 vs. scopolamine group. Cur-NL; curcumin-loaded nano-liposome

Cur-NL enhances synaptic plasticity via the upregulation of BDNF, p-CREB, and PSD95

To investigate the molecular basis of the cognitive improvement induced by Cur-NL, we assessed the protein expression levels of key synaptic plasticity markers-BDNF, p-CREB, and PSD95-in hippocampal tissue using western blotting. The data presented in Fig. 10 show that scopolamine administration significantly reduced the expression of BDNF, phosphorylated CREB (p-CREB), and PSD95 compared with those in the control group, indicating that synaptic dysfunction is associated with memory impairment. Cur-NL treatment at 250, 500, and 1000 mg/kg dose-dependently restored the expression of these proteins. The quantification results revealed that BDNF levels were significantly increased at 500 and 1000 mg/kg Cur-NL, reaching values comparable to those observed with donepezil treatment (Fig. 10). Similarly, the p-CREB/CREB ratio-a key indicator of CREB pathway activation-was significantly decreased in the scopolamine group, whereas Cur-NL treatment significantly increased p-CREB levels (Fig. 10) at all tested doses, supporting the activation of CREB-mediated transcription involved in neuroplasticity and memory consolidation. Moreover, PSD95, a postsynaptic density protein critical for synaptic stability and signaling, was also significantly diminished in scopolamine-treated mice. Cur-NL treatment significantly reversed this reduction at all doses, similar to the effect of donepezil (Fig. 10). Together, these results indicate that Cur-NL enhances synaptic plasticity by increasing BDNF expression, activating CREB signaling, and increasing PSD95 levels. The enhancement of synaptic plasticity observed in our molecular experiments contributes to the cognitive improvements demonstrated in our behavioral assessments.

Fig. 10.

Fig. 10

Effects of Cur-NL on the expression of synaptic proteins in scopolamine-treated mouse brains. Western blot analysis was performed to evaluate the expression of synaptic plasticity-related proteins in brain tissue. (A) Brain-derived neurotrophic factor, phosphorylated cAMP response element-binding protein (p-CREB), total CREB, postsynaptic density protein 95 (PSD95), and β-actin as a loading control. (B) Densitometric quantification was normalized to β-actin and is presented as mean ± SD. Statistical significance was determined by one-way ANOVA with Tukey’s test. ###p<0.001 vs. control group; *p<0.05, ***p<0.001 vs. scopolamine group. Cur-NL; curcumin-loaded nano-liposome

DISCUSSION

This study evaluated the neuroprotective potential of Cur-NL, a nano-formulated, water-soluble curcumin, using a scopolamine-induced mouse model that is widely employed to investigate transient cholinergic dysfunction and associated cognitive impairment. By benchmarking Cur-NL against donepezil, a clinically approved acetylcholinesterase (AChE) inhibitor, we aimed to assess the efficacy of Cur-NL in mitigating cholinergic hypofunction–related cognitive deficits and to expand the evidence supporting plant-derived polyphenolic interventions for neurodegeneration-associated cognitive decline. Our multimodal approach-integrating behavioral assays, RT-qPCR, enzyme activity measurements, immunohistochemistry, and protein–protein interaction network analysis-enabled a comprehensive evaluation of the molecular and functional effects of Cur-NL.

The hippocampus was selected as the primary region of interest because of its critical role in memory consolidation and its early vulnerability to cholinergic dysfunction, synaptic impairment, neuroinflammation, and oxidative stress-processes that are commonly associated with prodromal or early functional stages of Alzheimer’s disease rather than with advanced neuropathology (Moloney et al., 2021; Mufson et al., 2015). Importantly, the scopolamine model does not recapitulate progressive AD pathology such as amyloid plaque deposition or tau aggregation, but instead represents an acute and reversible disruption of muscarinic cholinergic signaling. Accordingly, the present findings should be interpreted in the context of early, functional cognitive impairment driven by cholinergic hypofunction, rather than as evidence of disease-modifying effects in progressive AD. Despite its limitations, the scopolamine-induced model is a well-established paradigm for producing transient cholinergic dysfunction and cognitive impairment. In this study, it was used to reproduce key functional and molecular features associated with the early or prodromal phases of AD, including cholinergic hypofunction, neuroinflammation, oxidative stress, and memory deficits—processes widely recognized as early regulators of AD pathogenesis and commonly targeted in preventive or symptomatic intervention studies. Moreover, the scopolamine model induces acute and reversible cognitive impairment rather than long-term memory deficits. Therefore, the escape hole location in the BM was intentionally changed between habituation and testing phases to assess new spatial learning under cholinergic disruption rather than retention of prior spatial memory. This design strengthens the interpretation that Cur-NL improves cognitive acquisition during acute cholinergic challenge rather than merely enhancing recall of previously learned task contingencies. Thus, the term “early-stage AD” in this work reflects functional and molecular vulnerability rather than progressive neuropathological change. Accordingly, the present findings should be interpreted as evidence of protective effects against AD-related cognitive dysfunction driven primarily by cholinergic, inflammatory, and oxidative mechanisms, rather than as disease-modifying effects on progressive Alzheimer’s pathology. Further validation in chronic pharmacological or transgenic AD models will be required to establish the translational relevance of Cur-NL.

Importantly, free curcumin exhibits extremely poor aqueous solubility and limited oral bioavailability, which complicates dose-matched in vivo comparisons and often results in inconsistent brain exposure in rodent models. Consequently, many preclinical investigations of nano-formulated curcumin emphasize efficacy benchmarking against pharmacological controls rather than against free curcumin. Nevertheless, the inclusion of a free-curcumin group would provide additional insight into formulation-specific effects. A limitation of the present study is the absence of a direct comparison between Cur-NL and free curcumin. Accordingly, future studies employing matched exposure conditions are warranted to delineate the precise contribution of nano-liposomal delivery to the observed neuroprotective outcomes.

The Cur-NL doses used (250-1000 mg/kg) were selected in light of curcumin’s well-documented pharmacokinetic constraints, including poor solubility, rapid metabolism, and limited brain bioavailability, which often necessitate high oral dosing in rodent models (Anand et al., 2007; Prasad et al., 2014). Although nano-formulation improves dispersion and absorption, similar dose ranges have been widely applied in preclinical neurodegeneration models and correspond to clinically relevant human-equivalent doses following body surface area–based scaling (Mahmood, 2002; Ringman et al., 2012). While detailed physicochemical characterization was beyond the scope of this study, nanoliposomal curcumin formulations have previously been shown to enhance systemic absorption, intracellular uptake, and circulation time, thereby improving biological efficacy in vivo (Jang et al., 2024; Xu et al., 2026).

Using this experimental framework, Cur-NL significantly ameliorated scopolamine-induced impairments in locomotor activity assessed by the open field test (Fig. 2) and spatial learning evaluated using the Barnes maze (Fig. 3), consistent with previous reports on curcumin and curcumin analogs in models of cholinergic dysfunction (Hussain et al., 2022; Shao et al., 2023). The increased exploratory activity and altered performance in the Barnes maze observed following scopolamine administration likely reflect hyperactivity or behavioral disinhibition, phenomena that have been previously reported in this model and are influenced by dose and route of administration (Kim et al., 2021; Walrave et al., 2016). These findings support the utility of the scopolamine model for assessing interventions targeting early-stage cognitive dysfunction, rather than progressive neurodegenerative processes.

Notably, the absence of a strictly linear dose-dependent response in behavioral outcomes may reflect a pharmacodynamic plateau effect, particularly for multi-target compounds such as curcumin, which modulates diverse signaling pathways including oxidative stress, inflammation, and synaptic plasticity (Anand et al., 2007; Hewlings and Kalman, 2017). In addition, cognitive behavioral assays such as the Y-maze and Barnes maze are subject to ceiling effects, which can limit the detection of incremental improvements at higher doses (Vorhees and Williams, 2014). These factors may explain the discrepancy between behavioral and molecular dose-response patterns observed in this study.

Mechanistically, protein–protein interaction network and gene ontology analyses highlighted acetylcholinesterase as a central node linking cholinergic neurotransmission with neuroinflammatory and synaptic pathways (Fig. 4). Importantly, the predictive network-based findings warrant mechanistic validation, which represents an important future research direction toward establishing causal relationships and translating these insights into preclinical testing in both scopolamine-induced and AD-relevant animal models. Consistent with this network-based prediction, Cur-NL reduced AChE activity and expression while restoring acetylcholine levels, paralleling the pharmacological action of donepezil (Fig. 5). Given that scopolamine-induced muscarinic receptor blockade is associated with increased AChE activity, reduced choline acetyltransferase function, and impaired synaptic transmission (Thongrong et al., 2024), the ability of Cur-NL to normalize cholinergic signaling likely underlies its cognitive benefits in this model. In addition to cholinergic modulation, Cur-NL attenuated scopolamine-induced neuroinflammatory gene expression (Fig. 6) and oxidative stress (Fig. 7) in the hippocampus (Abdul-Rahman et al., 2024), as evidenced by reduced proinflammatory cytokine transcripts and decreased ROS levels (Alikhanzade et al., 2025; Mosalam et al., 2025). These effects support the anti-inflammatory and antioxidant properties of Cur-NL.

It is important to note that the present study did not directly quantify curcumin levels in brain tissue. However, previous studies have shown that nano-liposomal and nanoparticle-based formulations can improve the systemic bioavailability of curcumin and facilitate its delivery to target tissues through enhanced cellular uptake and membrane interactions (Jang et al., 2024). In addition, curcumin has been reported to exert neuroprotective effects within the brain in various models of neurodegeneration, suggesting its potential to influence central nervous system function (Begum et al., 2008; Del Prado-Audelo et al., 2019).

In the present study, the observed improvements in hippocampus-dependent behavioral outcomes, together with the modulation of cholinergic signaling, neuroinflammation, and oxidative stress within hippocampal tissue, provide indirect evidence supporting the central activity of Cur-NL. Nevertheless, direct pharmacokinetic evaluation, including brain distribution analysis, will be necessary to further clarify tissue exposure and validate the translational relevance of these findings.

Notably, oxidative stress and neuroinflammation are closely linked to cholinergic dysfunction. Proinflammatory cytokines such as TNF-α and IL-1β have been shown to increase acetylcholinesterase (AChE) activity and impair cholinergic neurotransmission, while oxidative stress contributes to cholinergic neuronal damage and enhanced ACh degradation (Festini et al., 2016; Nizri and Brenner, 2013; Zhao and Zhao, 2013). In addition, the cholinergic anti-inflammatory pathway highlights a bidirectional interaction between inflammatory signaling and cholinergic regulation (Pavlov and Tracey, 2017). Therefore, the simultaneous reduction in oxidative stress and inflammatory mediators observed in this study may contribute to the restoration of cholinergic balance and cognitive function.

Cur-NL modulated genes related to amyloid precursor protein processing and synaptic plasticity, including APP, BACE1, ADAM10, BDNF, p-CREB, and PSD95, and preserved hippocampal synaptic integrity, as evidenced by restoration of pre- and postsynaptic markers, particularly in the CA1 region (Fig. 8-10). However, given the lack of progressive amyloid pathology in the scopolamine model, these changes likely reflect neuroprotective and synapse-supportive signaling rather than direct effects on amyloid deposition (Wu et al., 2020; Zhong et al., 2018). Accordingly, the present findings should be interpreted as evidence of protective effects against AD-related cognitive dysfunction primarily driven by cholinergic hypofunction, neuroinflammation, and oxidative stress, rather than as disease-modifying effects on progressive Alzheimer’s pathology, and further validation in chronic pharmacological or transgenic Alzheimer’s disease models will be required to establish the translational relevance of Cur-NL.

In summary, the present study demonstrates that Cur-NL exerts multitarget neuroprotective effects in a scopolamine-induced model of cholinergic dysfunction, improving cognitive performance and modulating pathways related to cholinergic signaling, neuroinflammation, oxidative stress, and synaptic plasticity (Fig. 11). These findings support the potential utility of Cur-NL as a preventive or adjunct therapeutic candidate for AD-related cognitive dysfunction associated with cholinergic impairment. Further validation in transgenic or pathology-driven Alzheimer’s disease models, together with AD-relevant behavioral and molecular assessments, will be essential to establish the translational relevance of Cur-NL for progressive Alzheimer’s disease.

Fig. 11.

Fig. 11

Proposed multitarget mechanism of Cur-NL in a scopolamine-induced cognitive dysfunction model.

bt-34-4-866-supple.pdf (24.8MB, pdf)

ACKNOWLEDGMENTS

This research was supported by the National Research Foundation of Korea (NRF-2021R1C1C2007371, and RS-2024-00335573). This work was supported in part by the National Research Council of Science & Technology grant by the Korea government (MSIT) (No. CAP 23053-000). We are highly acknowledged to our funding authority. We also extend our utmost gratitude to Professor Jae Hoon Cheong for his thoughtful review of the manuscript and insightful suggestions regarding the experiments and Dr. Geum-Hwa Lee of the Non-Clinical Evaluation Center (NCEC), Jeonbuk National University Medical School for their invaluable insights and feedback on this manuscript.

Footnotes

CONFLICT OF INTEREST

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

REFERENCES

  1. Abdul-Rahman T., Awuah W. A., Mikhailova T., Kalmanovich J., Mehta A., Ng J. C., Coghlan M. A., Zivcevska M., Tedeschi A. J., de Oliveira E. C., Kumar A., Cantu-Herrera E., Lyndin M., Sikora K., Alexiou A., Bilgrami A. L., Al-Ghamdi K. M., Perveen A., Papadakis M., Ashraf G. M. Antioxidant, anti-inflammatory and epigenetic potential of curcumin in Alzheimer's disease. Biofactors. 2024;50:693–708. doi: 10.1002/biof.2039. [DOI] [PubMed] [Google Scholar]
  2. Agostinho P., Cunha R. A., Oliveira C. Neuroinflammation, oxidative stress and the pathogenesis of Alzheimer's disease. Curr. Pharm. Des. 2010;16:2766–2778. doi: 10.2174/138161210793176572. [DOI] [PubMed] [Google Scholar]
  3. Alikhanzade M., Khosravi M., Hosseini M., Rajabian A. Gallic acid enhances memory, learning and reduces neuroinflammation in a rat model of scopolamine-induced cholinergic dysfunction. Inflammopharmacology. 2025;33:2095–2108. doi: 10.1007/s10787-025-01699-w. [DOI] [PubMed] [Google Scholar]
  4. Anand P., Kunnumakkara A. B., Newman R. A., Aggarwal B. B. Bioavailability of curcumin: Problems and promises. Mol. Pharm. 2007;4:807–818. doi: 10.1021/mp700113r. [DOI] [PubMed] [Google Scholar]
  5. Bartus R. T., Dean R. L., Beer B., Lippa A. S. The cholinergic hypothesis of geriatric memory dysfunction. Science. 1982;217:408–414. doi: 10.1126/science.7046051. [DOI] [PubMed] [Google Scholar]
  6. Begum A. N., Jones M. R., Lim G. P., Morihara T., Kim P., Heath D. D., Rock C. L., Pruitt M. A., Yang F., Hudspeth B., Hu S., Faull K. F., Teter B., Cole G. M., Frautschy S. A. Curcumin structure-function, bioavailability, and efficacy in models of neuroinflammation and Alzheimer's disease. J. Pharmacol. Exp. Ther. 2008;326:196–208. doi: 10.1124/jpet.108.137455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Del Prado-Audelo M. L., Caballero-Floran I. H., Meza-Toledo J. A., Mendoza-Munoz N., Gonzalez-Torres M., Floran B., Cortes H., Leyva-Gomez G. Formulations of curcumin nanoparticles for brain diseases. Biomolecules. 2019;9:56. doi: 10.3390/biom9020056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Ellman G. L., Courtney K. D., Andres V., Jr, Feather-Stone R. M. A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem. Pharmacol. 1961;7:88–95. doi: 10.1016/0006-2952(61)90145-9. [DOI] [PubMed] [Google Scholar]
  9. Festini S. B., McDonough I. M., Park D. C. The busier the better: Greater busyness is associated with better cognition. Front. Aging Neurosci. 2016;8:98. doi: 10.3389/fnagi.2016.00098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Girst G., Otvos S. B., Fulop F., Balogh G. T., Hunyadi A. Pharmacokinetics-driven evaluation of the antioxidant activity of curcuminoids and their major reduced metabolites-a medicinal chemistry approach. Molecules. 2021;26:3542. doi: 10.3390/molecules26123542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Hernandez-Rodriguez M., Arciniega-Martinez I. M., Garcia-Marin I. D., Correa-Basurto J., Rosales-Hernandez M. C. Chronic administration of scopolamine increased GSK3betaP9, beta secretase, amyloid beta, and oxidative stress in the hippocampus of wistar rats. Mol. Neurobiol. 2020;57:3979–3988. doi: 10.1007/s12035-020-02009-x. [DOI] [PubMed] [Google Scholar]
  12. Hewlings S. J., Kalman D. S. Curcumin: A review of its effects on human health. Foods. 2017;6:92. doi: 10.3390/foods6100092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hossain M. K., Kim H. R., Chae H. J. Aging phenotype in AD brain organoids: Track to success and challenges. Ageing Res. Rev. 2024;96:102256. doi: 10.1016/j.arr.2024.102256. [DOI] [PubMed] [Google Scholar]
  14. Hussain H., Ahmad S., Shah S. W. A., Ullah A., Rahman S. U., Ahmad M., Almehmadi M., Abdulaziz O., Allahyani M., Alsaiari A. A., Halawi M., Alamer E. Synthetic mono-carbonyl curcumin analogues attenuate oxidative stress in mouse models. Biomedicines. 2022;10:2597. doi: 10.3390/biomedicines10102597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Jang G. H., Kim Y. M., Kim D. H., Shin J. W., Yoon S. Y., Bae J. W., Choi J. H., Yoon M. S. A chitosan/alginate coated nano-liposome to improve intestinal absorption of curcumin for oral administration. Food Sci. Biotechnol. 2024;33:1707–1714. doi: 10.1007/s10068-023-01461-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Kamat P. K., Kalani A., Rai S., Swarnkar S., Tota S., Nath C., Tyagi N. Mechanism of oxidative stress and synapse dysfunction in the pathogenesis of Alzheimer's disease: Understanding the therapeutics strategies. Mol. Neurobiol. 2016;53:648–661. doi: 10.1007/s12035-014-9053-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kaur D., Sharma V., Deshmukh R. Activation of microglia and astrocytes: A roadway to neuroinflammation and Alzheimer's disease. Inflammopharmacology. 2019;27:663–677. doi: 10.1007/s10787-019-00580-x. [DOI] [PubMed] [Google Scholar]
  18. Kim S. K., Kwon D. A., Kim Y. S., Lee H. S., Kim H. K., Kim W. K. Standardized extract (HemoHIM) protects against scopolamine-induced amnesia in a murine model. Evid. Based Complement. Alternat. Med. 2021;2021:8884243. doi: 10.1155/2021/8884243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Klinkenberg I., Blokland A. The validity of scopolamine as a pharmacological model for cognitive impairment: A review of animal behavioral studies. Neurosci. Biobehav. Rev. 2010;34:1307–1350. doi: 10.1016/j.neubiorev.2010.04.001. [DOI] [PubMed] [Google Scholar]
  20. Kril J. J., Patel S., Harding A. J., Halliday G. M. Neuron loss from the hippocampus of Alzheimer's disease exceeds extracellular neurofibrillary tangle formation. Acta Neuropathol. 2002;103:370–376. doi: 10.1007/s00401-001-0477-5. [DOI] [PubMed] [Google Scholar]
  21. Li S. P., Wang Y. W., Qi S. L., Zhang Y. P., Deng G., Ding W. Z., Ma C., Lin Q. Y., Guan H. D., Liu W., Cheng X. M., Wang C. H. Analogous beta-carboline alkaloids harmaline and harmine ameliorate scopolamine-induced cognition dysfunction by attenuating acetylcholinesterase activity, oxidative stress, and inflammation in mice. Front. Pharmacol. 2018;9:346. doi: 10.3389/fphar.2018.00346. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Liu W., Zhai Y., Heng X., Che F. Y., Chen W., Sun D., Zhai G. Oral bioavailability of curcumin: Problems and advancements. J. Drug Target. 2016;24:694–702. doi: 10.3109/1061186X.2016.1157883. [DOI] [PubMed] [Google Scholar]
  23. Lu B., Nagappan G., Lu Y. BDNF and synaptic plasticity, cognitive function, and dysfunction. Handb. Exp. Pharmacol. 2014;220:223–250. doi: 10.1007/978-3-642-45106-5_9. [DOI] [PubMed] [Google Scholar]
  24. Lugrin J., Rosenblatt-Velin N., Parapanov R., Liaudet L. The role of oxidative stress during inflammatory processes. Biol. Chem. 2014;395:203–230. doi: 10.1515/hsz-2013-0241. [DOI] [PubMed] [Google Scholar]
  25. Luo J., Zhang L., Ning N., Jiang H., Yu S. Y. Neotrofin reverses the effects of chronic unpredictable mild stress on behavior via regulating BDNF, PSD-95 and synaptophysin expression in rat. Behav. Brain Res. 2013;253:48–53. doi: 10.1016/j.bbr.2013.07.014. [DOI] [PubMed] [Google Scholar]
  26. Mahmood I. Interspecies scaling: Predicting oral clearance in humans. Am. J. Ther. 2002;9:35–42. doi: 10.1097/00045391-200201000-00008. [DOI] [PubMed] [Google Scholar]
  27. Memarzia A., Khazdair M. R., Behrouz S., Gholamnezhad Z., Jafarnezhad M., Saadat S., Boskabady M. H. Experimental and clinical reports on anti-inflammatory, antioxidant, and immunomodulatory effects of Curcuma longa and curcumin, an updated and comprehensive review. Biofactors. 2021;47:311–350. doi: 10.1002/biof.1716. [DOI] [PubMed] [Google Scholar]
  28. Moloney C. M., Lowe V. J., Murray M. E. Visualization of neurofibrillary tangle maturity in Alzheimer's disease: A clinicopathologic perspective for biomarker research. Alzheimers Dement. 2021;17:1554–1574. doi: 10.1002/alz.12321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Mosalam E. M., Atya S. M., Mesbah N. M., Allam S., Mehanna E. T. Neuroprotective effects of cilomilast and chlorogenic acid against scopolamine-induced memory deficits via modulation of the cAMP/PKA-CREB-BDNF pathway. Int. J. Mol. Sci. 2025;26:3108. doi: 10.3390/ijms26073108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Mufson E. J., Mahady L., Waters D., Counts S. E., Perez S. E., DeKosky S. T., Ginsberg S. D., Ikonomovic M. D., Scheff S. W., Binder L. I. Hippocampal plasticity during the progression of Alzheimer's disease. Neuroscience. 2015;309:51–67. doi: 10.1016/j.neuroscience.2015.03.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Nita M., Grzybowski A. The role of the reactive oxygen species and oxidative stress in the pathomechanism of the age-related ocular diseases and other pathologies of the anterior and posterior eye segments in adults. Oxid. Med. Cell. Longev. 2016;2016:3164734. doi: 10.1155/2016/3164734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Nizri E., Brenner T. Modulation of inflammatory pathways by the immune cholinergic system. Amino Acids. 2013;45:73–85. doi: 10.1007/s00726-011-1192-8. [DOI] [PubMed] [Google Scholar]
  33. Pandey A., Chaturvedi M., Mishra S., Kumar P., Somvanshi P., Chaturvedi R. Reductive metabolites of curcumin and their therapeutic effects. Heliyon. 2020;6:e05469. doi: 10.1016/j.heliyon.2020.e05469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Pavlov V. A., Tracey K. J. Neural regulation of immunity: Molecular mechanisms and clinical translation. Nat. Neurosci. 2017;20:156–166. doi: 10.1038/nn.4477. [DOI] [PubMed] [Google Scholar]
  35. Prasad S., Tyagi A. K., Aggarwal B. B. Recent developments in delivery, bioavailability, absorption and metabolism of curcumin: The golden pigment from golden spice. Cancer Res. Treat. 2014;46:2–18. doi: 10.4143/crt.2014.46.1.2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Rao Y. L., Ganaraja B., Murlimanju B. V., Joy T., Krishnamurthy A., Agrawal A. Hippocampus and its involvement in Alzheimer's disease: A review. 3 Biotech. 2022;12:55. doi: 10.1007/s13205-022-03123-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Ringman J. M., Frautschy S. A., Teng E., Begum A. N., Bardens J., Beigi M., Gylys K. H., Badmaev V., Heath D. D., Apostolova L. G., Porter V., Vanek Z., Marshall G. A., Hellemann G., Sugar C., Masterman D. L., Montine T. J., Cummings J. L., Cole G. M. Oral curcumin for Alzheimer's disease: Tolerability and efficacy in a 24-week randomized, double blind, placebo-controlled study. Alzheimers Res. Ther. 2012;4:43. doi: 10.1186/alzrt146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Sarawi W. S., Alhusaini A. M., Fadda L. M., Alomar H. A., Albaker A. B., Aljrboa A. S., Alotaibi A. M., Hasan I. H., Mahmoud A. M. Curcumin and nano-curcumin mitigate copper neurotoxicity by modulating oxidative stress, inflammation, and Akt/GSK-3beta signaling. Molecules. 2021;26:5591. doi: 10.3390/molecules26185591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Shao S., Ye X., Su W., Wang Y. Curcumin alleviates Alzheimer's disease by inhibiting inflammatory response, oxidative stress and activating the AMPK pathway. J. Chem. Neuroanat. 2023;134:102363. doi: 10.1016/j.jchemneu.2023.102363. [DOI] [PubMed] [Google Scholar]
  40. Somin S., Kulasiri D., Samarasinghe S. Alleviating the unwanted effects of oxidative stress on Abeta clearance: A review of related concepts and strategies for the development of computational modelling. Transl. Neurodegener. 2023;12:11. doi: 10.1186/s40035-023-00344-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Szklarczyk D., Nastou K., Koutrouli M., Kirsch R., Mehryary F., Hachilif R., Hu D., Peluso M. E., Huang Q., Fang T., Doncheva N. T., Pyysalo S., Bork P., Jensen L. J., von Mering C. The STRING database in 2025: Protein networks with directionality of regulation. Nucleic Acids Res. 2025;53:D730–D737. doi: 10.1093/nar/gkae1113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Tabanelli R., Brogi S., Calderone V. Improving curcumin bioavailability: Current strategies and future perspectives. Pharmaceutics. 2021;13:1715. doi: 10.3390/pharmaceutics13101715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Tang K. S. The cellular and molecular processes associated with scopolamine-induced memory deficit: A model of Alzheimer's biomarkers. Life Sci. 2019;233:116695. doi: 10.1016/j.lfs.2019.116695. [DOI] [PubMed] [Google Scholar]
  44. Thongrong S., Promsrisuk T., Sriraksa N., Surapinit S., Jittiwat J., Kongsui R. Alleviative effect of scopolamine-induced memory deficit via enhancing antioxidant and cholinergic function in rats by pinostrobin from Boesenbergia rotunda (L.) Biomed. Rep. 2024;21:130. doi: 10.3892/br.2024.1818. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Tonnies E., Trushina E. Oxidative stress, synaptic dysfunction, and Alzheimer's disease. J. Alzheimers Dis. 2017;57:1105–1121. doi: 10.3233/JAD-161088. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Vorhees C. V., Williams M. T. Assessing spatial learning and memory in rodents. ILAR J. 2014;55:310–332. doi: 10.1093/ilar/ilu013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Walrave L., Vinken M., Albertini G., De Bundel D., Leybaert L., Smolders I. J. Inhibition of connexin43 hemichannels impairs spatial short-term memory without affecting spatial working memory. Front. Cell. Neurosci. 2016;10:288. doi: 10.3389/fncel.2016.00288. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Wang W. Y., Tan M. S., Yu J. T., Tan L. Role of pro-inflammatory cytokines released from microglia in Alzheimer's disease. Ann. Transl. Med. 2015;3:136. doi: 10.3978/j.issn.2305-5839.2015.03.49. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Wu D., Wu F., Lin R., Meng Y., Wei W., Sun Q., Jia L. Impairment of learning and memory induced by perinatal exposure to BPA is associated with ERalpha-mediated alterations of synaptic plasticity and PKC/ERK/CREB signaling pathway in offspring rats. Brain Res. Bull. 2020;161:43–54. doi: 10.1016/j.brainresbull.2020.04.023. [DOI] [PubMed] [Google Scholar]
  50. Xu N., Wixey J., Chand K., Wong M., Nance E. Nano-formulated curcumin uptake and biodistribution in the fetal growth restricted newborn piglet brain. Drug Deliv. Transl. Res. 2026;16:945–959. doi: 10.1007/s13346-025-01830-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Yakubu J., Pandey A. V. Innovative delivery systems for curcumin: Exploring nanosized and conventional formulations. Pharmaceutics. 2024;16:637. doi: 10.3390/pharmaceutics16050637. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Zhao Y., Zhao B. Oxidative stress and the pathogenesis of Alzheimer's disease. Oxid. Med. Cell. Longev. 2013;2013:316523. doi: 10.1155/2013/316523. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Zhong Y., Chen J., Li L., Qin Y., Wei Y., Pan S., Jiang Y., Chen J., Xie Y. PKA-CREB-BDNF signaling pathway mediates propofol-induced long-term learning and memory impairment in hippocampus of rats. Brain Res. 2018;1691:64–74. doi: 10.1016/j.brainres.2018.04.022. [DOI] [PubMed] [Google Scholar]
  54. Zverova M. Clinical aspects of Alzheimer's disease. Clin. Biochem. 2019;72:3–6. doi: 10.1016/j.clinbiochem.2019.04.015. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

bt-34-4-866-supple.pdf (24.8MB, pdf)

Articles from Biomolecules & Therapeutics are provided here courtesy of Korean Society of Applied Pharmacology

RESOURCES