Skip to main content
NCBI home page
Biomolecules & Therapeutics logoLink to Biomolecules & Therapeutics
. 2026 Jun 5;34(4):910–921. doi: 10.4062/biomolther.2026.052

Serum Starvation Promotes the Proteolysis of OGT by Activating AMPK and the CUL1/SKP1/SKP2 E3 Ubiquitin Ligase in 3T3-L1 Cells

Hoang Hai Ngo 1, Dang Quynh Le 1, Le Ba Nam 1,2, Young-Sam Keum 1,*
PMCID: PMC13324587  PMID: 42242895

Abstract

Post-translational modifications (PTMs) play a crucial role in the regulation of protein function. Protein O-linked N-acetylglucosamine (O-GlcNAc) is a type of nutrient-sensitive PTM that occurs on serine or threonine residues of substrates, catalysed by single pair of enzymes, O-GlcNAc transferase (OGT) and O-GlcNAcase (OGA). In the present study, we have observed that serum deprivation decreased OGT levels without affecting its transcription. Instead, we found that serum deprivation activated AMP-activated protein kinase (AMPK) and induced the phosphorylation of OGT at threonine 444, resulting in the proteolysis of OGT by the CUL1/SKP1/SKP2 E3 ubiquitin ligase. Knocking down OGT significantly impaired 3T3-L1 cell differentiation in the presence of serum. Likewise, treatment with AICAR, an AMPK activator, or OSMI-1, an OGT small molecule inhibitor, attenuated serum-induced 3T3-L1 differentiation. Together, our results demonstrate that OGT is essential for 3T3 cell differentiation in which serum starvation activates AMPK to phosphorylate OGT at Thr444, triggering the proteolysis of OGT by the CUL1/SKP1/SKP2 E3 ligase.

Keywords: 3T3-L1 cells, O-GlcNAc transferase (OGT), AMP-activated protein kinase (AMPK), The CUL1/SKP1/SKP2 E3 ubiquitin ligase

INTRODUCTION

Glucose is primarily metabolized for energy production via glycolysis (Chandel, 2021; Liu et al., 2025). In mammals, it can be stored as glycogen or utilized in non-ATP-generating pathways, such as the pentose phosphate pathway and the hexosamine biosynthesis pathway (HBP) (Cairns et al., 2022; Ge et al., 2020; Yu et al., 2024). The HBP plays a pivotal role in the synthesis of uridine diphosphate N-acetylglucosamine (UDP-GlcNAc) by integrating glucose, amino acid, lipid, and nucleotide metabolism (Akella et al., 2019; Buse, 2006; Liu et al., 2024; Morales and Pratt, 2024; Sampson et al., 2025; Slawson et al., 2010). Utilizing UDP-GlcNAc as a substrate, O-GlcNAc transferase (OGT) catalyzes the transfer of the N-acetylglucosamine (GlcNAc) moiety onto serine or threonine residues and creates a unique post-translational modification (PTM) on a large number of substrates, known as O-linked N-acetylglucosamine (O-GlcNAcylation) (Gao et al., 2001; Hart et al., 2007; Hou et al., 2024; Hwang and Rhim, 2018; Janetzko and Walker, 2014; Zhang et al., 2024a). A striking feature of O-GlcNAcylation lies in its reversible regulation by a single pair of enzymes: OGT for attachment and O-GlcNAcase (OGA) for removal (Alonso et al., 2014; Janetzko and Walker, 2014; Nagel and Ball, 2014; Wu et al., 2024; Xu et al., 2025).

Aberrant O-GlcNAcylation is associated with the development and progression of numerous human diseases, such as obesity, diabetes mellitus, and cancer (Banerjee et al., 2016; Ferrer et al., 2016; Scrivener et al., 2025; Shu et al., 2026; Xia et al., 2025; Zeng and Liang, 2025; Zhou et al., 2026). Since nutrient availability primarily determines UDP-GlcNAc production and O-GlcNAcylation levels, OGT is regarded as a nutrient sensor and coordinates cellular responses to changes in nutrient availability (Liu et al., 2024; Wells and Hart, 2024). While three-dimensional structures of OGT alone or in complex with its counterpart, OGA, are available (Lazarus et al., 2011; Lu et al., 2023; Meek et al., 2021; Wu et al., 2024), how intracellular OGT levels are regulated is largely unknown. In the present study, we provide evidence that serum deprivation decreases the OGT expression at the post-translational level. Serum starvation induces AMPK to phosphorylate OGT at Thr444, triggering OGT proteolysis by the CUL1/SKP1/SKP2 E3 ubiquitin. Consistent with these findings, knocking down OGT, or treatment with AICAR or OSMI-1 significantly inhibited serum-induced 3T3-L1 cell differentiation. Our study reveals an elegant mechanism by which serum starvation impairs adipocyte differentiation: AMPK phosphorylates OGT at Thr444, which triggers OGT proteolysis by the CUL1/SKP1/SKP2 E3 ubiquitin ligase.

MATERIALS AND METHODS

Cell culture, chemicals, and antibodies

Dulbecco’s modified eagle media (DMEM) (Cat. No. CM002-050), fetal bovine serum (FBS) (Cat. No. F0900-050), phosphate-buffered saline (PBS) (Cat. No. P2101-050), and penicillin/streptomycin (Pen/Strep) (Cat. No. CA005-010) were purchased from GenDEPOT (Austin, TX, USA). 3T3-L1 cells were purchased from the Korean Cell Line Bank (Seoul, Korea). 293T cells were purchased from the American Type Culture Collection (Manassas, VA, USA). 3T3-L1 cells and 293T cells were cultured with 1x DMEM containing 10% FBS and 1% Pen/Strep at 37°C in a 5% CO2 incubator. For differentiation, 3T3-L1 cells were cultured until reaching 70–80% confluence. At day 0, the differentiation of 3T3-L1 cells was induced with DMI cocktail (1 μM dexamethasone, 500 μM 3-isobutyl-1-methylxanthine, and 5 μg/mL insulin). From day 2 to day 8, 3T3-L1 cells were maintained in DMEM supplemented with 10% FBS and 1 μg/mL insulin, in which the media were changed every 48 h. AICAR (Cat. No. 2627-69-2), OSMI-1 (Cat. No. 1681056-61-0), 3-isobutyl-a-methylxanthine (Cat. No. 28822-58-4), and Oil Red O (Cat. No. 1320-06-5) were purchased from Sigma-Aldrich (St. Louis, MO, USA). JetPEI was purchased from Polyplus transfection (New York, NY, USA). Antibody against RL2 (Cat. No. MABS157), FLAG M2-HRP (Cat. No. A8592), anti-FLAG beads, anti-HA beads, paraformaldehyde, and bovine serum albumin (BSA) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Antibodies against OGT (Cat. No. CS24083), AMPKα (Cat. No. CS2532), Phospho-AMPKα Thr172 (Cat. No. CS2531) and HA-HRP (Cat. No CS2999) were purchased from Cell Signaling Technology (Beverly, MA, USA). Antibodies against actin (Cat. No. sc-8432) was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Antibody against phospho-OGT Thr444 (Cat. No. YP1623) was purchased from Immunoway (San Jose, CA, USA).

Generation of plasmids

Human cDNAs encoding OGT, AMPKα1, AMPKα2, Ubiquitin, F-box proteins (β-TrCP, SKP2, FBXL2, FBXL9, FBXO2, FBXO9, FBXO16, FBXW2, and FBXW7), PPARγ, and mouse cDNAs encoding OGT were amplified from various cell lines. The cDNAs were amplified by PCR and subcloned into the pcDNA3 mammalian expression vector. The full-length sequence of all constructs was verified by DNA sequencing. pcDNA3-HA-OGT, pcDNA3-FLAG-OGT, pcDNA3-FLAG-AMPKα1, pcDNA3-FLAG-AMPKα2, pcDNA3-FLAG-Ubiquitin, pcDNA3-HA-F-box proteins, pcDNA3-FLAG-PPARγ plasmids were generated using the In-Fusion® HD Cloning Plus Kit (Takara Korea Biomedical Inc., Seoul, Korea).

Western blot analysis

After treatment, cells were washed three times with 1x PBS and the cell pellets were collected by centrifugation. The pellets were resuspended in 1x RIPA lysis buffer [50 mM Tris-HCl at pH 8.0, 150 mM NaCl, 1% NP-40, 0.5% deoxycholic acid, 0.1% sodium dodecyl sulfate (SDS), 1 mM Na3VO4, 1 mM DTT, and 1 mM phenylmethylsulfonyl fluoride (PMSF)] and incubated on ice for 1 h. After cell lysates were collected, the protein concentration was measured using the BCA protein assay kit (Thermo-Fisher Scientific, Waltham, MA, USA). Cell lysates were separated by SDS-PAGE and transferred to the PVDF membranes (Merck-Millipore Korea, Daejeon, Korea). The membranes were incubated in blocking buffer (5% skim milk in 1x PBS-0.1% Tween-20, and 1xPBST) for 1 h and hybridized with appropriate primary antibodies in 1x PBS overnight at 4°C. After washing three times with 1x PBST for 30 min, the membrane was hybridized with horseradish peroxidase (HRP)-conjugated secondary antibody (Thermo-Fisher Scientific, Waltham, MA, USA) for 1 h at 4°C. The membranes were washed three times with 1xPBST for 30 min and visualized using an enhanced chemiluminescence (ECL) detection system.

Real-time reverse transcription-polymerase chain reaction

Total RNA was extracted using a Hybrid-R RNA extraction kit (GeneAll, Seoul, Korea). Synthesis of cDNA from total RNA (1 μg) was conducted using AmfiRivert cDNA Synthesis Platinum master mix (GenDEPOT, Austin, TX, USA). Real-time RT-PCR was conducted using SYBR mix (ELPIS Biotech, Daejeon, Korea) on the CFX384 Real-Time System (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s instructions, and the mRNA levels of target genes were normalized to GAPDH. PCR primer sequences against individual genes are listed in Table 1.

Table 1.

Real-Time RT-PCR primers

Genes Forward Reverse
OGT TGTGTTGTTTCGGTCGAGGA GTTTTGAAGGGCTCAGGGGG
FAS ACATGGTAGCTGCCCTCAAG GCGCAGTACCGTACCGTAGAAGAC
C/EBPα GCAAAGCCAAGAAGTCGGTG AGGCGGTCATTGTCACTGGT
PPARγ CCCTGGCAAAGCATTTGTAT GAAACTGGCACCCTTGAAAA
SREBP1c TGTGGCAGTGGAGGAGGCACA CCGCTGGGCTTTGACCTGGC
GAPDH ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA
CUL1 CACTACACGCCGTCGCC TCACAGCAGCTCAGAAAGAATG
CUL2 TGTTTTACTAGGCTCCCTCGG TGCTCGCTCGACATATTCCAA
CUL3 CCAGCGTAAGAATAACAGTGGTC AGTACATCTTCTCGCACCTTATT
CUL4A GCTTCACGAAGCGGTCAAGG CTTGTAGAGCGTTGGGGAGAC
CUL4B TCATGAGCCATCAAAGAGAGGA GGCGCTCTTGATTGGAGGTT
CUL7 GCGCGTTCTGGACTACGATA TCGGGCCCATACTTCCTGTA
Open in a new tab

Generation of stable 3T3-L1 cell lines

Lentiviral-mediated gene knockdown in 3T3-L1 cells was performed using the pLKO.1-puro vector (Addgene, Cambridge, MA, USA). The pLKO.1-puro vector was double-digested with EcoRI and AgeI, and the oligonucleotides targeting the indicated genes were ligated into the vector. The sequences of oligonucleotides targeting each gene are listed in Table 2. To generate stable 3T3-L1 cell lines overexpressing HA-OGT and HA-OGT-T444A, pLenti-puro-HA-OGT and pLenti-puro-HA-OGT-T444A constructs were generated by overlapping PCR. The pLenti-puro lentiviral expression vector and lentiviral helper plasmids (pMD2.G and psPAX.2) were acquired from Addgene (Cambridge, MA, USA).

Table 2.

Oligonucleotide sequences used for ligation into the pLKO.1 vector targeting Cullins, AMPK, SKP2, and OGT

Genes Primer Sequence (5’ → 3’)
shRNA design strategy Forward
Reverse		 CCGG-21bp sense-CTCGAG-21bp antisense-TTTTTG
Age I Loop Terminal
AATTCAAAAA-21bp sense-CTCGAG-21bp antisense
EcoRI Terminal Loop
shScramble Forward
Reverse		 CCGGATGCTGGAAATGCTAGAATACCTCGAGGTATTCTAGCATTTCCAGCATTTTTTG AATTCAAAAAATGCTGGAAATGCTAGAATACCTCGAGGTATTCTAGCATTTCCAGCAT
shCUL1 Forward
Reverse		 CCGGGCCGCATGTATAATCTTGTATCTCGAGATACAAGATTATACATGCGGCTTTTTG AATTCAAAAAGCCGCATGTATAATCTTGTATCTCGAGATACAAGATTATACATGCGGC
shCUL2 Forward
Reverse		 CCGGGCCGACTATATGGACTGCTTACTCGAGTAAGCAGTCCATATAGTCGGCTTTTTG
AATTCAAAAAGCCGACTATATGGACTGCTTACTCGAGTAAGCAGTCCATATAGTCGGC
shCUL3 Forward
Reverse		 CCGGCGAGATCAAGTTGTACGGTATCTCGAGATACCGTACAACTTGATCTCGTTTTTG
AATTCAAAAACGAGATCAAGTTGTACGGTATCTCGAGATACCGTACAACTTGATCTCG
shCUL4A Forward
Reverse		 CCGGCGAGACAAAGACAGTCCAAATCTCGAGATTTGGACTGTCTTTGTCTCGTTTTTG
AATTCAAAAACGAGACAAAGACAGTCCAAATCTCGAGATTTGGACTGTCTTTGTCTCG
shCUL4B Forward
Reverse		 CCGGGCTGTCTGATTTGCAAATTTACTCGAGTAAATTTGCAAATCAGACAGCTTTTTG
AATTCAAAAAGCTGTCTGATTTGCAAATTTACTCGAGTAAATTTGCAAATCAGACAGC
shCUL7 Forward
Reverse		 CCGGGCGCTATTATAAAGGAACAATCTCGAGATTGTTCCTTTATAATAGCGCTTTTTG
AATTCAAAAAGCGCTATTATAAAGGAACAATCTCGAGATTGTTCCTTTATAATAGCGC
shAMPK Forward
Reverse		 CCGGGCCCAGATGAACGCTAAGATACTCGAGTATCTTAGCGTTCATCTGGGCTTTTTG
AATTCAAAAAGCCCAGATGAACGCTAAGATACTCGAGTATCTTAGCGTTCATCTGGGC
shSKP2 Forward
Reverse		 CCGGGCCTCGACTTAAGTGACAGTACTCGAGTACTGTCACTTAAGTCGAGGCTTTTTG
AATTCAAAAAGCCTCGACTTAAGTGACAGTACTCGAGTACTGTCACTTAAGTCGAGGC
shOGT Forward
Reverse		 CCGGGCAGCTTATCTTCGTGCCTTACTCGAGTAAGGCACGAAGATAAGCTGCTTTTTG
AATTCAAAAAGCAGCTTATCTTCGTGCCTTACTCGAGTAAGGCACGAAGATAAGCTGC
Open in a new tab

For lentivirus production, 3 µg of pLKO.1 knockdown constructs or pLenti-expression vectors were cotransfected with lentiviral packaging plasmids (3 µg pMD2.G and 9 µg psPAX.2) into 293T cells. Viral supernatants were collected 72 h after transfection and used to infect 3T3-L1 cells in the presence of 5 µg/mL polybrene (Merck-Millipore Korea, Daejeon, Korea). Transduced cells were selected with puromycin (2 µg/mL) for 48 h and maintained in the medium containing puromycin (200 ng/mL) for at least one week.

Oil red O staining

Fully differentiated 3T3-L1 cells were washed twice with PBS and fixed in 4% paraformaldehyde for 1 h. Cells were stained with 3 mg/mL of Oil Red O (Sigma Chemical, St. Louis, MO, USA) in 60% isopropanol at room temperature for 10 min and washed extensively with distilled water. Pictures were taken using a microscope (Nikon Eclipse TS100, Tokyo, Japan). For quantification, Oil Red O-stained samples were eluted with 100% isopropanol, and the absorbance was measured at 510 nm.

Statistics

Data were analysed using one-way analysis of variance (ANOVA). Asterisks indicate statistical significances of *p<0.05, **p<0.01, and ***p<0.001.

RESULTS

Serum starvation decreases OGT levels by promoting poly-ubiquitination in 3T3-L1 cells

The mouse embryonic fibroblast 3T3-L1 cells are conventionally used in metabolism and obesity research due to their ability to be chemically induced to differentiate into adipocytes (Flori et al., 2025; Green and Kehinde, 1974; Roberts et al., 2009). In the present study, we investigated whether serum levels are associated with OGT expression in 3T3-L1 cells. We observed that serum deprivation decreased OGT protein levels at 12 h (Fig. 1A) without affecting the OGT mRNA levels up to 24 h (Fig. 1B). The OGA level was unaffected during serum deprivation (Fig. 1A) Treatment with the proteasomal inhibitor, MG-132 also blocked the serum deprivation-induced decrease of OGT levels (Fig. 1C), suggesting that the reduction of OGT by serum deprivation is post-translationally regulated. Consistent with this finding, global O-GlcNAcylation levels significantly decreased after serum starvation (Fig. 1A, 1C).

Fig. 1.

Fig. 1

Open in a new tab

Serum deprivation decreases the OGT level by promoting poly-ubiquitination. (A) Serum starvation suppressed OGT expression without affecting OGA levels in 3T3-L1 cells. 3T3-L1 cells were seeded in 100 mm culture plates (2×106 cells/plate) and serum-starved for 24 h. Western blot analysis was performed for OGT, OGA, O-GlcNAc (RL2), and actin. (B) Serum starvation does not affect the levels of OGT mRNA in 3T3-L1 cells. 3T3-L1 cells were seeded in 6-well plates (2×105 cells/well) and serum-starved for various times. Real-time RT-PCR was performed to measure the level of OGT mRNA (n=4). (C) MG132 rescues a decrease in OGT level under serum starvation. 3T3-L1 cells were seeded in 100 mm culture plates (2×106 cells/plate) and serum-starved alone or in combination with MG132 (10 µM) for various times. Western blot was performed using antibodies against OGT, RL2, and actin. (D) Serum starvation induces the poly-ubiquitination of OGT. 293T cells were seeded in 100 mm culture plates (2×106 cells/plate) and cotransfected with 1 μg of pcDNA3-HA-OGT and pcDNA3-FLAG-ubiquitin for 24 h. Cells were serum-starved for various times, and immunoprecipitation (IP) was conducted with HA-agarose beads, followed by Western blot analysis using HA and FLAG antibodies. (E) Serum starvation induces OGT poly-ubiquitination. 3T3-L1 cells stably expressing HA-OGT were seeded in 100 mm culture plates (2×106 cells/plate) and serum-starved for 24 h. Cell lysates were incubated with IgG (1 μg) or HA antibody (1 μg) overnight at 4°C. After IP with protein A/G beads, samples were washed with NP-40 lysis buffer, and Western blot analysis was performed using HA and Ubiquitin (FK2) antibodies.

To examine whether this decrease was mediated by poly-ubiquitination, we cotransfected HA-OGT and FLAG-ubiquitin plasmids in 3T3 cells. Following immunoprecipitation (IP) of HA-OGT using HA-agarose beads, Western blot analysis was conducted for FLAG-ubiquitin. Our results revealed that poly-ubiquitination of HA-OGT occurred after 12 h of serum starvation (Fig. 1D). As our endogenous antibody against OGT was not appropriate for IP (data not shown), we generated 3T3-L1 stable cells overexpressing HA-OGT (3T3-L1-HA-OGT cells) and used HA epitope for IP. After 3T3-L1-HA-OGT cells were subjected to serum starvation for 24 h, we conducted IP with HA-agarose beads followed by Western blot analysis for ubiquitin. Our results show that serum starvation promotes the poly-ubiquitination of HA-OGT in 3T3-L1 cells (Fig. 1E). Together, these results demonstrate that serum starvation decreases OGT levels by promoting its poly-ubiquitination.

Serum starvation activates AMPK to phosphorylate OGT at threonine 444, triggering OGT proteolysis by the CUL1/SKP2/SKP1 E3 ubiquitin ligase

AMPK phosphorylates OGT at threonine 444 residue (Thr444) (Bullen et al., 2014; Zhang et al., 2024b). While phosphorylation of OGT at this site does not affect OGT enzymatic activity, it modulates OGT cellular localization and substrate specificity (Gelinas et al., 2018). We observed that serum starvation activated AMPK with a concomitant reduction in OGT levels (Fig. 2A). To examine whether OGT phosphorylation at Thr444 is associated with OGT stability, we generated 3T3-L1 cells overexpressing HA-OGT (3T3-L1-HA-OGT cells) or HA-OGT-T444A (3T3-L1-HA-OGT-T444A cells) and exposed them to serum deprivation for 24 h. Our results show that serum deprivation significantly decreased the level of HA-OGT, whereas HA-OGT-T444A levels remained stable (Fig. 2B), suggesting that OGT phosphorylation at Thr444 is required for the serum-induced decrease in OGT stability. Supporting this observation, serum starvation decreased total OGT levels with an increase in OGT phosphorylation at Thr444 in 3T3-L1 cells, whereas silencing AMPK abrogated serum starvation-induced OGT degradation (Fig. 2C): a direct interaction between the AMPKα2 and OGT was also observed (Fig. 2D). In addition, treatment with the AMPK activator, AICAR decreased OGT and global O-GlcNAcylation levels in 3T3-L1 cells (Supplementary Fig. 1).

Fig. 2.

Fig. 2

Open in a new tab

Serum deprivation promotes AMPK phosphorylation-dependent decrease in OGT level. (A) Serum starvation decreased OGT expression and induced AMPK phosphorylation at Thr172 in 3T3-L1 cells. 3T3-L1 cells (2×106 cells) were seeded in 100 mm culture plates (2×106 cells/plate) and serum-starved for various times. Western blot analysis was performed against OGT, AMPK, p-AMPK (Thr172), and actin. (B) Thr444 residue is necessary for serum deprivation-induced decrease in OGT level. Stable 3T3-L1-HA-OGT and 3T3-L1-HA-OGT-T444A cells were seeded in 100 mm culture plates (2×106 cells/plate) and serum-starved for 24 h. Western blot analysis was conducted using HA-HRP and actin antibodies. (C) Silencing AMPK prevents serum starvation–induced OGT phosphorylation at Thr444 in 3T3-L1 cells. After transduction using shScramble and shAMPK virus, 3T3-L1 cells were serum starved in 100 mm culture plates (2×106 cells/plate) for various times. Western blot was performed using antibodies against OGT, p-OGT (Thr444), AMPK, and actin. (D) AMPKα2 directly binds to OGT. pcDNA3-HA-OGT plasmid was transfected alone or together with pcDNA3-FLAG-AMPKα1, pcDNA3-FLAG-AMPKα2 in 293T cells. After 24 h, cells were serum starved by 12 h and the interaction of OGT with AMPKα1 and AMPKα2 was examined by immunoprecipitation followed by Western blot analysis. β-Actin was used as a loading control for the input.

We have demonstrated that serum deprivation decreases OGT levels by promoting its poly-ubiquitination (Fig. 1). To identify the E3 ubiquitin ligase responsible for OGT degradation, we established stable 3T3-L1 cell lines expressing short hairpin RNAs (shRNAs) that target individual Cullins (CUL1, CUL2, CUL3, CUL4A, CUL4B, and CUL7) (Supplementary Fig. 2) and found that silencing CUL1 prevented serum starvation-induced OGT reduction (Fig. 3A). CUL1 serves as the core scaffold of the CUL1/SKP1/F-box protein (SCF) complex (Fig. 3B), where F-box family proteins act as the substrate-recognition components (Cardozo and Pagano, 2004; Dai et al., 2025). In order to identify the putative F-box protein responsible for OGT stability, we subcloned several F-box proteins in mammalian expression vector and performed IP of HA-tagged F-box proteins after cotransfection with FLAG-OGT. Our results show that HA-SKP2 selectively binds to FLAG-OGT (Fig. 3C). As phosphorylation of OGT by AMPK is critical for OGT degradation, silencing AMPK decreased the interaction between OGT and HA-SKP2 during serum starvation (Fig. 3D). Together, these findings suggest that AMPK-dependent phosphorylation of OGT at Thr444 under serum starvation facilitates OGT proteolysis by the CUL1/SKP2/SKP1 E3 ubiquitin ligase.

Fig. 3.

Fig. 3

Open in a new tab

Serum deprivation promotes the proteolysis of OGT by the CUL1/SKP1/SKP2 E3 ubiquitin ligase. (A) CUL1 is necessary for the reduction of OGT by serum deprivation. After 3T3-L1 cells stably silenced with CUL1, CUL2, CUL3, CUL4A, CUL4B, or CUL7 were generated, cells were seeded in 100 mm culture plates (2×10⁶ cells/ plate) and subjected to serum starvation for 24 h. OGT expression was analyzed by Western blot analysis. (B) Schematic diagram of the CUL1/SKP1/F-box protein (SCF) complex. (C) SKP2 directly binds to OGT. pcDNA3-FLAG-OGT was co-transfected with various pcDNA3-HA-F-box constructs in 293T cells (2×106 cells/ 100 mm plate) for 24 h. After serum starvation for 12 h, cell lysates were immunoprecipitated using anti-HA beads and Western blotting was conducted with FLAG and HA antibodies. (D) Silencing AMPK abolishes the interaction between OGT and SKP2. After transduction using shScramble and shAMPK virus, 3T3-L1 cells were cultured in 100 mm culture plates (2×106 cells/plate), transfected with pcDNA3-HA-SKP2 plasmid, and subjected to serum starvation for 12 h. Cell lysates were immunoprecipitated with IgG (1 μg) or HA antibody (1 μg) and Western blot analysis was performed using HA and OGT antibodies.

AMPK and OGT are necessary for serum-induced 3T3-L1 differentiation

It is known that the intracellular O-GlcNAcylation levels increase during the differentiation of 3T3-L1 cells (Hsieh et al., 2012; Ishihara et al., 2010; Yan et al., 2024). Given that OGT is the sole enzyme responsible for catalyzing the O-GlcNAc modification (Levine and Walker, 2016; Xu et al., 2025), we hypothesized that AMPK-dependent degradation of OGT by the CUL1/SKP2/SKP1 E3 ubiquitin ligase affect 3T3-L1 differentiation. To test this hypothesis, we established a 3T3-L1 differentiation model (Fig. 4A) and monitored cell differentiation using Oil Red O staining. Our results show that silencing OGT, but not AMPK and SKP2, significantly inhibits serum-induced 3T3-L1 differentiation (Fig. 4B, 4C).

Fig. 4.

Fig. 4

Open in a new tab

Silencing OGT, but not AMPK and SKP2, impairs serum-induced 3T3-L1 cell differentiation. (A) Schematic diagram of the 3T3-L1 differentiation protocol. (B) Silencing OGT, but not AMPK and SKP2, inhibits serum-induced 3T3-L1 cell differentiation. 3T3-L1 cells silenced with AMPK, SKP2, and OGT were established by lentiviral transduction. After viral infection, 3T3-L1 cells were seeded in 12-well culture plates (1×105 cells/well) and differentiation was induced according to the protocol. The level of lipid accumulation was visualized by Oil Red O staining (Scale Bar, 100 μm). (C) Quantification of 3T3-L1 cell differentiation after silencing AMPK, SKP2, and OGT (n=3).

To further confirm the role of AMPK and OGT during serum-induced 3T3-L1 differentiation, we examined the effects of the AMPK activator AICAR and OGT inhibitor OSMI-1 (Fig. 5A). We found that treatment with AICAR or OSMI-1 significantly attenuated serum-induced 3T3-L1 differentiation (Fig. 5B, 5C). The transcription of key adipogenic transcription factor PPARγ and its downstream targets, such as FAS, C/EBPα, and SREBP1c (Fig. 5D) was also attenuated. Collectively, these results demonstrate that AMPK and OGT are essential for serum-induced 3T3-L1 differentiation.

Fig. 5.

Fig. 5

Open in a new tab

Pharmacological AMPK activation or OGT inhibition suppresses 3T3-L1 differentiation. (A) Chemical structures of AICAR (AMPK activator) and OSMI-1 (OGT inhibitor). (B) AICAR or OSMI-1 impairs 3T3-L1 differentiation. 3T3-L1 cells were seeded in 12-well culture plates (1×105 cells/well) and differentiated. Cells were exposed to AICAR (100 μM) or OGT inhibitor (5 μM) for 8 days and the level of lipid accumulation was assessed by Oil Red O staining (Scale Bar, 100 μm). (C) Effects of AICAR and OSMI-1 on 3T3-L1 differentiation as measured by relative lipid accumulation (n=3). (D) AICAR or OSMI-1 attenuates the mRNA levels of PPARγ and its target genes. Real-time RT-PCR was performed against PPARγ, FAS, C/EBPα, and SREBP1c mRNAs (n=4).

DISCUSSION

There are many ways crosstalk occurs between phosphorylation and ubiquitination. One notable mechanism is that phosphorylation generates a recognition signal on Ser/Thr residues in the substrates (termed as a phosphodegron), which provides a platform for binding to the E3 ubiquitin ligase (Low et al., 2014; Morales and Pratt, 2024; Skaar et al., 2013). Two subfamilies of the SCF (Cullin/SKP1/F-box protein) E3 ligase family-WD40 repeat F-box proteins and leucine-rich repeat (LRR) F-box proteins-are known to recognize these phosphodegrons (Jin et al., 2004; Tekcham et al., 2020; Wang et al., 2014; Zeng et al., 2025). While WD40 repeat F-box proteins recognize two closely spaced phosphate residues contributed by a single or different protein kinases, LRR F-box proteins recognize a phosphodegron contributed by a kinase (Hunter, 2007). As SKP2 is a LRR F-box protein, a single phosphodegron created at Thr444 by AMPK appears sufficient to recruit the CUL1/SKP1/SKP2 E3 ubiquitin ligase and target OGT for proteolysis, thereby impairing 3T3-L1 differentiation (Fig. 6).

Fig. 6.

Fig. 6

Open in a new tab

A proposed model how serum starvation induces O-GlcNAc transferase (OGT) degradation and impairs 3T3-L1 differentiation. During serum starvation, AMP-activated protein kinase (AMPK) is activated and phosphorylates OGT at Thr444, facilitating the proteolysis of OGT by the Cullin 1/S-phase kinase-associated protein 1/S-phase kinase-associated protein 2 (CUL1/SKP1/SKP2) E3 ligase. OGT degradation impairs 3T3-L1 cell differentiation.

Protein O-GlcNAcylation, which also occurs on serine or threonine residues, influences a plethora of cellular functions as a counterpart to phosphorylation (Comer and Hart, 2000; Haltiwanger et al., 1997; Li et al., 2025; Shu et al., 2026; Wang et al., 2025; Zhou et al., 2025). Beyond catalyzing O-GlcNAcylation, OGT exhibits other functions, such as the proteolytic maturation of HCF-1 (Lazarus et al., 2013; Potter et al., 2024) and the inhibition of the 26S proteasomes (Yang and Qian, 2017; Zhang et al., 2003). While many reports show that O-GlcNAcylation by OGT is necessary for adipocyte differentiation, how it contributes to this process remains unclear. We propose that OGT directly binds to PPARγ and increases its O-GlyNAcylation, thereby promoting 3T3-L1 differentiation (Supplementary Fig. 3). This hypothesis is well supported by the observation that serum deprivation inhibited transcription of PPARγ and its target genes, such as FAS, C/EBP, and SREBP1 in 3T3-L1 cells (Fig. 5D). Nonetheless, the possibility that O-GlcNAcylation of proteins other than PPARγ by OGT contributed to 3T3-L1 cell differentiation should not excluded and further experiments are necessary to examine this hypothesis.

To date, numerous OGT small molecule inhibitors have been developed (Cheng et al., 2026; Zhang et al., 2022). Many of them are structural analogues of OGT substrate, UDP-GlcNAc while others are structurally unrelated compounds identified through high-throughput screening (Ortiz-Meoz et al., 2015; Vocadlo, 2012). Given the observation that the CUL1/SKP1/SKP2 E3 ubiquitin ligase promotes AMPK-dependent OGT proteolysis, we propose that targeted protein degradation (TPD) strategies, such as proteolysis-targeting chimera (PROTAC) or molecular glue (Bekes et al., 2022; Eladl, 2025; Pan et al., 2025), could be harnessed to develop novel compounds with new structural modalities for targeting metabolic diseases, caused by aberrant O-GlcNAcylation.

bt-34-4-910-supple.pdf (936.9KB, pdf)

ACKNOWLEDGMENTS

This study was supported by the Dongguk University Research Fund of 2026.

REFERENCES

  1. Akella N. M., Ciraku L., Reginato M. J. Fueling the fire: Emerging role of the hexosamine biosynthetic pathway in cancer. BMC Biol. 2019;17:52. doi: 10.1186/s12915-019-0671-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Alonso J., Schimpl M., van Aalten D. M. O-GlcNAcase: Promiscuous hexosaminidase or key regulator of O-GlcNAc signaling? J. Biol. Chem. 2014;289:34433–34439. doi: 10.1074/jbc.R114.609198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Banerjee P. S., Lagerlof O., Hart G. W. Roles of O-GlcNAc in chronic diseases of aging. Mol. Aspects. Med. 2016;51:1–15. doi: 10.1016/j.mam.2016.05.005. [DOI] [PubMed] [Google Scholar]
  4. Bekes M., Langley D. R., Crews C. M. PROTAC targeted protein degraders: The past is prologue. Nat. Rev. Drug. Discov. 2022;21:181–200. doi: 10.1038/s41573-021-00371-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bullen J. W., Balsbaugh J. L., Chanda D., Shabanowitz J., Hunt D. F., Neumann D., Hart G. W. Cross-talk between two essential nutrient-sensitive enzymes: O-GlcNAc transferase (OGT) and AMP-activated protein kinase (AMPK) J. Biol. Chem. 2014;289:10592–10606. doi: 10.1074/jbc.M113.523068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Buse M. G. Hexosamines, insulin resistance, and the complications of diabetes: Current status. Am. J. Physiol. Endocrinol. Metab. 2006;290:E1–E8. doi: 10.1152/ajpendo.00329.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cairns M., Joseph D., Essop M. F. The dual role of the hexosamine biosynthetic pathway in cardiac physiology and pathophysiology. Front. Endocrinol. (Lausanne) 2022;13:984342. doi: 10.3389/fendo.2022.984342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cardozo T., Pagano M. The SCF ubiquitin ligase: Insights into a molecular machine. Nat. Rev. Mol. Cell Biol. 2004;5:739–751. doi: 10.1038/nrm1471. [DOI] [PubMed] [Google Scholar]
  9. Chandel N. S. Glycolysis. Cold Spring Harb. Perspect. Biol. 2021;13:a040535. doi: 10.1101/cshperspect.a040535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cheng S. S., Mody A. C., Vetere A., Govindan A., Lee Y., Khost D. E., Narayan R., Sackton T. B., Conrad N. K., Wagner B. K., Woo C. M. Small molecule splicing modulators that disrupt O-GlcNAc homeostasis. Nat. Commun. 2026;17:1548. doi: 10.1038/s41467-025-68271-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Comer F. I., Hart G. W. O-Glycosylation of nuclear and cytosolic proteins. Dynamic interplay between O-GlcNAc and O-phosphate. J. Biol. Chem. 2000;275:29179–29182. doi: 10.1074/jbc.R000010200. [DOI] [PubMed] [Google Scholar]
  12. Cui X., Zhu Y., Zeng L., Zhang M., Uddin A., Gillespie T. W., McCullough L. E., Zhao S., Torres M. A., Wan Y. Pharmacological dissection identifies retatrutide overcomes the therapeutic barrier of obese TNBC treatments through suppressing the interplay between glycosylation and ubiquitylation of YAP. Adv. Sci. (Weinh.) 2025;12:e2407494. doi: 10.1002/advs.202407494. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Dai M., Chen S., Wang Y., Fan J., Pan X., Sang C., Liu Y., Hu M., Ma L., Wang S. F-box proteins at the crossroads of ubiquitination and tumor immunity: Regulatory networks and immunotherapy strategies [review] Front. Immunol. 2025;16:2025. doi: 10.3389/fimmu.2025.1596344. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Eladl O. Molecular glues and PROTACs in targeted protein degradation: Mechanisms, advances, and therapeutic potential. Biochem. Pharmacol. 2025;242:117297. doi: 10.1016/j.bcp.2025.117297. [DOI] [PubMed] [Google Scholar]
  15. Ferrer C. M., Sodi V. L., Reginato M. J. O-GlcNAcylation in cancer biology: Linking metabolism and signaling. J. Mol. Biol. 2016;428:3282–3294. doi: 10.1016/j.jmb.2016.05.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Flori L., Galgani G., Bray G., Ippolito C., Segnani C., Pellegrini C., Citi V., Bernardini N., Martelli A., Calderone V. Development of an adipocyte differentiation protocol using 3T3-L1 cells for the investigation of the browning process: Identification of the PPAR-gamma agonist rosiglitazone as a browning reference drug. Front. Pharmacol. 2025;16:1546456. doi: 10.3389/fphar.2025.1546456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Gao Y., Wells L., Comer F. I., Parker G. J., Hart G. W. Dynamic O-glycosylation of nuclear and cytosolic proteins: Cloning and characterization of a neutral, cytosolic beta-N-acetylglucosaminidase from human brain. J. Biol. Chem. 2001;276:9838–9845. doi: 10.1074/jbc.M010420200. [DOI] [PubMed] [Google Scholar]
  18. Ge T., Yang J., Zhou S., Wang Y., Li Y., Tong X. The role of the pentose phosphate pathway in diabetes and cancer. Front. Endocrinol. (Lausanne) 2020;11:365. doi: 10.3389/fendo.2020.00365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Gelinas R., Dontaine J., Horman S., Beauloye C., Bultot L., Bertrand L. AMP-activated protein kinase and O-GlcNAcylation, two partners tightly connected to regulate key cellular processes. Front. Endocrinol. (Lausanne) 2018;9:519. doi: 10.3389/fendo.2018.00519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Green H., Kehinde O. Sublines of mouse 3T3 cells that accumulate lipid. Cell. 1974;1:113–116. doi: 10.1016/0092-8674(74)90126-3. [DOI] [Google Scholar]
  21. Haltiwanger R. S., Busby S., Grove K., Li S., Mason D., Medina L., Moloney D., Philipsberg G., Scartozzi R. O-glycosylation of nuclear and cytoplasmic proteins: Regulation analogous to phosphorylation? Biochem. Biophys. Res. Commun. 1997;231:237–242. doi: 10.1006/bbrc.1997.6110. [DOI] [PubMed] [Google Scholar]
  22. Hart G. W., Housley M. P., Slawson C. Cycling of O-linked beta-N-acetylglucosamine on nucleocytoplasmic proteins. Nature. 2007;446:1017–1022. doi: 10.1038/nature05815. [DOI] [PubMed] [Google Scholar]
  23. Hou C., Deng J., Wu C., Zhang J., Byers S., Moremen K. W., Pei H., Ma J. Ultradeep O-GlcNAc proteomics reveals widespread O-GlcNAcylation on tyrosine residues of proteins. Proc. Natl. Acad. Sci. U. S. A. 2024;121:e2409501121. doi: 10.1073/pnas.2409501121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Hsieh T. J., Lin T., Hsieh P. C., Liao M. C., Shin S. J. Suppression of Glutamine:fructose-6-phosphate amidotransferase-1 inhibits adipogenesis in 3T3-L1 adipocytes. J. Cell. Physiol. 2012;227:108–115. doi: 10.1002/jcp.22707. [DOI] [PubMed] [Google Scholar]
  25. Hunter T. The age of crosstalk: Phosphorylation, ubiquitination, and beyond. Mol. Cell. 2007;28:730–738. doi: 10.1016/j.molcel.2007.11.019. [DOI] [PubMed] [Google Scholar]
  26. Hwang H., Rhim H. Functional significance of O-GlcNAc modification in regulating neuronal properties. Pharmacol. Res. 2018;129:295–307. doi: 10.1016/j.phrs.2017.12.006. [DOI] [PubMed] [Google Scholar]
  27. Ishihara K., Takahashi I., Tsuchiya Y., Hasegawa M., Kamemura K. Characteristic increase in nucleocytoplasmic protein glycosylation by O-GlcNAc in 3T3-L1 adipocyte differentiation. Biochem. Biophys. Res. Commun. 2010;398:489–494. doi: 10.1016/j.bbrc.2010.06.105. [DOI] [PubMed] [Google Scholar]
  28. Janetzko J., Walker S. The making of a sweet modification: Structure and function of O-GlcNAc transferase. J. Biol. Chem. 2014;289:34424–34432. doi: 10.1074/jbc.R114.604405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Jin J., Cardozo T., Lovering R. C., Elledge S. J., Pagano M., Harper J. W. Systematic analysis and nomenclature of mammalian F-box proteins. Genes Dev. 2004;18:2573–2580. doi: 10.1101/gad.1255304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Lazarus M. B., Nam Y., Jiang J., Sliz P., Walker S. Structure of human O-GlcNAc transferase and its complex with a peptide substrate. Nature. 2011;469:564–567. doi: 10.1038/nature09638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Lazarus M. B., Jiang J., Kapuria V., Bhuiyan T., Janetzko J., Zandberg W. F., Vocadlo D. J., Herr W., Walker S. HCF-1 is cleaved in the active site of O-GlcNAc transferase. Science. 2013;342:1235–1239. doi: 10.1126/science.1243990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Levine Z. G., Walker S. The biochemistry of O-GlcNAc transferase: Which functions make it essential in mammalian cells? Annu. Rev. Biochem. 2016;85:631–657. doi: 10.1146/annurev-biochem-060713-035344. [DOI] [PubMed] [Google Scholar]
  33. Li Y., Song Q., Guo R., Qian Y., Jiang Y., Song Z. Glucose metabolism through the hexosamine biosynthetic pathway drives hepatic de novo lipogenesis via promoting N-linked protein glycosylation. Am. J. Physiol. Gastrointest. Liver Physiol. 2025;328:G746–G759. doi: 10.1152/ajpgi.00056.2025. [DOI] [PubMed] [Google Scholar]
  34. Liu H., Wang S., Wang J., Guo X., Song Y., Fu K., Gao Z., Liu D., He W., Yang L.-L. Energy metabolism in health and diseases. Signal Transduct. Target. Ther. 2025;10:69. doi: 10.1038/s41392-025-02141-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Liu X., Cai Y. D., Chiu J. C. Regulation of protein O-GlcNAcylation by circadian, metabolic, and cellular signals. J. Biol. Chem. 2024;300:105616. doi: 10.1016/j.jbc.2023.105616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Low T. Y., Peng M., Magliozzi R., Mohammed S., Guardavaccaro D., Heck A. J. A systems-wide screen identifies substrates of the SCFbetaTrCP ubiquitin ligase. Sci. Signal. 2014;7:rs8. doi: 10.1126/scisignal.2005882. [DOI] [PubMed] [Google Scholar]
  37. Lu P., Liu Y., He M., Cao T., Yang M., Qi S., Yu H., Gao H. Cryo-EM structure of human O-GlcNAcylation enzyme pair OGT-OGA complex. Nat. Commun. 2023;14:6952. doi: 10.1038/s41467-023-42427-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Meek R. W., Blaza J. N., Busmann J. A., Alteen M. G., Vocadlo D. J., Davies G. J. Cryo-EM structure provides insights into the dimer arrangement of the O-linked beta-N-acetylglucosamine transferase OGT. Nat. Commun. 2021;12:6508. doi: 10.1038/s41467-021-26796-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Morales M. M., Pratt M. R. The post-translational modification O-GlcNAc is a sensor and regulator of metabolism. Open Biol. 2024;14:240209. doi: 10.1098/rsob.240209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Nagel A. K., Ball L. E. O-GlcNAc transferase and O-GlcNAcase: Achieving target substrate specificity. Amino Acids. 2014;46:2305–2316. doi: 10.1007/s00726-014-1827-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Ortiz-Meoz R. F., Jiang J., Lazarus M. B., Orman M., Janetzko J., Fan C., Duveau D. Y., Tan Z. W., Thomas C. J., Walker S. A small molecule that inhibits OGT activity in cells. ACS Chem. Biol. 2015;10:1392–1397. doi: 10.1021/acschembio.5b00004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Pan Y., Wang Y., Gou S. Proteolysis targeting chimera, molecular glue degrader and hydrophobic tag tethering degrader for targeted protein degradation: Mechanisms, strategies and application. Bioorg. Chem. 2025;161:108491. doi: 10.1016/j.bioorg.2025.108491. [DOI] [PubMed] [Google Scholar]
  43. Potter S. C., Gibbs B. E., Hammel F. A., Joiner C. M., Paulo J. A., Janetzko J., Levine Z. G., Fei G. Q., Haggarty S. J., Walker S. Dissecting OGT's TPR domain to identify determinants of cellular function. Proc. Natl. Acad. Sci. U. S. A. 2024;121:e2401729121. doi: 10.1073/pnas.2401729121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Roberts L. D., Virtue S., Vidal-Puig A., Nicholls A. W., Griffin J. L. Metabolic phenotyping of a model of adipocyte differentiation. Physiol. Genomics. 2009;39:109–119. doi: 10.1152/physiolgenomics.90365.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Sampson C., Li P., Wang Y., Liu J., Lv J., Xia T., Piao H. L., Ma Y. Exploring the metabolic signaling network of GFPT in cancer. Cell Death Discov. 2025;11:388. doi: 10.1038/s41420-025-02687-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Scrivener A. L., Westwood M., Ruane P. T., Aplin J. D. Protein O-GlcNAcylation in reproductive biology and the impact of metabolic disease. Hum Reprod Update. 2025;31:512–531. doi: 10.1093/humupd/dmaf013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Shu T., Han X., Zhu Y. O-Glycosylation as an energy sensor: Related molecular mechanisms, disease associations, and therapeutic opportunities in type 2 diabetes. Genes Dis. 2026 doi: 10.1016/j.gendis.2026.102165. doi: 10.1016/j.gendis.2026.102165 [In Press] [DOI] [Google Scholar]
  48. Skaar J. R., Pagan J. K., Pagano M. Mechanisms and function of substrate recruitment by F-box proteins. Nat. Rev. Mol. Cell Biol. 2013;14:369–381. doi: 10.1038/nrm3582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Slawson C., Copeland R. J., Hart G. W. O-GlcNAc signaling: A metabolic link between diabetes and cancer? Trends Biochem. Sci. 2010;35:547–555. doi: 10.1016/j.tibs.2010.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Tekcham D. S., Chen D., Liu Y., Ling T., Zhang Y., Chen H., Wang W., Otkur W., Qi H., Xia T., Liu X., Piao H. L., Liu H. F-box proteins and cancer: an update from functional and regulatory mechanism to therapeutic clinical prospects. Theranostics. 2020;10:4150–4167. doi: 10.7150/thno.42735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Vocadlo D. J. O-GlcNAc processing enzymes: catalytic mechanisms, substrate specificity, and enzyme regulation. Curr. Opin. Chem. Biol. 2012;16:488–497. doi: 10.1016/j.cbpa.2012.10.021. [DOI] [PubMed] [Google Scholar]
  52. Wang M., Qiao L., Jin L., Chen Y., Wen X., Wang H. OGT-regulated O-GlcNAcylation promotes the malignancy of colorectal cancer by activating STAT2 to induce macrophage M2: OGT protein macromolecule action. Int. J. Biol. Macromol. 2025;311:144057. doi: 10.1016/j.ijbiomac.2025.144057. [DOI] [PubMed] [Google Scholar]
  53. Wang Z., Liu P., Inuzuka H., Wei W. Roles of F-box proteins in cancer. Nat. Rev. Cancer. 2014;14:233–247. doi: 10.1038/nrc3700. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Wells L., Hart G. W. O-GlcNAcylation: A major nutrient/stress sensor that regulates cellular physiology. J. Biol. Chem. 2024;300:107635. doi: 10.1016/j.jbc.2024.107635. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Wu C., Li J., Lu L., Li M., Yuan Y., Li J. OGT and OGA: Sweet guardians of the genome. J. Biol. Chem. 2024;300:107141. doi: 10.1016/j.jbc.2024.107141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Xia L., Mei J., Huang M., Bao D., Wang Z., Chen Y. O-GlcNAcylation in ovarian tumorigenesis and its therapeutic implications. Transl. Oncol. 2025;51:102220. doi: 10.1016/j.tranon.2024.102220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Xu N., Zhao Y., Chi W., Yuan Y., Li J. Understanding O-GlcNAc transferase (OGT): Every amino acid matters. J. Biol. Chem. 2025;301:110760. doi: 10.1016/j.jbc.2025.110760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Yan X., Zheng J., Ren W., Li S., Yang S., Zhi K., Gao L. O-GlcNAcylation: roles and potential therapeutic target for bone pathophysiology. Cell Commun. Signal. 2024;22:279. doi: 10.1186/s12964-024-01659-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Yang X. Y., Qian K. V. Protein O-GlcNAcylation: Emerging mechanisms and functions. Nat. Rev. Mol. Cell Biol. 2017;18:452–465. doi: 10.1038/nrm.2017.22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Yu B. Y., Eom D. H., Kim H. W., Jeong Y. J., Keum Y. S. Dimethyl alpha-ketoglutarate promotes the synthesis of collagen and inhibits metalloproteinases in HaCaT cells. Biomol. Ther. (Seoul) 2024;32:240–248. doi: 10.4062/biomolther.2023.131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Zeng X., Cao J., Xu J., Zhou Z., Long C., Zhou Y., Tang J. SKP1-CUL1-F-box: Key molecular targets affecting disease progression. FASEB J. 2025;39:e70326. doi: 10.1096/fj.202402816RR. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Zeng X., Liang S. OGT-mediated O-GlcNAc of PINK1 promotes the progression of obesity-related hypertension via regulating mitophagy. Am J Hypertens. 2025;38:964–973. doi: 10.1093/ajh/hpaf084. [DOI] [PubMed] [Google Scholar]
  63. Zhang D., Qi Y., Inuzuka H., Liu J., Wei W. O-GlcNAcylation in tumorigenesis and its implications for cancer therapy. J. Biol. Chem. 2024a;300:107709. doi: 10.1016/j.jbc.2024.107709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Zhang F. X., Su K. H., Yang X. Y., Bowe D. B., Paterson A. J., Kudlow J. E. O-GIcNAc modification is an endogenous inhibitor of the proteasome. Cell. 2003;115:715–725. doi: 10.1016/S0092-8674(03)00974-7. [DOI] [PubMed] [Google Scholar]
  65. Zhang N., Jiang H., Zhang K., Zhu J., Wang Z., Long Y., He Y., Feng F., Liu W., Ye F., Qu W. OGT as potential novel target: Structure, function and inhibitors. Chem. Biol. Interact. 2022;357:109886. doi: 10.1016/j.cbi.2022.109886. [DOI] [PubMed] [Google Scholar]
  66. Zhang Y., Sun C., Ma L., Xiao G., Gu Y., Yu W. O-GlcNAcylation promotes malignancy and cisplatin resistance of lung cancer by stabilising NRF2. Clin. Transl. Med. 2024b;14:e70037. doi: 10.1002/ctm2.70037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Zhou S., Lou W., Wei Z., Wang T., Li Y., Zhao Q., Zhang F., Nie Y., Qian H., Xu Z. Decoding the regulatory code: O-GlcNAcylation in epithelial-mesenchymal transition (EMT) J. Biol. Chem. 2026;302:111265. doi: 10.1016/j.jbc.2026.111265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Zhou X., Zhang C., Li L., Feng Z., Bai X., Mei Y., He W., Gou X., Li X. Combinational analysis of metabolomic and O-GlcNAcylation omics reveals the HBP metabolic regulation of chemoresistance via GFPT1/NR3C1 O-GlcNAcylation/GPX4 axis. Research (Wash. D.C.) 2025;8:0809. doi: 10.34133/research.0809. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

bt-34-4-910-supple.pdf (936.9KB, pdf)

Articles from Biomolecules & Therapeutics are provided here courtesy of Korean Society of Applied Pharmacology

RESOURCES