Activation of endothelial GABA_A receptor α1 subunit protects against barrier dysfunction in acute lung injury

Abstract

Vascular hyperpermeability drives the pathogenesis of acute lung injury (ALI) during sepsis. Although γ-aminobutyric acid type A receptors (GABAARs) are classically recognized as central nervous system ion channels, we identified an unexpected, essential requirement for the GABA_A receptor α1 subunit (GABRA1) in preserving pulmonary endothelial integrity. To investigate the translational relevance of our findings in vivo, we utilized a cecal ligation and puncture (CLP)-induced sepsis mouse model. Analysis of pulmonary microvascular endothelial cells (PMVECs) isolated from these septic mice revealed a profound depletion of GABRA1. This reduction was consistently observed in cultured endothelial cells following LPS challenge. Furthermore, targeted silencing of GABRA1 in Human Umbilical Vein Endothelial Cell (HUVEC) significantly exacerbated LPS-induced barrier dysfunction, as indicated by a marked decrease in transendothelial electrical resistance and increased expression of adhesion molecules (ICAM-1 and VCAM-1). These results suggest that GABRA1 may act as a regulatory element in the pulmonary vasculature, offering a potential therapeutic avenue for managing septic endothelial leakage.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12890-026-04311-1.

Highlights

What is the central question of this study?

Two primary objectives guide this research on sepsis-induced ALI: first, to characterize the expression profile of GABA_A receptor subunits (with a focus on α1) in endothelial cells; and second, to delineate the functional role of the α1 subunit in preserving endothelial barrier integrity and controlling the inflammatory response.

What is the main finding and its importance?

We observed a significant downregulation of GABA_A receptor α1 subunit in PMVECs during sepsis. Consequently, knocking down this subunit in endothelial cells worsened LPS-induced injury, manifesting as impaired barrier function (lower TEER) and enhanced inflammation (elevated ICAM-1/VCAM-1). These data collectively identify endothelial GABA_A receptor α1 subunit as may function as a potential regulatory element in septic ALI, warranting further investigation as a therapeutic target.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12890-026-04311-1.

Introduction

Septic acute lung injury (ALI) is characterized by the structural collapse of the pulmonary microvascular endothelium, which significantly contributes to the high mortality observed in this condition. Singer et al., [16]. This loss of barrier integrity triggers massive plasma extravasation, inundating alveolar compartments with proteinaceous exudate and severely impairing respiratory function [20]. Consequently, targeting and restoring endothelial stability represents a critical imperative for future sepsis interventions.

Beyond the classical myeloid-driven cytokine storm, sepsis profoundly dysregulates the vascular endothelium [19]. Rather than functioning as mere passive conduits, endothelial cells (ECs) act as innate immune sentinels at the blood-tissue interface [6]. During early infection, this endothelial activation is an adaptive mechanism- shifting toward a pro-coagulant and adhesive phenotype to orchestrate leukocyte trafficking for pathogen clearance. However, in severe sepsis, this response rapidly becomes maladaptive. Rampant, unchecked endothelial hyperactivation inevitably compromises structural integrity, thereby amplifying collateral tissue injury and local inflammation [5]. Consequently, preserving endothelial homeostasis has emerged as a paramount therapeutic strategy for septic ALI.

Historically, γ-aminobutyric acid type A receptors (GABAARs) have been almost exclusively characterized as the primary inhibitory gatekeepers of the central nervous system (CNS) [4]. Defective GABAAR signaling is fundamentally linked to epileptic pathogenesis [8, 10, 14], whereas its functional restoration has been shown to offer cognitive benefits in Alzheimer’s disease models [2]. Unsurprisingly, contemporary investigations remain heavily neuro-centric, emphasizing phenomena like hippocampal neurogenesis [12], premenstrual dysphoric disorder [17] and sleep regulation [18]. As a result, the structural diversity and physiological relevance of GABAAR subunits in peripheral, non-neuronal compartments represent a striking knowledge gap. Elucidating this extraneural GABAergic network is critical for identifying novel therapeutic targets in critical care.

In this report, we uncover the functional presence of the GABA_A receptor α1 subunit (GABRA1) within pulmonary microvascular endothelial cells (PMVECs). Strikingly, targeted endothelial ablation of this receptor appears to amplify both endotoxin-driven cytokine cascades and microvascular leakage. These insights suggest GABA_A receptor α1 subunit as an unconventional, barrier-preserving potential candidate for sepsis-driven ALI. Based on the observation of GABRA1 expression in the pulmonary vasculature, we hypothesized that GABRA1 functions as a critical regulator of endothelial barrier integrity during sepsis. To test this, we employed both in vitro endothelial models and in vivo septic mouse models to characterize the functional impact of GABRA1 on cytokine production and microvascular permeability.

Methods

Animals

We utilized male C57BL/6J mice (6 weeks old; 25–30 g) sourced from the Shanghai Experimental Animal Center. The housing conditions were standardized at 23 ± 1 °C and 50% humidity, following a 12-hour circadian rhythm. Animals were provided with ad libitum food and water and were allowed to adapt to the facility for one week before the experiments commenced. The experimental protocol received approval from the Institutional Animal Care and Use Committee at the Sixth Affiliated Hospital of Shanghai Jiao Tong University. All procedures were conducted in strict compliance with the NIH Guide for the Care and Use of Laboratory Animals. Following a seven-day acclimatization period, the mice were randomly allocated into two experimental groups (n = 6 per group): sham-operated controls and cecal ligation and puncture (CLP) treatment group. Surgical anesthesia was induced by intraperitoneal administration of 4% pentobarbital sodium at a dosage of 40 mg/kg body weight [15]. After confirming the absence of the plantar reflex, the abdominal region was shaved and disinfected prior to performing a midline laparotomy. The cecum was carefully exteriorized, ligated distal to the ileocecal valve, and punctured twice using a 25-gauge needle. Following return of the cecum to the abdominal cavity, the surgical incision was closed in layers. Control animals underwent identical surgical procedures excluding the ligation and puncture steps. At 12 h post-surgery, mice were deeply anesthetized via intraperitoneal injection of pentobarbital sodium (50 mg/kg) [3]. Once the loss of pedal reflex was confirmed, thoracotomy was performed followed by cardiac exsanguination to ensure death.

Histological analysis

For histological evaluation, left lung lobes were fixed by tracheal perfusion with ice-cold 4% PFA immediately after euthanasia. The tissues were then post-fixed overnight at 4 °C. Subsequent processing included dehydration, paraffin embedding, and sectioning at 4–5 μm. Once stained with H&E per standard protocols, the sections were examined under a light microscope for pathological assessment.

Determination of lung Wet/Dry (W/D) weight ratio

Pulmonary vascular barrier integrity was evaluated by determining the lung wet-to-dry (W/D) weight ratio, a validated surrogate marker for capillary permeability and tissue edema. Following euthanasia, the lungs were harvested and weighed immediately to record the wet mass. Subsequently, the samples were dehydrated in an 80 °C oven for 72 h until a constant weight was achieved, representing the dry mass. This index served as a quantitative measure of the severity of sepsis-induced pulmonary edema.

Collection and analysis of Bronchoalveolar Lavage Fluid (BALF)

Bronchoalveolar lavage fluid (BALF) was collected 24 h post-intervention to assess pulmonary inflammation and barrier integrity. Following deep anesthesia with sodium pentobarbital (50 mg/kg, i.p.) and subsequent tracheotomy, the lungs were lavaged thrice with a total of 1 mL ice-cold PBS. The recovered fluid was centrifuged (300 × g, 4 °C, 10 min) to isolate the supernatant from the cellular component. Pulmonary vascular permeability was evaluated by quantifying total protein levels in the supernatant using a BCA protein assay kit (P0012, Beyotime) at 562 nm.

Cell culture and treatment

Human Umbilical Vein Endothelial Cell (HUVEC) line was obtained from the Cell Bank of the Chinese Academy of Sciences. The cells were routinely cultured in high-glucose DMEM (SH30022, HyClone, USA) medium supplemented with 10% fetal bovine serum (FBS) (FBP-S005#, HyCyte, Suzhou, China), 1% Endothelial Cell Growth Supplement (ECGS), 100 U/mL penicillin, and 100 µg/mL streptomycin (Biosharp, Beijing, China). Cells were maintained in a humidified incubator at 37 °C with 5% CO₂. Cells were treated with LPS (10 µg/mL) for 12 h.

Lentiviral transduction

Lentiviral vectors expressing shRNA targeting GABA_A receptor α1 subunit (LV-shGABA_A α1) and negative control vectors (LV-NC) were synthesized by GeneChem (Shanghai, China). The shRNA sequence for GABA_A receptor α1 subunit was 5’-CCTCCGGTTAAATAACCTAAT-3’, and the control sequence was 5’-TTCTCCGAACGTGTCACGT-3’. For transduction, HUVECs were seeded into 6-well plates and reached 80% confluence before being infected at a multiplicity of infection (MOI) of 10 in the presence of 5 µg/mL Polybrene. The culture medium was refreshed after 24 h, and cells were incubated for an additional 48 h. Transduction efficiency was initially assessed by GFP fluorescence imaging. Subsequently, the knockdown efficiency of GABA_A receptor α1 subunit was validated using qRT-PCR.

Quantitative Real-Time Reverse Transcription PCR (qRT-PCR)

Total RNA was isolated from treated cells or mouse lung tissues using TRIzol reagent. RNA quality was verified by assessing concentration, purity (A260/A280 ratio) with a NanoDrop™ spectrophotometer, and integrity. Subsequently, 1 µg of total RNA was reverse-transcribed into first-strand cDNA using the 4× EZscript Reverse Transcription Mix II kit. qRT-PCR was performed in a 10 µL reaction volume containing cDNA, gene-specific primers (Table 1), and 2×SYBR Green qPCR Master Mix on a LightCycler^® 480 II system. The thermal cycling protocol consisted of an initial denaturation at 95 °C for 5 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 30 s. Gene expression was normalized to β-actin, and relative quantification was calculated using the 2^(-ΔΔCt) method.

Table 1.

qPCR primers

Gene	Genbank	Forward and reverse primer sequences (5’ to 3’)
GABBR1	NM_001470	F: TACAATGTGGCAGTCCTGTG R: ACTATGGCAAGAGAGGCAAAG
GABBR2	NM_005458	F: GCTGACTTACATGCTCCACAT R: CAGGAATGGGTGTTATTGTGT
GABRA1	NM_000806.5	F: GCCAGAAACTCCCTCCCTAAGGT R: GCTGAGAACACAAAGGCATAGCAC
GABRA2	NM_000807	F: ATGACAACTCTAAGCATCAGTG R: AACAGCAATAAACCAGTCCA
GABRA3	NM_000808	F: CGACTGAGACCAAGACCTACA R: GCCCAATAGACCAGATTGAAT
GABRA4	NM_000809.4	F: GAGGTTTTATCTCCCTTGCCTAT R: CACCACTTCCCACACTGTAGTT
GABRA5	NM_000810.4	F: GCCATACTTCCAGCGAAAT R: TTCCTGAAAGATAGTGCTCACAT
GABRB1	NM_000812	F: ATGTCGTCTATTGGCTTTACT R: TGGATGGCTGAATCTCTTA
GABRB2	NM_000813.3	F: GACTGATGTGAATGCCATAG R: TAATAAAGCCAATAGACGATGTT
GABRB3	NM_000814.6	F: TTCAAAACCCACCATCAGATAAA R: CCAGAGAGCAGCGATTAGGA
GABRE	NM_004961	F: TCTTCCCGTGATGTTGTCTAT R: GAGAGGCTTCTGGCAGTTT
GABRG1	NM_173536	F: GAAGGAAGGATACACATACGCA R: AGCCAACCCAATAAACCAAG
GABRG2	NM_198904.4	F: AGATGAAGAGTACGGCTATGAGT R: CAAGCTCCTGTTCGACAAT
GABRG3	NM_033223.5	F: GTAACCCATTCTGCATTGAC R: TTTGTGTTCTAGCCCTTTAGATA
GABRP	NM_014211.3	F: TTTTTGAGTGTGCCAGGGTAAAG R: CTGACAGGAAAGGTAAAGCCGT
GABRQ	NM_018558.4	F: GACCACCATCGACTCACAT R: AGAACAAGCACACGAGGATATAG
GABRR1	NM_002042.5	F: ATACGACACTGTAGCGACTGATG R: GGGTCTAACGGGTGGAACTAA
GABRR2	NM_002043	F: GCGTCACACTTCACATCTCT R: CTAGGCAATCTGAGGGTCTAA
TNF-α	NM_000594.4	F: CCTCTCTCTAATCAGCCCTCTG R: GAGGACCTGGGAGTAGATGAG
β-actin	NM_001101	F: AAGGTGACAGCAGTCGGTT R: TGTGTGGACTTGGGAGAGG

Immunofluorescence staining

Paraffin-embedded lung sections were deparaffinized, rehydrated, and blocked with 5% BSA containing 0.5% Triton X-100. HUVECs, seeded on coverslips and subjected to LPS stimulation where indicated, were fixed with 4% PFA, permeabilized with 0.5% Triton X-100, and blocked with 5% BSA.Samples were incubated overnight at 4 °C with the following primary antibodies: CD31 (P72490#, MCE), ICAM-1 (10831#, proteintech), VCAM-1 (11444#, proteintech), VE-Cadherin (98251#, proteintech), and GABRA1 (12410#, proteintech). To ensure antibody specificity, negative control staining was performed using isotype-matched IgG. Furthermore, the specificity of the anti-GABRA1 antibody was validated by comparing staining intensity between shNC-transfected cells and GABRA1-knockdown cells, where a significant reduction in fluorescence signal was observed. After washing, samples were incubated with Alexa Fluor 488-conjugated goat anti-rabbit IgG (ab150077#, Abcam) and/or Alexa Fluor 594-conjugated goat anti-mouse IgG (ab150116#, Abcam) for 1–2 h at room temperature. Nuclei were counterstained with DAPI (C1006#, Beyotime). Images were captured using Leica or Zeiss microscopy systems and analyzed with ImageJ software.

Measurement of transendothelial electrical resistance

Transendothelial Electrical Resistance (TEER) measurements were performed using an Electric Cell-substrate Impedance Sensing (ECIS) system (Applied BioPhysics, Troy, NY, USA). HUVECs were grown to form confluent monolayers on ECIS array slides pre-coated with 0.1% gelatin. Subsequently, the cells were transfected with shGABA_A α1 for 48 h as described above, followed by treatment with 10 µg/ml LPS. TEER values were obtained every 3 min for 8 h after LPS treatment as an automatically recorded resistance (TEER = R_TEER × Marea (cm²), R_TEER represents the monolayer cell resistance). To account for inter-experimental variability, raw resistance values were normalized to the baseline resistance measured immediately before LPS stimulation. The relative TEER values were calculated by dividing actual TEER values at each time point by the initial TEER values.

Western blotting

Total protein was extracted from cell lysates or lung tissue homogenates using ice-cold RIPA buffer supplemented with protease inhibitors. Following centrifugation at 12,000 × g for 10 min at 4 °C, the protein concentration of the resulting supernatant was quantified via a BCA assay kit (Beyotime, P0012). Equal amounts of protein (adjusted with RIPA buffer) were fractionated by SDS-PAGE and subsequently electro-transferred onto PVDF membranes. To minimize non-specific signals, membranes were blocked with 5% non-fat milk in TBST for 1 h at room temperature. The membranes were then probed overnight at 4 °C with primary antibodies targeting ERK1/2 and phospho-ERK1/2 (p-ERK1/2). After incubation with appropriate HRP-conjugated secondary antibodies for 1 h, protein bands were visualized using ECL reagents (Beyotime, P0018) and a chemiluminescence imaging system (Tanon). Protein expression levels were semi-quantified using ImageJ software, with band intensities normalized to total ERK1/2 or an internal reference, as appropriate.

Statistical analysis

Statistical analyses were carried out using GraphPad Prism 9 to evaluate the data, which are reported as mean ± SEM. Group comparisons involved the unpaired Student’s t-test for two groups or one-way ANOVA with Tukey’s post-hoc test for multiple groups, respectively. All experiments were performed at least three times independently, and n values represent independent biological replicates. For cell culture experiments, each n represents cells from a separate passage/seeding event. Statistical significance was set at P < 0.05.

Results

The expression of GABA receptor genes in ECs upon LPS stimulation

To determine the expression of GABA receptor genes in ECs, HUVECs were incubated with LPS (10 µg/ml) for 12 h. GABBR1, GABBR2, GABRA1, GABRA2, GABRA3, GABRA4, GABRA5, GABRB1, GABRB2, GABRB3, GABRE, GABRG1, GABRG2, GABRG3, GABRP, GABRQ, GABRR1 and GABRR2 mRNA were analyzed by RT-qPCR. The results revealed that, among the 18 GABAAR genes examined, the expression levels of two GABA receptor genes (GABRA1 and GABRP) and one GABAb receptor gene (GABBR1) were decreased in ECs upon LPS stimulation compared to the control group. In contrast, the expression of GABRA3 and GABRA5 was significantly upregulated following LPS challenge. Notably, the expression level of GABRA1 was the most markedly downregulated after LPS treatment (Fig. 1a and b).

Fig. 1.

The expression of GABA receptor genes in ECs upon LPS stimulation. HUVECs were treated by LPS for 12 h. a The expression of GABA receptor-related genes in ECs was analyzed by RT-qPCR. The mRNA levels of GABBR1, GABBR2, GABRA1, GABRA2, GABRA3, GABRA4, GABRA5, GABRB1, GABRB2, GABRB3, GABRE, GABRG1, GABRG2, GABRG3, GABRP, GABRQ, GABRR1, and GABRR2 are presented as a heatmap. b represents the significant difference analysis for (a). Effect sizes are reported as fold-change (FC) values relative to the control group. Bar graphs depict the mean ± SEM. Comparisons between the Control and LPS groups were performed using an unpaired Student’s t-test. The analysis revealed significant differences in the expression of the following genes: GABRA1 (FC = 0.40, P < 0.0001), GABRA3 (FC = 1.28, P = 0.0004), GABRA5 (FC = 1.24, P = 0.0029), GABRP (FC = 0.77, P = 0.0029), and GABRR1 FC = 0.80, P = 0.0150). Significance levels are denoted as *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001

The expression of GABA_A receptor α1 subunit decreased in the PMVECs of septic mice

Histological examination via H&E staining revealed substantial lung injury in the CLP-induced sepsis model, characterized by alveolar hemorrhage, enlargement of airspaces, and infiltration of inflammatory cells. The pathological alterations were markedly more severe than those observed in the sham-operated control group (Fig. 2a), confirming the successful establishment of the septic animal model. To assess the integrity of the pulmonary vascular barrier, we measured the lung W/D ratio (Fig. 2b) and BALF protein concentration (Fig. 2c). These functional readouts revealed a significant increase in microvascular permeability in septic mice, which temporally aligns with the downregulation of GABRA1. To investigate the expression pattern of GABA_A receptor α1 subunit in pulmonary microvascular endothelial cells (PMVECs), we performed immunofluorescence staining on lung sections using a GABA_A receptor α1 subunit-specific antibody. As illustrated in Fig. 2d, GABA_A receptor α1 subunit was found to be co-localized with CD31, an endothelial cell marker. Notably, a significant reduction in GABA_A receptor α1 subunit expression was detected within PMVECs of septic mice. Collectively, these findings imply a potential role for GABA_A receptor α1 subunit downregulation in PMVECs during the pathogenesis of sepsis-induced ALI.

Fig. 2.

The expression of GABA_A receptor α1 subunit decreased in PMVECs of septic mice. a Lung injury was assessed by H&E staining (n = 6; scale bar: 100 μm). b Assessment of pulmonary edema via the lung W/D ratio (n = 6, FC = 1.4, P < 0.0001). c Quantification of inflammatory cells in BALF, (n = 6, FC = 2.58, P < 0.0001). d Representative immunofluorescence images showing co-localization of GABA_A receptor α1 subunit (green) and the endothelial marker CD31 (red) in lung tissue sections. Nuclei were counterstained with DAPI (blue) (Scale bar: 100 μm). Significance levels are denoted as *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001

GABA_A receptor α1 subunit negatively regulates ECs inflammation and barrier integrity

To investigate the impact of GABA_A receptor α1 subunit loss-of-function on inflammatory cytokine expression in LPS-treated HUVECs, we employed lentivirus-mediated RNA interference for targeted gene knockdown in vitro (Fig. 3a). The efficiency of GABRA1 depletion was confirmed in HUVECs using quantitative real-time PCR (Fig. 3b). Analysis revealed that silencing GABRA1 markedly upregulated the expression of TNF-α, ICAM-1, and VCAM-1 under LPS stimulation (Fig. 3c-e). Furthermore, to assess the consequences of GABRA1 knockdown on endothelial barrier function, we monitored TEER using an electric cell-substrate impedance sensing system following LPS exposure. Notably, while LPS alone reduced TEER values in HUVECs, the additional loss of GABA_A receptor α1 subunit significantly exacerbated this barrier impairment (Fig. 3f). To investigate the molecular mechanism underlying this GABRA1-mediated protection, we examined the MAPK/ERK signaling pathway, which is a critical regulator of endothelial inflammation. Western blot analysis revealed that while LPS stimulation increased p-ERK1/2 levels, the knockdown of GABRA1 markedly exacerbated this phosphorylation (Fig. 3g and h). These data suggest that GABRA1 functions as a negative regulator of the MAPK/ERK pathway, and its depletion unleashes the inflammatory signaling cascade in endothelial cells.

Fig. 3.

GABA_A receptor α1 subunit negatively regulates ECs inflammation and barrier integrity. a Transfection efficiency in ECs 48 h post-transfection with shNC (negative control) and shGABRA1, as observed under a fluorescence microscope (scale bar: 200 μm). b qRT-PCR analysis to determine the optimal sequence for GABRA1 gene knockdown (n = 4, P < 0.0001). c mRNA expression levels of TNF-α among groups following stable lentiviral transduction (n = 4, P < 0.0001). d and e Immunofluorescence staining of ICAM-1 (green), VCAM-1 (green), and DAPI (blue) in endothelial cells (scale bar: 100 μm). f Real-time changes in TEER values following LPS treatment up to 8 h (n = 4, P < 0.0001). g Western blot detection of p-ERK1/2 and ERK protein expression. β-actin was used as an internal control. h Densitometric quantification of the protein bands shown in (g). Bar graphs represent the mean ± SEM for each group. For comparisons across multiple groups, one-way ANOVA with repeated measures was employed, followed by Tukey’s post-hoc test for multiple comparisons. Significance levels are denoted as *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001

Discussion

Sepsis-induced acute lung injury is primarily characterized by the structural collapse of the pulmonary microvascular barrier. Saguil and Fargo [13], . Within this pathological framework, our current investigation uncovers an unexpected molecular event: the profound depletion of the GABRA1 in the pulmonary endothelium of septic mice. This in vivo suppression temporally correlates with the development of severe pulmonary edema and compromised tissue homeostasis.

Classically, GABAergic signaling is synonymous with central nervous system inhibition, where it dictates neuronal excitability and developmental trajectories [9, 11]. However, emerging paradigms suggest a broader, extraneural footprint for these ionotropic channels. For instance, GABRB3 is expressed in periventricular endothelial networks. Its ablation disrupts neurobehavioral outcomes and impairs fundamental endothelial processes, including proliferation and angiogenic sprouting [1, 7, 21]. Building upon this concept of “endothelial GABAergic signaling,” we hypothesized that GABRA1 might act as an intrinsic regulator of vascular stability during severe systemic infection. Although we also observed compensatory upregulation of GABRA3 and GABRA5 upon LPS stimulation, our data identify GABRA1 as the functionally dominant subunit in pulmonary endothelial barrier maintenance.

To mechanistically validate this, we employed lentiviral-mediated depletion of GABRA1 in human endothelial cells. While lentiviral knockdown is a robust tool, we acknowledge the potential for off-target effects inherent in shRNA-based approaches. To address this, we utilized distinct shRNA sequences targeting different regions of the GABRA1 transcript. We designed three independent shRNA sequences; the other two sequences also yielded consistent results. This consistency across independent knockdown sequences significantly mitigates concerns regarding off-target interference. Strikingly, the loss of this receptor dramatically sensitized the endothelium to endotoxemic injury. Upon LPS challenge, GABRA1-deficient cells exhibited an exaggerated inflammatory phenotype, evidenced by the hyper-expression of ICAM-1 and VCAM-1. Furthermore, this molecular hyperactivation translated into severe structural vulnerability, demonstrated by a precipitous decline in TEER.

Taken together, these data delineate a previously unrecognized paradigm wherein the loss of endothelial GABRA1 may contribute to the immunopathology of sepsis. Rather than being a mere bystander, GABRA1 may function as a potential regulatory element, which may help restrain inflammatory signaling and reinforce the alveolar-capillary barrier. Given that GABA_A receptors are clinically druggable, pharmacological strategies to augment endothelial GABAergic tone—such as the systemic administration of GABA_A receptor positive allosteric modulators (PAMs)—warrant further investigation. Future in vivo studies should explore whether such interventions can effectively mitigate pulmonary vascular collapse and improve survival in septic models, offering a promising therapeutic avenue for clinical management. Consequently, rescuing or augmenting this localized endothelial GABAergic tone warrants further investigation as a potential therapeutic strategy for mitigating sepsis-associated vascular collapse.

Study limitations

Our current findings, while methodologically grounded, carry inherent constraints. First, the use of HUVECs as an in vitro model, while standard, does not fully recapitulate the organ-specific microenvironment of the pulmonary endothelium, necessitating future validation in primary PMVECs or organ-on-a-chip models. Second, the statistical power underpinning our in vivo conclusions would be substantially strengthened by recruiting larger murine cohorts, a step critical to guaranteeing both reproducibility and translational confidence. Crucially, a significant limitation of our study is the absence of an endothelial-specific GABRA1 knockout mouse model to definitively prove the causal role of this receptor in vivo. While our in vitro knockdown experiments and in vivo functional readouts (W/D ratio and BALF protein) provide strong evidence for the role of GABRA1 in maintaining vascular stability, future investigations utilizing conditional knockout mice will be essential to further validate the therapeutic implications of GABRA1 signaling in sepsis-induced ALI. Furthermore, our genetic manipulation of GABRA1 was restricted to cultured systems; the absence of endothelial-targeted conditional knockout transgenic lines limits our ability to definitively confirm these phenotypes within a complex physiological environment. Additionally, the precise molecular crosstalk driving pathogen-induced endothelial hyperactivation remains incompletely resolved. Future investigations must dissect these mechanisms while explicitly accounting for the profound phenotypic heterogeneity of vascular beds across different organs. Ultimately, pinpointing exactly how this receptor orchestrates microvascular barrier competence will require high-resolution mapping of its downstream signaling cascades.

Conclusions

In conclusion, this study demonstrates that GABA_A receptor α1 subunit is expressed in PMVECs and is reduced during sepsis. Its knockdown in endothelial cells exacerbated the inflammatory response to LPS, suggesting that enhancing GABA_A receptor α1 subunit signaling may represent a potential strategy for treating infection-induced inflammatory lung injury.

Abbreviations

ALI

Acute lung injury

LPS

Lipopolysaccharide

ECs

Endothelial cells

GABA_A Receptor α1 subunit

γ-aminobutyric acid type A (GABA_A) receptor α1 subunit

VCAM-1

Vascular cell adhesion molecule-1

ICAM-1

Intercellular cell adhesion molecule-1

BALF

Bronchoalveolar lavage fluid

TNF-α

Tumor necrosis factor-α

IL-1β

Interleukin-1β

IL-6

Interleukin-6

Authors’ contributions

The research framework and central hypothesis were jointly formulated by Xiaotao Xu and Aizhong Wang. Shuting Zhou and Xudong He performed the experiments. Shuting Zhou and Xinzhe Ni analysed the data. The initial manuscript was prepared by Shuting Zhou. Xiaotao Xu critically reviewed the manuscript. Every named contributor has thoroughly examined and endorsed the finalized document, assuming collective responsibility for the study’s veracity and scientific rigor. We formally commit to transparently addressing any future inquiries concerning the validity or ethical execution of this research. Furthermore, the designated author list strictly reflects individuals meeting established attribution criteria, ensuring no eligible researchers have been omitted.

Funding information

This work was supported by Natural Science Foundation of Shanghai (25ZR1401287) and Retrospective Study Project of Shanghai Sixth People’s Hospital (ynhg202215).

Data availability

The datasets used and/or analyzed during the current study are available within themanuscript and tables.

Declarations

Ethics approval and consent to participate

This study did not involve human participants, human data, or human tissue. All methods in this study are reported in accordance with ARRIVE guidelines for the reporting of animal experiments. Furthermore, all experimental procedures were approved by the Ethics Committee of Shanghai Sixth People’s Hospital Affiliated to Shanghai Jiaotong University School of Medicine (Approval ID: 2025 − 0573). Also, the study was carried out in compliance with the the National Institutes of Health Guidelines for the Use of Laboratory Animals.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.