Tofacitinib as a Successful Treatment for Hyper-IgE Syndrome and Autoimmunity Associated with Constitutive Activation of JAK3

Abstract

The Janus Kinase 3 (JAK3) germline gain-of-function (GOF) mutation is a rare inborn error of immunity, first reported in 2020, characterized by lymphopenia and chronic NK-cell proliferation. However, its role in autoimmunity remains unclear, and no direct association with hyper-IgE syndrome (HIES) has been established. In this study, we describe a patient presenting with HIES, myositis, lymphopenia, and autoimmune hypothyroidism. Whole-exome sequencing identified a novel compound heterozygous JAK3 mutation (c.2524_2525delinsTT and c.2805G > C), predicted to be deleterious. Flow cytometry and RNA sequencing of peripheral blood mononuclear cells revealed a significant reduction in T cells and NK cells, particularly naïve CD4⁺ T cells, accompanied by a marked imbalance in T cell subsets. This led to constitutive activation of JAK1 and JAK3, along with increased STAT3 and STAT5 phosphorylation. Tofacitinib treatment significantly improved the patient’s symptoms. Our findings expand the clinical spectrum of JAK3-associated immune dysregulation, linking it for the first time to HIES and multiple autoimmune manifestations. Furthermore, this study suggests that tofacitinib may be a potential therapeutic option for JAK3 signaling–associated immune dysregulation.

Supplementary Information

The online version contains supplementary material available at 10.1007/s10875-026-02027-9.

Introduction

Janus kinase 3 (JAK3) is a non-receptor tyrosine kinase that plays a pivotal role in the JAK-STAT signaling pathway, which is critical for the development and function of immune cells. Dysregulation of JAK-STAT signaling can result in inborn errors of immunity (IEI) [1]. JAK3 interacts with the common gamma chain (γc) to regulate cytokine receptors, including those for IL-2, IL-7, IL-9, and IL-15, and is essential for T cell and natural killer (NK) cell development as well as immune homeostasis [2].

The first report of germline JAK3 gain-of-function (GOF) mutations was published in 2020, describing two cases in which enhanced JAK3 activity led to an IEI characterized by chronic NK cell proliferation and autoimmune manifestations, including cytopenia, vasculitis, and psoriasis [3]. In vitro studies have shown that GOF mutations of JAK3 result in persistent tyrosine phosphorylation, enabling cells to proliferate independently of cytokine signals. For example, mutations such as A572V lead to constitutive activation of JAK3, promoting abnormal T cell proliferation and differentiation, even in the absence of cytokine stimulation [4].

In this study, we present a patient with constitutive activation of JAK3. Unlike previously described cases, this patient exhibited hyper-IgE syndrome (HIES), myositis, lymphopenia, and autoimmune hypothyroidism. Treatment with tofacitinib, a JAK inhibitor, led to significant clinical improvement. This case suggests the potential role of tofacitinib in managing these conditions.

Method

Data Collection

Clinical data were retrospectively obtained from medical records following written informed consent from the patient and his parents. Parental consent was also granted for participation in the approved research, encompassing sample collection, data analysis, and publication. This study was approved by the Ethical Committee for Clinical Research and Animal Trials of the First Affiliated Hospital of Sun Yat-sen University [(2021)137].

Whole-Genome Sequencing

Peripheral blood samples were collected, and genomic DNA was extracted from peripheral blood using the TianGen Blood Genomic DNA Kit following the manufacturer’s instructions. The extracted DNA was subjected to quality control using a Qubit 2.0 fluorometer and 0.8% agarose gel electrophoresis. After passing quality control, the extracted DNA was randomly fragmented, and a DNA library was obtained through amplification and purification. The captured sequences were sequenced using the Illumina Next 500 sequencing platform. Bioinformatics analysis was conducted on the raw data, including variations within the coding regions, non-coding regions within 150 bp upstream and downstream, and UTR region variations. Mutations were verified by Sanger sequencing.

Immunophenotyping by Flow Cytometry

Peripheral blood EDTA-anticoagulated venous blood samples were processed for analysis of lymphocyte subsets, lymphocyte activation inhibitory subsets, and regulatory T cell subsets using a BD FACSCanto flow cytometer (BD Biosciences, USA). Cells were stained with a cocktail of monoclonal antibodies for 20 min in the dark. Following staining, hemolysin was added for complete lysis, and the sample was incubated for 10 min. After lysis, 3 mL of PBS buffer was added, followed by centrifugation to remove the supernatant. The cell pellet was resuspended in 200 µL of PBS buffer, and flow cytometry analysis was performed using the BD FACSCanto flow cytometer. Data were analyzed using FlowJo V10 (BD Biosciences).

JAK3 RNA Expression by qRT-PCR

Quantitative real-time PCR (qRT-PCR) was performed to assess the JAK3 mRNA expression levels in the patient’s peripheral blood compared to healthy controls. Total RNA was extracted using a commercial RNA extraction kit, and cDNA was synthesized using reverse transcription. The qRT-PCR was carried out using specific primers for JAK3 (Hu-JAK3-F2: TTGGGGCTACCGAAAGATT and Hu-JAK3-R2: CACCCCTGTGCCTTGAGACTG), ACTB (Human ACTB-F: GATTCCATATGTGGGCGACGA, ACTB-R: TCTCCATGTGCTGCCAGTTG), and GAPDH (Human GAPDH-F: GGAAGCTTGTCATCAATGGAAATC, GAPDH-R: TGATGACCCTTTTGGCTCCC) as internal controls for normalization.

Isolation of Peripheral Blood Mononuclear Cells

Peripheral blood was collected from the patient before treatment and from an age- and sex-matched healthy control for single-cell RNA sequencing (scRNA-seq). Raw peripheral blood mononuclear cells (PBMCs; All Cells) were isolated from the buffy coats by density gradient centrifugation. Blood samples were diluted with PBS to 1:2 then carefully layered over 15 mL Ficoll-Paque premium (GE Healthcare, 17-5442-02) in a 50 mL conical tube and centrifuged for 30 min at room temperature with 1800 r.p.m and brake. After centrifugation, the peripheral blood mononuclear cell (PBMC) layer was aspirated and washed twice with PBS.

Library Preparation and scRNA-seq

Gel beads-in-emulsion generation, cDNA amplification, and the construction of 3’ gene expression and V(D)J libraries were carried out using the Chromium Next GEM Single Cell 3’ Reagent Kits v2 from 10X Genomics.

Quality Control of scRNA-seq Data

The raw single-cell RNA sequencing (scRNA-seq) data were processed using Cell Ranger (Version 5.0.1) by 10x Genomics for demultiplexing, read alignment, and gene-cell matrix generation based on the GRCh38 human reference genome. Quality control (QC) metrics were evaluated with the Seurat R package (Version 4.0.5). Genes detected in fewer than three cells and cells with fewer than 200 or more than 4,000 genes detected were filtered out. Cells were also excluded if over 10% of unique molecular identifiers (UMIs) came from mitochondrial genes or if their log10 gene count/log10 UMI count ratio exceeded 0.80. Doublets were identified by gene expression patterns indicating dual lineage markers, such as cells coexpressing the T cell marker CD3D and the B cell marker CD79A. We reviewed canonical marker gene expressions and repeated filtering to remove most barcodes associated with doublets. Finally, cytoplasmic genes, including mitochondrial, ribosomal, and hemoglobin genes, were eliminated from further analysis.

Cell Type Annotations

After removing low-quality cells and doublets, the Seurat R package (version 4.0.5) was used to normalize the filtered gene-cell count matrix, scale the data, and identify highly variable genes using the default parameters. The optimal number of principal components (PCs) was determined using the ElbowPlot function. The top 2,000 variable genes and the first 12 PCs selected by Seurat were utilized for unsupervised clustering analysis. Harmony was applied after principal component analysis (PCA) based on the sample. Subsequently, Uniform Manifold Approximation and Projection (UMAP) was performed in the “harmony space,” followed by clustering with a resolution set to 0.8 to identify clusters. Cluster-specific marker genes were identified using the FindAllMarkers function with the following criteria: only.pos = TRUE, min.pct = 0.25, and log FC ≥ 0.25.

JAK3 Protein Expression and Phosphorylation in PBMCs Following IL-2 and Tofacitinib Treatment

Raw PBMCs were treated with recombinant human IL-2 (100 ng/ml; R&D Systems) at 37 °C for 20 min, and Tofacitinib was added 30 min before treatment. The cells were lysed on ice by RIPA lysates. Protein concentrations were determined with a BCA Protein Quantitation Kit. A total of 10–30 µg protein was loaded in each lane and was separated by 10% SDS-PAGE. After separation, the proteins were transferred to PVDF membranes. The membranes were blocked with 5% defatted milk powder for 1 h. Blots were incubated overnight with the primary antibodies as follows: p-JAK1 (1:500, Zenbio, R30275), p-JAK3 (1:500, Proteintech, 29101-1-AP), p-STAT3 (1:1000, Huabio, ET1603-40), p-STAT5 (1:1000, Huabio, ET1610-48). The β-actin (1:5000, Abways, AB2001) was used as a control. Then, horseradish peroxidase (HRP)-conjugated secondary antibody was incubated with corresponding primary antibody blots for 1 h. Blots were visualized using the ECL western blotting substrate and recorded by the gel imager.

Statistical Analysis

Data analysis was performed using GraphPad Prism software. P values < 0.05 is considered statistically significant.

Result

HIES and Autoimmunity in a Patient with Novel JAK3 Mutation

A boy first presented at 28 months of age with recurrent eczema affecting his face and the extensor surfaces of both upper limbs, accompanied by allergic rhinitis. Treatment with topical corticosteroids and oral antihistamines provided only transient symptom relief. After turning three, he experienced an increase in respiratory infections, averaging three to four episodes of bronchitis or pneumonia annually, though without severe infections caused by atypical pathogens. By age five, he exhibited alopecia, loss of eyebrows, and growth retardation. At 5.5 years, he developed difficulty squatting, lower limb pain, reduced exercise capacity, and cold intolerance (Fig. 1A and B). The patient had no hepatomegaly, splenomegaly, or lymphadenopathy. His parents and sister have no clinical manifestations and no history of immune-related or autoimmune disorders.

Fig. 1.

Novel mutation in JAK3 identified in a patient with myositis. (A) Clinical course. (B) Disease manifestation. (C) Patient’s family pedigree. (D) Sanger sequencing of peripheral blood DNA confirmed the mutations c.2524_2525delinsTT and c.2805G > C in the JAK3 gene. (E) Location of germline activating JAK3 mutations. The JAK3 protein consists of four domains: four-point-one, ezrin, radixin and moesin (FERM), Src-homology 2 (SH2), pseudo-protein tyrosine kinase (pseudo-PTK), and protein tyrosine kinase (PTK). * indicates the patient’s variants (D842F and K935N), # indicates previously reported GOF mutations

Despite these symptoms, they were initially overlooked by both his parents and attending physicians until a school-entry physical examination revealed reduced white blood cell counts. He had received all immunizations according to the standard schedule, including the Bacille Calmette-Guérin vaccination, without any adverse reactions.

Laboratory tests revealed leukopenia (1.99 × 10⁹/L) and lymphopenia (0.63 × 10⁹/L). Further clinical evaluation showed multi-system involvement, including anemia, significantly elevated creatine kinase levels (945 U/L), impaired renal function (eGFR 43 ml/1.73 m²/min), and hypothyroidism (Table 1). The patient had no hematuria, and 24-hour urinary protein was 0.023–0.028 g. Renal biopsy was not performed as the family declined the procedure. Notably, antineutrophil cytoplasmic antibodies proteinase 3 and thyroglobulin antibodies were transiently positive, whereas all other autoimmune antibodies were negative (Table S2). The Coombs test was negative. Cytokine analysis showed a mild elevation of IL-4, with other cytokines within normal ranges. Inflammatory markers, including ESR, CRP, and ferritin, were also within normal limits (Table S3). Immunoglobulin levels were within normal limits, except for an elevated IgE level (1500 IU/ml). A bone marrow smear showed active hyperplasia with no evidence of malignant cells.

Table 1.

Clinical laboratory examination of this patient before and after tofacitinib treatment

	Before treatment (7 y 2 m)	Three month after treatment (7 y 5 m)	One year after treatment (8 y 2 m)	Normal
WBC (109/L)	1.99	2.99	4.27	(4.3–11.3)
Neutrophils(109/L)	1.10	2.23	2.61	(1.6–7.8)
Lymphocytes(109/L)	0.63	0.38	1.04	(1.5–4.6)
CD3+ (cells/µL)	442	290	914	(876–2310)
CD3+CD4+(cells/µL)	235	133	249	(411–1228)
CD3+CD8+(cells/µL)	203	155	633	(258–958)
CD3+CD8+HLA-DR+CD38+/CD3+CD8+(%)	46.1	NA	52.5	(0.1–1.7)
CD3+CD8+PD1+/CD3+CD8+(%)	0.42	NA	6.50	(4.3–12.6)
CD19+(cells/µL)	92	97	157	(107–545)
CD16+CD56+ (cells/µL)	6.83	30	130	(109–780)
IgA (g/L)	2.23	NA	2.02	(1.45–3.45)
IgG (g/L)	10.9	NA	10.20	(10.13–15.13)
IgM (g/L)	0.90	NA	1.18	(0.92–2.04)
IgE (IU/ml)	1500	4488	4854	(0–120)
Eosinophils(109/L)	0.07	0.01	0.27	(0.00–0.68)
RBC (1012/L)	3.46	4.12	4.61	(4.20–5.70)
Hemoglobin(g/L)	106	123	128	(118–156)
Platelet(109/L)	154	161	284	(167–453)
ALT (U/L)	158	37	13	(7–30)
AST (U/L)	188	70	39	(14–44)
BUN (mmol/L)	6	3.4	4.5	(2.9–8.6)
Serum Creatinine (µmol/L)	92	32	43	(27–66)
CK (U/L)	2182	63	125	(25–200)
TSH (uIU/mL)	50.6	3.15	0.67	(0.34–5.60)
FT3 (pmol/L)	2.30	5.02	7.01	(3.28–6.47)
FT4 (pmol/L)	3.20	13.94	17.14	(7.50–21.10)

WBC White blood cells, RBC Red blood cells, ALT Alanine aminotransferase, AST Aspartate aminotransferase, BUN Blood urea nitrogen, CK creatine kinase, TSH Thyroid stimulating hormone, FT Free thyroxine, NA Not available due to no test performed

Given the early onset and complex clinical course of the disease, whole-exome sequencing was performed, revealing a novel compound heterozygous variant in JAK3 (c.2524_2525delinsTT and c.2805G > C), inherited from his unaffected parents (Fig. 1C and D). Neither variant is present in the gnomAD database. The variant allele frequencies were 42.1% and 50.0%, relative to the overall sequencing depth. Both variants are located within the kinase domain of JAK3 and were consistently predicted to be deleterious by pathogenicity prediction tools. (Table S1, Figure S1-S3)

Functional Analysis of JAK3 Mutation and JAK-STAT Pathway Activation

Flow cytometry and RNA sequencing analysis revealed a significant imbalance in T cell subsets, characterized by a marked reduction in CD4⁺CCR7⁺ naïve T cells. These cells exhibited high JAK3 expression, along with upregulation of JUN and FOS, which promote T cell activation and proliferation, as well as MAF and TNFRSF4, which facilitate Th2 cell differentiation. Concurrently, there was an increased proportion of CD8⁺GZMB⁺ cytotoxic T cells, with a particular high proportion of HLA-DR⁺CD38⁺CD8⁺ T cells.

Using scRNA-seq of PBMCs, NK cell subsets were annotated based on canonical marker genes. The overall NK cell count was reduced in the patient; however, within the NK cell population, the proportion of CD56⁺ NK cells was increased. These CD56⁺ NK cells showed high expression of JAK3, JAK1, and ITGB2. GO enrichment analysis further revealed upregulation of genes associated with intrinsic apoptotic pathways and oxidative phosphorylation in CD56⁺ NK cells, suggesting a potential role for mitochondrial-mediated apoptosis in NK cell loss. In the pseudo-bulk analysis of the HALLMARK_IL2_STAT5_SIGNALING gene set, 85 out of 199 genes were significantly upregulated in the patient compared to the control, indicating widespread activation of IL-2/STAT5 signaling at the transcriptional level. These findings indicate that JAK3 mutations alter immune cell lineage composition. (Fig. 2A-G, Figure S5)

Fig. 2.

(A) UMAP of 20 380 cells derived from PBMC of healthy control (10 573 cells) and patient (9 807 cells). The right panel shows the same UMAP separated by sample origin (Control vs. Patient). (B) Bar plot showing the proportions of cells in PBMC from healthy control and patient. (C) Violin plots showing the expression of JAK3, JUN, and FOS in CD4⁺CCR7⁺Tcm between healthy control and patient. (D) Boxplot comparing the TH2_vs_TH1_UP gene signature (from Molecular Signatures Database) scores in CD4⁺CCR7⁺ Tcm cells between healthy control and patient. (E) Violin plots showing the gene expression levels in CD56⁺ NK cells between healthy control and patient. (F) Heatmaps of genes associated with oxidative phosphorylation and intrinsic apoptotic pathways in CD56⁺ NK cells, showing differential expression between control and patient. (G) Violin plot showing the expression of JAK3-regulated target genes in PBMC from healthy control and patient. DC, dendritic cell; Mono, monocyte; PBMC, peripheral blood mononuclear cell; Tcm, central memory T cell; NK, natural killer cell

Quantitative real-time PCR analysis showed no significant difference in JAK3 mRNA expression levels in the patient’s peripheral blood compared to healthy controls (Figure S4). To assess JAK-STAT pathway activity, Western blotting was performed on PBMCs isolated from the patient and healthy control. The cells were stimulated with IL-2, with or without the JAK inhibitor tofacitinib. Compared to the control, the patient’s JAK1, JAK3, STAT3, and STAT5 exhibited phosphorylation even in the absence of IL-2 stimulation, which was further elevated upon IL-2 exposure (Fig. 3A, Figure S7). Collectively, these findings suggest that the JAK3 mutation drives immune dysregulation through hyperactivation of the JAK-STAT pathway.

Fig. 3.

JAK3^D842F/K935N effects on JAK-STAT pathway activation and response to Tofacitinib treatment. (A) PBMCs were isolated and stimulated with IL-2 to assess JAK-STAT pathway activation, and tofacitinib was added prior to IL-2 stimulation to evaluate its inhibitory effects. The patient’s JAK1, JAK3, STAT3, and STAT5 showed phosphorylation even without IL-2 stimulation, and IL-2 further enhanced the phosphorylation levels of these factors, indicating constitutive activation of the JAK-STAT pathway associated with JAK3^D842F/K935N. With increasing concentrations of tofacitinib, the phosphorylation of these factors in both the patient and control groups was progressively inhibited. However, due to limited sample availability, the visualization of patient samples in the tofacitinib inhibition experiments was suboptimal, limiting the ability to repeat the experiments. (B) One month after Tofacitinib treatment, the patient’s serum creatinine (Scr) and creatine kinase (CK) levels returned to normal. (C) After one year of treatment, the patient’s immune cell counts also returned to normal

Patient with JAK3 mutation showed response to JAK inhibition

The patient was initiated on tofacitinib (2.5 mg qd, 3.3 mg/m²/d), a JAK inhibitor, to suppress hyperactive JAK-STAT signaling caused by the JAK3 mutation. No additional immunosuppressive or immunomodulatory treatment was given. The first signs of recovery included regrowth of eyebrows and hair, relief from muscle pain, and improved exercise tolerance. After one month of treatment, his CK levels normalized, and blood creatinine returned to normal within three months. Over one year of therapy, the patient’s height increased by 7 cm (Figure S6), and total white blood cell counts, along with T and NK cell numbers, returned to normal (Fig. 3B and C). Although the proportion of CD38⁺HLA-DR⁺CD8⁺ T cells remained elevated, the frequency of PD-1⁺CD8⁺ T cells increased, suggesting a possible initiation of negative feedback regulation or the early onset of T cell exhaustion despite ongoing T cell activation (Table 1).

The patient contracted COVID-19 pneumonia during follow-up, requiring a one-month interruption of tofacitinib, after which hair loss and muscle pain recurred but improved again upon resuming therapy. He did not receive antimicrobial prophylaxis, and aside from the COVID-19 episode, no viral infections were observed and no viral PCR screening was performed.

Discussion

Harry et al. first reported germline JAK3 GOF mutations in 2020, describing two individuals from a non-consanguineous family who presented with NK cell lymphoproliferation, lymphadenopathy, splenomegaly, and autoimmune symptoms [3]. Here, we describe the third reported patient with a germline JAK3 mutation, carrying novel compound heterozygous variants in JAK3 (c.2524_2525delinsTT and c.2805G > C). The patient primarily presented with HIES-like features, including eczema, recurrent infections, and elevated IgE levels, along with multisystem autoimmune manifestations such as immune cytopenia, myositis, and thyroiditis, but without NK cell proliferation. Functional studies confirmed that these mutations led to hyperactivation of the JAK-STAT pathway, suggesting a complex role for JAK3 in type 2 inflammation and autoimmunity. Our findings expand the clinical spectrum of JAK3 mutations and, for the first time, link them to HIES and multiple autoimmune manifestations.

Elevated serum IgE is an important biomarker for IEIs, with approximately 20% of patients with monogenic IEI exhibiting HIES-related features and autoimmunity [5, 6, 7]. JAK-STAT signaling dysregulation has been well established as a key pathogenic mechanism in HIES, with STAT3 loss-of-function (LOF) mutations as the primary genetic cause [8, 9, 10]. However, the role of JAK3 in HIES remains unclear, with only one case report describing extreme hyper-IgE levels (> 50,000 IU/mL) in a patient with Omenn syndrome carrying the JAK3 R431P mutation [11]. In our patient, PBMC transcriptomic analysis revealed abnormally high MAF and TNFRSF4 expression in CCR7⁺ naïve CD4⁺ T cells, suggesting a shift toward Th2 differentiation and an imbalance in Th1/Th2 responses. Excessive Th2 activation can lead to IL-4 overproduction, a key driver of B cell IgE class switching and a potential mechanism that enhances IgE production [12, 13]. These findings identify JAK3 as a potential genetic cause of HIES, though additional cases are needed for validation.

JAK3 is essential for immune cell differentiation and function. Harry et al.³ reported that JAK3 GOF mutations can cause immune cytopenia. Our patient similarly exhibited lymphopenia, primarily affecting T and NK cells, along with T cell subset imbalance. In hyperinflammatory conditions such as HLH, HLA-DR and CD38 serve as markers of T cell activation [14]. The increased expression of HLA-DR+CD38 + CD8⁺ T cells in our patient indicates enhanced cytotoxic T cell activation. Single-cell sequencing further revealed elevated JAK3 expression in naïve T cells, along with upregulation of JUN and FOS—key components of the AP-1 transcription factor complex that regulate T cell activation, proliferation, and function [15]. Persistent JUN and FOS overexpression may initially drive excessive T cell activation. However, prolonged stimulation could lead to T cell exhaustion, with surviving T cells remaining in a hyperactivated state, ultimately contributing to autoimmunity [16].

Unlike previous JAK3 GOF cases that exhibited NK cell expansion, our patient presented with NK cell depletion. GO enrichment analysis revealed upregulation of intrinsic apoptotic pathway genes in NK cells, suggesting that mitochondrial-mediated apoptosis may contribute to NK cell loss, although the underlying mechanism remains unclear. However, the role of JAK3 in regulating cell proliferation is complex, and variations in JAK3 mutations and epigenetic modifications may result in diverse clinical and immunological phenotypes among patients [1, 17].

JAK3 primarily functions through cross-phosphorylation with JAK1. Animal studies suggest that JAK3 GOF mutations require constitutive JAK1 activation to drive STAT5 signaling. In JAK1-deficient cells, JAK3 GOF mutations fail to activate STAT5; however, co-expression with wild-type (WT) JAK1 restores this function [18, 19]. In our patient, the constitutive activation of both JAK1 and JAK3, along with downstream STAT phosphorylation, further confirmed the JAK3 GOF diagnosis. Given the critical role of JAK/STAT dysregulation in inborn errors of immunity (IEI), JAK inhibitors (JAKi) provide a targeted therapeutic option. Compared to hematopoietic stem cell transplantation (HSCT), which carries risks such as graft rejection and long-term immune dysfunction, JAKi offer superior tolerability and potential efficacy [20–22]. Marco et al. [23] reported that JAKi significantly improved overall health in patients with JAK/STAT pathway defects, with 87% of STAT1 GOF and 90% of STAT3 GOF cases benefiting, and no severe adverse events observed. Similarly, Feyza et al. [24] reported that ruxolitinib effectively controlled clinical manifestations in STAT3 GOF patients, leading to increased naïve CD4⁺ and CD8⁺ T cells, reduced effector memory T cells, and normalization of previously dysregulated PBMC transcriptomes, with sustained effects for up to 12 months. In our patient, we report the successful treatment of the JAK3 constitutive activation with tofacitinib, resulting in significant clinical improvement. These findings not only establish tofacitinib as a promising JAK1/JAK3 inhibitor for JAK3-associated immune dysregulation but also provide new insights into JAK-STAT pathway regulation, further supporting JAKi as a viable therapeutic strategy for IEI.

This study has several limitations. The patient’s vaccine-specific antibody titers were not assessed during the initial evaluation. Although clinical, immunological, and transcriptomic data indirectly support constitutive activation of the JAK-STAT pathway, no in vitro functional assays were performed to directly assess the activating potential of the D842F and K935N variants. The individual or combined contributions of these variants to JAK3 activation also remain undetermined. Furthermore, we did not obtain single-cell transcriptomic data after tofacitinib treatment, which could have provided valuable insights into treatment-induced molecular changes. In addition, the limited availability of patient samples restricted our ability to repeat certain experiments. Future studies are needed to address it through functional validation and post-treatment single-cell profiling.

In summary, we describe a patient with a novel compound heterozygous JAK3 mutation (c.2524_2525delinsTT/c.2805G > C) leading to constitutive activation of the JAK-STAT signaling pathway. The patient presented with HIES and autoimmunity and demonstrated a favorable response to tofacitinib treatment. Further investigation is required to elucidate the underlying pathogenic mechanisms.

Supplementary Information

Below is the link to the electronic supplementary material.

Author Contributions

Xiaoyun Jiang and Heying Pei conceived this research and designed an experiment together with Yuxin Pei. Yuxin Pei conducted the experiment with the assistance of Bei Jin, Reyila Abbas, Cheng Cheng, Hongjie Zhuang, Shuhan Zeng, Pei Heying, and others. Pei Yuxin and Jiang Mengjie provided clinical data. Pei Yuxin and Reyila Abbas wrote the manuscript, while Jiang Xiaoyun and Pei Heying revised the manuscript.

Funding

This work was supported by The National Key Research and Development Program of China（2022YFC2705100，2022YFC2705101）, National Natural Science Foundation of China（82003799，82502165），Guangdong Basic and Applied Basic Research Foundation （2021A1515110197）and Project supported by the KRT Plan of Guangdong Medical Development Foundation (No.K-20240123).

Data Availability

No datasets were generated or analysed during the current study.

Declarations

Ethics Approval

This study was approved by the Ethical Committee for Clinical Research and Animcal Trials of the First Affiliated Hospital of Sun Yat-sen University[(2021)137].

Consent for Publication

The authors have obtained consent to publish from the patient and his parents to report individual data.

Competing Interests

The authors declare no competing interests.