Nrf2 Protects Against Lipoteichoic Acid-Induced Acute Lung Injury By Suppressing SLC24A2-Mediated Ferroptosis

Abstract

Acute lung injury (ALI) is a severe inflammatory syndrome characterized by epithelial and endothelial injury, increased pulmonary vascular permeability, and impaired gas exchange. ALI often involves ferroptosis, an iron-dependent form of oxidative cell death. Nuclear factor erythroid 2-related factor 2 (NRF2) is a key regulator of antioxidant defenses, but its role in ALI-related ferroptosis is not well understood. In this study, NRF2 knockout (KO) mice were utilized for transcriptomic analysis to investigate the role of NRF2 in ALI. NRF2 deficiency significantly exacerbated lung injury and ferroptosis, and upregulated the expression of the calcium transporter gene solute carrier family 24 member 2 (SLC24A2). Calcium overload was closely associated with increased SLC24A2 expression and contributed to the development of ferroptosis. These findings were validated in vitro: knockdown of NRF2 in lung epithelial cells enhanced susceptibility to ferroptosis, whereas overexpression of NRF2 attenuated ferroptotic cell death. Conversely, silencing SLC24A2 reduced intracellular calcium overload and suppressed ferroptosis. These results suggest that there may be a regulatory axis between NRF2 and SLC24A2, which has a potential association with inflammation and ferroptosis signals related to acute lung injury (ALI). However, further studies are required to clarify the causal relationship and its consistency across different models, thereby evaluating the feasibility of this axis as a potential therapeutic target.

Graphical Abstract

Supplementary Information

The online version contains supplementary material available at 10.1007/s10753-026-02499-2.

Introduction

Acute lung injury (ALI) is a severe inflammatory syndrome characterized by epithelial and endothelial injury, increased pulmonary vascular permeability, and impaired gas exchange [1]. It is commonly associated with various etiologies, including bacterial infections, trauma, and aspiration [2]. The most severe form of ALI is acute respiratory distress syndrome (ARDS), which frequently follows gram-positive bacterial infection [3]. Lipoteichoic acid (LTA), a gram-positive bacterial cell-wall component, is a potent inducer of lung inflammation and is commonly used as a surrogate for gram-positive infection in lung injury studies [4]. LTA triggers a strong pro-inflammatory response in the lung by activating immune cells, releasing cytokines, and disrupting normal lung architecture [5, 6]. Understanding the molecular mechanisms underlying ALI is critical for improving lung function, reducing inflammation, and developing effective therapies for this condition.

Regulation of cell death is a key factor in ALI pathology. Ferroptosis—an iron-dependent form of regulated cell death driven by oxidative stress—has emerged as a critical mechanism in lung injury [7]. Ferroptosis can exacerbate inflammation and tissue damage in various conditions, including ALI [8]. Nuclear factor erythroid 2-related factor 2 (NRF2) is a master transcription factor that regulates antioxidant defenses by inducing antioxidant gene expression and maintaining redox balance [9]. NRF2 is generally considered protective: its activation has been shown to mitigate ferroptosis and prevent tissue damage in diverse disease models [10, 11]. For example, NRF2 activation reduces oxidative stress and ferroptotic cell death in neurodegeneration [12], ischemia-reperfusion injury [13], and other inflammatory diseases [14]. Overall, NRF2 regulates antioxidant and iron metabolism genes to exert anti-ferroptotic effects, making the NRF2 pathway a promising therapeutic target for ferroptosis-related diseases.

Solute Carrier Family 24 Member 2 (SLC24A2), also known as NCKX2, is a sodium/potassium/calcium exchanger that maintains intracellular calcium homeostasis [15]. Calcium overload, defined as an abnormal increase in intracellular Ca^2⁺ concentration, occurs in many diseases including neurodegenerative and cardiovascular disorders [16, 17]. Calcium overload is linked to ferroptosis: excessive intracellular Ca^2⁺ can activate calcium-dependent kinases that alter iron metabolism-related proteins, leading to iron accumulation [5, 18]. Additionally, calcium overload triggers oxidative stress pathways, increasing reactive oxygen species (ROS) and promoting lipid peroxidation, which is a hallmark of ferroptosis [19]. Thus, calcium dysregulation contributes to pathology through multiple mechanisms, and targeting calcium overload has been proposed as a therapeutic strategy.

This study investigated the role of NRF2 in LTA-induced ALI, with a focus on ferroptosis and the involvement of SLC24A2. Our data indicate that NRF2 protects against LTA-induced lung injury by downregulating SLC24A2, thereby inhibiting ferroptosis and inflammation. Specifically, NRF2 deficiency upregulated SLC24A2, which led to increased calcium influx, enhanced ferroptosis, and more severe tissue damage. These results identify a critical NRF2-SLC24A2 axis in ALI and provide a basis for targeting this pathway in therapeutic strategies.

Materials and Methods

Animals and Ethics

Male wild-type (WT) C57BL/6 mice (8 weeks old, 20–22 g) and age-/weight-matched NRF2-knockout (KO) mice were obtained from Jiangnan University (Wuxi, China) and the Model Animal Research Center (Nanjing, China), respectively. NRF2 deficiency was confirmed by PCR genotyping (Figure S3). To induce ALI, mice received an intratracheal injection of LTA (5 mg/kg); control mice received PBS. Six hours post-injection, mice were anesthetized with 2% isoflurane. Whole blood, serum, bronchoalveolar lavage fluid (BALF), and lung tissues were then collected. Blood was drawn from the posterior vena cava and allowed to clot for 30 min to obtain serum. BALF was collected by lung lavage, then centrifuged to separate cells and supernatant. Fresh lung tissue was either frozen at − 80 °C for molecular assays or fixed in 4% paraformaldehyde for histology.

Cell Culture and Treatment

Human bronchial epithelial BEAS-2B cells (ATCC) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin (Gibco; Cat. Nos. 16140071, 11965092) at 37 °C in 5% CO₂. Lipoteichoic acid (LTA) was dissolved at 5 mg in 500 µL ultrapure water. For gene expression and protein analysis, cells were treated with 20 µg/mL LTA for 4 h [20].

Lung Wet-to-Dry Ratio

The left lung lobe was excised and immediately weighed (wet weight). The tissue was then dried at 65 °C for 48 h and reweighed to obtain the dry weight. The lung wet-to-dry (W/D) weight ratio was calculated to assess pulmonary edema.

Histopathology and Lung Injury Score

Mouse lung specimens were fixed in 4% paraformaldehyde for 48 h and then embedded in paraffin (ASP200S and EG1150H; Leica). Paraffin blocks were cut into 4 μm thick sections on a microtome (RM2245; Leica) that were imaged under a pathology scanner (Pannoramic MIDI;3DHISTECH) after H&E staining. The lung injury score was assigned according to American Thoracic Society criteria based on examination of five randomly selected fields by two pathologists who were not involved in the study. The average score of the five random regions serves as the lung injury score for this mouse, and this score is represented by this slice.

BALF

After tracheotomy, mouse lungs were lavaged with sterile, ice-cold PBS. The collected BALF was centrifuged; the supernatant protein concentration was measured using a bicinchoninic acid (BCA) assay kit (Vazyme; Cat. No. E112-01). The cell pellet was resuspended, and total BALF cell counts were determined by flow cytometry (BD FACSCanto II).

Serum Biochemical Indicators

Collected blood was allowed to clot for 30 min at room temperature. Serum was separated by centrifugation (425×g for 10 min, then 2,000×g for 20 min) and stored at − 80 °C. Serum markers of lung injury and oxidative stress, lactate dehydrogenase (LDH; Cat. No. A020-2-2), malondialdehyde (MDA; Cat. No. A003-1–2), superoxide dismutase (SOD; Cat. No. A001-3-2), glutathione (GSH; Cat. No. A006-2-1), and myeloperoxidase (MPO; Cat. No. A044-1-1), were measured using commercial assay kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).

Transcriptome Sequencing

RNA sequencing was performed using the Illumina Novaseq 6000 platform, generating 150 bp paired-end reads. Raw reads in fastq format were processed using fastp to remove low-quality reads, yielding clean reads for downstream analysis. HISAT2 was used for reference genome alignment, and gene expression levels (FPKM) were calculated with HTSeq-count providing read counts for each gene. PCA analysis and plotting were performed using R (v3.2.0) to assess sample biological replicates. Differential expression analysis was conducted using DESeq2, with genes having q < 0.05 and fold change > 2 or < 0.5 defined as differentially expressed genes (DEGs). Hierarchical clustering of DEGs was performed using R to visualize expression patterns across groups and samples. The top 20 genes were visualized using heatmaps. Enrichment analysis of DEGs was conducted using hypergeometric distribution algorithms for GO, KEGG Pathway, Reactome, and Wiki Pathways, with significant terms visualized using bar charts, chord diagrams, or enrichment maps in R. Gene set enrichment analysis (GSEA) was performed using predefined gene sets to identify enrichment at the top or bottom of the ranked gene list.

RT-qPCR

Total RNA was extracted from lung tissue using TRIzon reagent (CWBIO, CW0580). cDNA synthesis was performed with the PrimeScript RT kit (Takara, RR047A), and quantitative PCR was carried out using SYBR Green Master Mix (Yeasen, 11198ES08) on a LightCycler 480 system (Roche). Gene expression levels were normalized to GAPDH, and relative expression was calculated by the 2^−ΔΔCt method. Reaction specificity was confirmed by dissociation curve analysis.

Western Blotting

Proteins were extracted from lung tissues or cells and quantified. Equal amounts of protein were separated by 10–12% SDS-PAGE and transferred to nitrocellulose membranes. Membranes were blocked and incubated overnight at 4 °C with primary antibodies (see Table S2) at 1:1000 dilution. After washing, blots were incubated with HRP-conjugated secondary antibodies for 1 h at room temperature. Protein bands were visualized using an enhanced chemiluminescence (ECL) kit (Vazyme, E412-01) and imaged (Bio-Rad Gel Imaging). Band intensities were quantified with ImageJ software after background subtraction, using β-actin as a loading control.

Immunofluorescence

Samples were fixed, permeabilized, and blocked according to standard protocols. Primary antibodies specific to the target proteins were applied overnight at 4 °C, followed by incubation with fluorophore-conjugated secondary antibodies. Nuclei were counterstained with DAPI. Fluorescence was visualized by confocal laser scanning microscopy at 40 × magnification and analyzed using ZEN2 (blue edition) software (Carl Zeiss).

Cell Viability Assay (CCK-8)

Cell viability was assessed using a Cell Counting Kit-8 (CCK-8; Cat. No. 40203ES76; Yeasen Biotechnology, Shanghai, China). BEAS-2B cells were seeded into 96-well plates at a density of 5 × 10³ cells per well and allowed to adhere overnight. For concentration-response experiments, cells were treated with LTA at indicated concentrations (0, 5, 10, 20, and 40 µg/mL). For ferroptosis rescue experiments, cells were pretreated with the ferroptosis inhibitor Ferrostatin-1 (Fer-1; Cat. No. HY-100579; MedChemExpress, USA) for 1 h prior to LTA stimulation. After treatment, 10 µL of CCK-8 reagent was added to each well and incubated at 37 °C for 2 h. Absorbance was measured at 450 nm, and cell viability was expressed as a percentage of the control group.

Plasmid Construction and Transfection

The plasmid pcDNA3.1(+)-Nrf2-3 × FLAG-P2A-EGFP, which includes the forward primer [CMV-F] with the sequence CGCAAATGGGCGGTAGGCGTG and the reverse primer [EGFPSEQR] with the sequence GACACGCTGAACTTGTGGC, was meticulously designed and constructed by OBiO Technology. For the transfection process, Beas-2B cells were seeded at a density of 5 × 10⁵ cells per well in six-well plates. Each well received a mixture of 2 µg of the aforementioned DNA and 5 µL of Liposomal Transfection Reagent (Yeasen; Cat. No: 40802ES02), following the manufacturer’s protocol. Additionally, the control vector H2713 pcDNA3.1(+) − 3 × FLAG-P2A-EGFP was also prepared for comparison.

Nrf2 and Slc24A2 SiRNA Transfection

To enhance gene silencing efficiency, a mixture of three different Nrf2 siRNAs was used: 5′-GCCACATCACAGAATCGTA-3′; 5′-GAACCCTGGCTACATCAAA-3′; 5′-CCAAGGACTTCAGCCTCAT-3′. Similarly, three Slc24A2 siRNAs were constructed and utilized to achieve effective knockdown: 5′-GCUGGAGGCUGGUAAUGAU-3′; 5′-GCAGGAUCAUCAUUAAUGA-3′; 5′-CGCUGUGGAUCGCUGUGUU-3′. The siRNAs were commercially synthesized (RiBobio). For negative controls, scrambled RNA oligonucleotides were used. For each well, 50 nM of each of the three oligos were transfected using Hieff Trans™ Liposomal Transfection Reagent (Yeasen, Cat. No: 40802ES02) according to the manufacturer’s instructions. After incubation for 15 min, the medium was replaced with DMEM containing 10% fetal bovine serum. Transfected cells were used for the subsequent experiments 48 h after transfection.

Dual-luciferase Reporter Assay

HEK-293T cells were seeded into 96-well plates at a density of 5 × 10³ cells per well and transfected with luciferase reporter plasmids containing the wild-type (wt) and mutant (mut) SLC24A2 promoters. The wt promoter served as a control to assess baseline activity, while the mut promoter was used to evaluate the impact of specific mutations. For transfection, the wt promoter was amplified using forward primer [RVprimer3] GGTACCGCAATTAATGTAATA and reverse primer [Luc2-N-Re] TGGCCCATAATAATTCTCGAG, and the mut promoter was amplified using forward primer [RVprimer3] CTATTCCCCATCGTGATACC and reverse primer [Luc2-N-Re] CGATGGCTGTCCCGAAGGCTG. After 48 h, luciferase activity was measured using a dual-luciferase reporter system (Yeasen Biotechnology, China), with Firefly Luciferase (Luc1) indicating promoter activity and Renilla Luciferase (Luc2) serving as an internal control for normalization.

FerroOrange Assay

BEAS-2B cells were transfected and/or treated with LTA (20 µg/mL, 4 h) as outlined in Sect. 2.2 to create the following experimental groups: NC, NC + LTA, Si-Nrf2, Si-Nrf2 + LTA, OE-Nrf2, OE-Nrf2 + LTA, and Si-Slc24a2 + LTA. Subsequently, cells (1 × 10⁵ cells/well) were seeded in fluorescence dishes and cultured overnight. After incubation with 1 µM FerroOrange (DOJINDO Laboratories, Cat. No: AB123) for 30 min at 37 °C, intracellular Fe²⁺ levels were visualized and measured using fluorescence microscopy (excitation 532 nm, emission 572 nm).

Measurement of Intracellular Ca²⁺Levels

Intracellular Ca²⁺ levels were measured using Fluo-4 AM (Cat. No. F312; Tongren Chemical, Japan). After experimental treatments, BEAS-2B cells were incubated with 5 µM Fluo-4 AM in serum-free medium containing 0.02% Pluronic F-127 at 37 °C for 30 min in the dark. Cells were then washed three times with Hank’s balanced salt solution and incubated for an additional 20 min to allow dye de-esterification. Fluorescence images were captured using a fluorescence microscope (excitation 488 nm, emission 515–535 nm). Mean fluorescence intensity was quantified using ImageJ software.

ROS Assay

Following the same experimental groupings and treatments as described in the FerroOrange assay (Sect. 2.15), cells were seeded in fluorescence dishes at 1 × 10⁵ cells/well and cultured overnight. The cells were then incubated with 10 µM DCFH-DA (Nanjing Jiancheng Bioengineering Institute, Cat. No: E004-1-1) for 30 min at 37 °C in the dark. After washing, ROS-positive cells were visualized and quantified under a fluorescence microscope (excitation 488 nm, emission 530 nm).

Reagents and Antibodies

LTA was purchased from Sigma–Aldrich (Cat. No: L2515). The Antibodies used in this study are listed in Table S2.

Statistical Analysis

Data are presented as mean ± standard deviation (SD) of at least three independent experiments. Statistical significance between groups was determined by Student’s t test or one-way ANOVA as appropriate, with p < 0.05 considered significant. All analyses were performed using GraphPad Prism 9.0 (GraphPad Software, San Diego, CA, USA) (Tables 1, 2 and 3).

Table 1.

Primer sequence of mouse qPCR

Name of protein	Gene names	Primer sequences
IL-1β	Il-1β	Forward: 5’- TCTATGATGCAAGCTATGGCTCA − 3’
		Reverse: 5’- CGGCTCTCCTTGAAGGTGA − 3’
IL-6	Il-6	Forward: 5’- ACTTCCATCCAGTTGCCTTCTTGG − 3’
		Reverse: 5’- TTAAGCCTCCGATTGTGAAGTG − 3’
IL-10	Il-10	Forward: 5’- CTTACTGACTGGCATGAGGATCA − 3’
		Reverse: 5’- GCAGCTCTAGGAGCATGTGG − 3’
TNF-α	Tnf-α	Forward: 5’- AGGTTCTCTTCAAGGGACAA − 3’
		Reverse: 5’- GACTTTCTCCTGGTATGAGATAG − 3’
Nrf2	Nrf2	Forward: 5’- AAAATCATTAACCTCCCTGTTGAT − 3’
		Reverse: 5’- CGGCGACTTTATTCTTACCTCTC − 3’
Slc24a2	Nckx2	Forward: 5’- CTGGAGGAGCGAAGGAAAGG − 3’
		Reverse: 5’- TGTGAAAGTTCTGGGGCTGAC − 3’
GAPDH	Gapdh	Forward: 5’- CCTCGTCCCGTAGACAAAATG-3’
		Reverse: 5’- TCTCCACTTTGCCACTGCAA-3’

Table 2.

Antibody information table

Antibody Name	Dilution	Application	Brand	Catalog #
NRF2	1: 2000	Western Blot	PROTEINTECH	16396-1-AP
SLC24A4	1: 2000 1: 200	Western Blot Immunofluorescence	PROTEINTECH	18992-1-AP
β-actin	1: 2000	Western Blot	PROTEINTECH	20536-1-AP
GPX4	1: 1000	Western Blot	PROTEINTECH	30388-1-AP
PTGS2	1: 1000	Western Blot	PROTEINTECH	12375-1-AP
FTH	1:1000	Western Blot	PROTEINTECH	11682-1-AP
XCT	1:1000	Western Blot	PROTEINTECH	26864-1-AP
ORAI1	1:1000	Western Blot	ZEN-BIO	R382034
TRPC1	1:1000	Western Blot	ZEN-BIO	R383032

Table 3.

Primer sequence of human qPCR

Name of protein	Gene names	Primer sequences
IL-1β	IL-1b	Forward: 5’- TGGTAGTAGCAACCAACGGGA − 3’
		Reverse: 5’- ACTTTGATTGAGGGCGTCATTC − 3’
IL-6	IL-6	Forward: 5’- ACTTCCATCCAGTTGCCTTCTTGG − 3’
		Reverse: 5’- TTAAGCCTCCGATTGTGAAGTG − 3’
IL-10	IL-10	Forward: 5’-GACTTTAAGGGTTACCTGGGTTG − 3’
		Reverse: 5’- TCACATGCGCCTTGATGTCTG − 3’
TNF-α	TNF-α	Forward: 5’- CCTCTCTCTAATCAGCCCTCTG − 3’
		Reverse: 5’- GAGGACCTGGGAGTAGATGAG − 3’
Nrf2	NRF2	Forward: 5’- TCAGCGACGGAAAGAGTATGA − 3’
		Reverse: 5’- CCACTGGTTTCTGACTGGATGT − 3’
Slc24a4	NCKX4	Forward: 5’- GTCTGGTAGCCATTAGCACTG − 3’
		Reverse: 5’- TGGGCGTGATCTGTACTATTCTC − 3’
GAPDH	GAPDH	Forward: 5’- CCTTCCGTGTTCCTACCC C-3’
		Reverse: 5’- CCCAAGATGCCCTTCAGT-3’

Results

LTA Induces Acute Lung Injury in Mice

We evaluated the effects of LTA on acute lung injury (ALI) using a C57BL/6 mouse model. Histopathological examination by H&E staining revealed marked alveolar edema, structural disruption, and inflammatory cell infiltration in the lungs of LTA-treated mice compared with controls (Fig. 1A). Consistently, lung injury scores were significantly elevated following LTA exposure (Fig. 1B). The lung wet-to-dry weight ratio was also increased in the LTA group, indicating pulmonary edema (Fig. 1C).Markers of alveolar–capillary barrier disruption were further assessed. Protein concentration (Fig. 1D) and total cell counts (Fig. 1E) in bronchoalveolar lavage fluid (BALF) were both significantly increased in LTA-treated mice. In serum, oxidative stress–related indicators, including malondialdehyde (MDA), myeloperoxidase (MPO), and lactate dehydrogenase (LDH), were markedly elevated, whereas superoxide dismutase (SOD) activity was reduced (Fig. 1F–I). Inflammatory responses were further confirmed at the transcriptional level. RT-qPCR analysis showed significant upregulation of IL-1β, IL-6, IL-10, and TNF-α mRNA expression in lung tissues from LTA-treated mice (Fig. 1J–M). NRF2 mRNA expression was increased following LTA challenge (Fig. 1N). In addition, NRF2 protein expression in lung tissues was evaluated by Western blotting and densitometric analysis (Fig. 1O–P), providing protein-level confirmation of NRF2 regulation during LTA-induced ALI. Collectively, these results show that LTA exposure is associated with histological injury, oxidative stress, and an inflammatory response in this mouse model of ALI, but causal links and generalizability need further validation.

Fig. 1.

LTA Induces Acute Lung Injury in Mice. (A) Histological analysis of lung tissue showing edema, necrosis, and inflammatory infiltration using H&E staining (magnification, ×100, bar = 100 μm; n = 6). (B) Lung injury scores were assessed based on histological analysis. (C) Lung wet-to-dry weight ratio was calculated. (D) Protein concentration in BALF was determined . (E) Total cell counts in BALF were measured. (F–I) MDA, MPO, LDH, and SOD activities were quantified in lung tissues. (J-M) RT-qPCR was used to measure the mRNA levels of IL-1, IL-6, IL-10, and TNF-α. (N) Nrf2 mRNA expression was analyzed by RT-qPCR. (O–P) NRF2 protein expression in lung tissues determined by Western blot analysis and densitometric quantification.Experiments were repeated at least three times. *p < 0.05, **p < 0.01, ***p < 0.001

Nrf2 Deletion Exacerbates LTA-Induced Acute Lung Injury in Mice

Lungs from Nrf2 KO mice showed markedly worse pathology (increased inflammatory infiltration, alveolar hemorrhage, and edema; Fig. 2A). This was reflected quantitatively: Nrf2 KO mice had higher lung injury scores than WT (Fig. 2B). The lung W/D ratio was not significantly different between genotypes (Fig. 2C), but Nrf2 KO mice had elevated BALF protein (Fig. 2D) and cell counts (Fig. 2E), indicating greater alveolar-capillary barrier breakdown and inflammation. In serum, Nrf2 KO mice showed higher LDH and MPO levels and lower SOD activity compared to WT (Fig. 2F-H). At the mRNA level, lung IL-1β, IL-6 and TNF-α were upregulated and IL-10 was downregulated in KO mice (Fig. 2I-L), indicating a stronger pro-inflammatory response. In summary, NRF2 deficiency appeared to exacerbate several features of LTA-induced ALI in this mouse model, including worsened histopathology, enhanced oxidative stress, and altered inflammatory cytokine expression, suggesting a potential protective role for NRF2 that warrants further mechanistic investigation. To facilitate direct comparison between genotypes under identical experimental conditions, WT control and WT + LTA data shown in Fig. 2 were analyzed together with Nrf2 knockout groups from independent experimental repeats.

Fig. 2.

Nrf2 Knockout Exacerbates LTA-Induced Acute Lung Injury in Mice. (A) Histological changes in lung tissues assessed by H&E staining (magnification, ×100, bar = 50 μm; n = 6). (B–E) Lung injury scores，lung wet-to-dry weight ratio, ,total BALF cell counts and Protein concentration in BALF were measured. (F–H) LDH, MPO, and SOD activities were determined in serum. (I-L) mRNA levels of IL-1, IL-6, TNF-α, and IL-10 were measured by RT-qPCR. WT control and WT + LTA groups were derived from the same experimental cohort as those shown in Figure 1. Quantitative analyses were performed together with Nrf2 knockout groups in independent experimental repeats to allow direct comparison between genotypes. Experiments were repeated at least three times. *p < 0.05, **p < 0.01, ***p < 0.001

Nrf2 Deletion Increases Slc24a2 Expression and Exacerbates Calcium Overload and Ferroptosis in LTA-Induced Acute Lung Injury

To explore the molecular mechanisms underlying NRF2-mediated protection, transcriptomic profiling was performed. Differential expression analysis revealed significant upregulation of several genes in LTA-treated Nrf2 KO lungs, among which SLC24A2 was prominently increased (Fig. 3A). Immunofluorescence staining further confirmed enhanced SLC24A2 protein expression in lung tissues from Nrf2 KO mice (Fig. 3B–C). Western blot analysis demonstrated increased protein levels of SLC24A2 and the calcium-entry channel TRPC1 in KO lungs compared with WT controls (Fig. 3D), which was further validated by densitometric quantification (Fig. 3E–F).To investigate the transcriptional regulation of SLC24A2, a dual-luciferase reporter assay was performed, showing that NRF2 negatively regulates SLC24A2 promoter activity (Fig. 3G). KEGG pathway enrichment analysis revealed significant activation of ferroptosis-related pathways in Nrf2-deficient lungs (Fig. 3H). In addition, supplementary transcriptomic analyses demonstrated downregulation of several ferroptosis-defense genes, including Fth1, Slc40a1, Gss, and Gclm (Supplementary Figure S1).Biochemical assays further supported enhanced ferroptotic stress in Nrf2 KO mice, as reflected by increased serum MDA levels and elevated lung ferrous iron (Fe²⁺), whereas glutathione (GSH) levels showed no significant difference (Fig. 3I–K). Together, these data suggest that Nrf2 deletion may contribute to SLC24A2 upregulation, calcium dysregulation, and ferroptosis, which may in turn be associated with the exacerbation of LTA-induced ALI.

Fig. 3.

Nrf2 Deletion Increases Slc24a2 Expression and Exacerbates Calcium Overload and Ferroptosis in LTA-Induced Acute Lung Injury. (A) Heatmap of differential gene expression in Nrf2 KO vs. WT mice. (B, C) Immunofluorescence of SLC24A2 in lung tissues (×40, bar = 25 μm).(D) Western blot of SLC24A2 and TRPC1 proteins. (E-F) Quantification of Western blot results. (G) Luciferase assay for Nrf2 regulation of Slc24a2. (H) KEGG pathway analysis of ferroptosis pathways. (I-K) Biochemical assays of serum MDA, intracellular iron, and serum GSH levels.Experiments repeated ≥3 times. *p < 0.05, **p < 0.01, ***p < 0.001

Knockdown of Nrf2 in LTA-treated BEAS-2B Cells Promotes Slc24a2 Expression and exacerbates Calcium Overload and Ferroptosis

The role of NRF2 was further examined in vitro using BEAS-2B bronchial epithelial cells. Cell viability assays demonstrated that LTA reduced BEAS-2B cell viability in a concentration-dependent manner, supporting the selection of experimental LTA conditions (Fig. 4A). Efficient knockdown of Nrf2 by siRNA was confirmed by RT-qPCR (Fig. 4B and Supplementary Figure S2A).Nrf2 silencing significantly enhanced inflammatory signaling, as evidenced by increased IL-1β and TNF-α mRNA levels, whereas IL-10 expression remained unchanged (Fig. 4C–E). Concurrently, SLC24A2 mRNA expression was markedly increased following Nrf2 knockdown (Fig. 4F), which was further validated at the protein level by immunofluorescence staining and quantitative analysis (Fig. 4G–H).Calcium homeostasis was also disrupted. Western blot analysis showed increased ORAI1 expression, while TRPC1 levels remained unchanged following Nrf2 knockdown (Fig. 4I–K). Importantly, direct measurement of intracellular Ca²⁺ using Fluo-4 AM staining revealed significantly elevated Ca²⁺ signals in Nrf2-deficient cells (Fig. 4L), providing direct evidence of calcium overload.

Fig. 4.

Nrf2 knockdown upregulates SLC24A2 and exacerbates calcium overload in BEAS-2B cells. (A) Cell viability of BEAS-2B cells following treatment with increasing concentrations of LTA. (B) Validation of Nrf2 knockdown efficiency by siRNA transfection. (C–E) RT-qPCR analysis of mRNA levels of IL-1β, TNF-α, and IL-10. (F) RT-qPCR analysis of SLC24A2 mRNA expression. (G–H) Immunofluorescence staining and quantitative analysis of SLC24A2 expression in BEAS-2B cells (40×, scale bar = 25 μm). (I–K) Western blot analysis and densitometric quantification of ORAI1 and TRPC1 protein expression. (L) Intracellular Ca²⁺ levels were assessed using Fluo-4 AM fluorescence staining to evaluate calcium overload in BEAS-2B cells (10×, scale bar = 100 μm).All experiments were repeated at least three times. Data are presented as mean ± SD.*p < 0.05, **p < 0.01, ***p < 0.001

Ferroptosis-related changes were further observed. Nrf2 knockdown increased PTGS2 expression and reduced GPX4 and FTH1 protein levels (Fig. 5A–B). Consistently, intracellular reactive oxygen species (ROS) and labile Fe²⁺ levels were elevated, as detected by DCFH-DA and FerroOrange fluorescence, respectively (Fig. 5C–D). Biochemical assays confirmed decreased GSH and increased Fe²⁺ content (Fig. 5E–F). These findings suggest that loss of Nrf2 may promote SLC24A2-associated calcium overload and ferroptosis in LTA-treated epithelial cells.

Fig. 5.

Knockdown of Nrf2 in BEAS-2B Cells Promotes Ferroptosis. (A, B) Western blot analysis and quantification of ferroptosis-related proteins PTGS2, GPX4, and FTH. (C, D) FerroOrange (40×, scale bar = 25 μm) and ROS (20×, scale bar = 50 μm) fluorescence in Nrf2 knockdown cells. (E, F) Biochemical assays of intracellular GSH and ferrous iron levels.Experiments repeated at least 3 times. *p < 0.05, **p < 0.01, ***p < 0.001

Nrf2 Overexpression Reduces SLC24A2 Expression and Alleviates Calcium Overload and Ferroptosis in BEAS-2B Cells

In contrast, overexpressing Nrf2 in BEAS-2B cells had protective effects. Forced Nrf2 expression (Fig. 6A, S2B) dampened inflammatory signaling: IL-1β mRNA decreased and IL-10 increased, while TNF-α was unchanged (Fig. 6B–D). Nrf2 overexpression also lowered SLC24A2 mRNA and protein levels (Fig. 6E–G). Consistently, the Ca²⁺ entry channel ORAI1 was reduced (Fig. 6H). TRPC1 expression showed a decreasing trend in the OE-Nrf2 + LTA group compared with the NC + LTA group, although the difference did not reach statistical significance (Fig. 6I). These results suggest that Nrf2 overexpression alleviates Ca²⁺ overload. Ferroptosis markers reflected these changes: PTGS2 protein was downregulated, and the protective proteins FTH1 and xCT were upregulated, while GPX4 was unchanged (Fig. 7A-B). Fluorescent probes showed decreased ROS and labile Fe²⁺ levels in Nrf2-overexpressing cells (Fig. 7C-D). Intracellular Fe²⁺ decreased and GSH levels remained steady (Fig. 7E-F). Our findings suggest that Nrf2 overexpression is associated with reduced SLC242 expression, attenuated Ca²⁺ accumulation, and decreased ferroptosis markers, along with a concomitant reduction in pro-inflammatory mediators.

Fig. 6.

Overexpression of Nrf2 in BEAS-2B cells inhibits the expression of Slc24a2 and alleviates calcium overload. (A) Validation of Nrf2 overexpression. (B-D) RT-qPCR analysis of mRNA levels of IL-1β, IL-10, and TNF-α. (E) RT-qPCR analysis of SLC24A2 mRNA expression. (F, G) Immunofluorescence and quantification of SLC24A2 expression (×40, bar = 25 μm). (H-I) Western blot analysis and quantification of calcium overload markers TRPC1 and ORAI1.(J) Intracellular Ca²⁺ levels were assessed using Fluo-4 AM fluorescence staining to evaluate calcium overload in BEAS-2B cells (scale bar = 100 μm).Experiments were repeated at least three times. *p< 0.05, **p < 0.01, ***p < 0.001

Fig. 7.

Overexpression of Nrf2 in BEAS-2B Cells Mitigates Ferroptosis. (A, B) Western blot analysis and quantification of ferroptosis-related proteins PTGS2, FTH, XCT, and GPX4. (C, D) FerroOrange (40×, scale bar = 25 μm) and ROS (20×, scale bar = 50 μm) fluorescence in Nrf2 overexpression cells. (E, F) Biochemical assays of intracellular ferrous iron and GSH levels. Experiments were repeated at least three times. *p < 0.05, **p < 0.01, ***p < 0.001

Ferroptosis markers were also favorably modulated: PTGS2 was downregulated, FTH1 and xCT were upregulated, and GPX4 levels remained stable (Fig. 7A–B). Reduced ROS and Fe²⁺ accumulation were confirmed by fluorescence assays (Fig. 7C–D), with biochemical analysis showing decreased Fe²⁺ levels and preserved GSH content (Fig. 7E–F). These results suggest that Nrf2 overexpression may alleviate calcium overload and ferroptosis by inhibiting SLC24A2.

Knockdown of SLC24A2 Mitigates Calcium Overload and Ferroptosis in BEAS-2B Cells

Finally, we directly assessed the functional role of SLC24A2. Treatment with the ferroptosis inhibitor Ferrostatin-1 (Fer-1) significantly improved cell viability in LTA-treated BEAS-2B cells (Fig. 8A). Two independent SLC24A2-targeting siRNAs effectively reduced SLC24A2 mRNA expression (Fig. 8B). SLC24A2 knockdown markedly decreased ORAI1 and TRPC1 protein levels compared with control conditions (Fig. 8C–D), indicating reduced calcium influx.Direct assessment of intracellular Ca²⁺ using Fluo-4 AM staining confirmed that SLC24A2 silencing significantly alleviated calcium overload in LTA-treated cells (Fig. 8E). Ferroptosis-related protein analysis showed reduced PTGS2 expression and increased GPX4 and FTH1 levels, while xCT expression remained unchanged (Fig. 8F–G). Moreover, intracellular Fe²⁺ accumulation and ROS production were significantly attenuated, as evidenced by FerroOrange and DCFH-DA fluorescence (Fig. 8H–I). Together, these findings suggest that SLC24A2 may act as a key mediator of calcium overload and ferroptosis downstream of NRF2 in LTA-induced epithelial injury.

Fig. 8.

Knockdown of SLC24A2 Mitigates Calcium Overload and Ferroptosis in BEAS-2B Cells. (A) Effects of Ferrostatin-1 treatment on cell viability in BEAS-2B cells. (B) RT-qPCR analysis of SLC24A2 mRNA levels in BEAS-2B cells transfected with different SLC24A2 siRNA sequences. (C, D) Western blot analysis and densitometric quantification of calcium overload–related proteins TRPC1 and ORAI1. (E) Intracellular Ca²⁺ levels were evaluated by Fluo-4 AM fluorescence staining to assess calcium overload in BEAS-2B cells (10×, scale bar = 100 μm).(F, G) Western blot analysis and quantification of ferroptosis-related proteins PTGS2, GPX4, FTH, and XCT. (H-I)FerroOrange (40×, scale bar = 25 μm) and ROS (20×, scale bar = 50 μm) fluorescence. Experiments were repeated at least three times. *p < 0.05, **p< 0.01, ***p < 0.001

Discussion

In this study, we investigated the role of NRF2 in LTA–induced acute lung injury and explored links between NRF2, calcium homeostasis and ferroptosis. Our in vivo data show that NRF2 deficiency was associated with worse histopathology, increased markers of oxidative stress and a stronger pro-inflammatory transcriptional response after LTA challenge. Transcriptomic profiling identified upregulation of the calcium transporter gene SLC24A2 in Nrf2-deficient lungs, and biochemical and imaging assays indicated increased labile iron, ROS and calcium signals consistent with enhanced ferroptotic stress. In vitro, knockdown of NRF2 in bronchial epithelial cells increased SLC24A2 expression, intracellular Ca²⁺ and ferroptosis-related changes, whereas NRF2 overexpression produced opposite effects; conversely, silencing SLC24A2 reduced calcium accumulation and attenuated ferroptotic markers. Together, these results suggest a potential NRF2–SLC24A2 axis that is associated with calcium dysregulation and ferroptosis in LTA-induced ALI.

Nrf2 as a Regulator of Ferroptosis and Inflammation in ALI

Recent studies have demonstrated that Nrf2 plays a crucial role in the development and progression of ferroptosis [20–22]. As a key transcription factor, Nrf2 regulates the expression of antioxidant genes to counteract oxidative stress and ferroptosis [10]. By binding to the antioxidant response element (ARE), Nrf2 activates the expression of a series of antioxidant enzymes, such as GPX4, which play important roles in the ferroptosis pathway [23]. GPX4 relies on the presence of GSH to reduce peroxidized phospholipids in the cell membrane, converting lipid peroxides into non-toxic alcohols, thereby inhibiting ferroptosis [24, 25]. Additionally, Nrf2 influences intracellular iron levels by regulating the expression of iron metabolism-related proteins, which in turn inhibits ferroptosis [26, 27]. In this study, we observed that in LTA-induced ALI cells, Nrf2 knockdown significantly increased the levels of ferroptosis markers (such as PTGS2) and decreased the levels of ferroptosis-protective proteins (such as GPX4 and FTH). These results suggest that under LTA-induced inflammatory conditions, Nrf2 deficiency is associated with enhanced ferroptotic features, possibly through alterations in iron homeostasis and lipid redox balance. The mechanism may involve the regulation of iron metabolism and lipid peroxidation pathways by Nrf2. Inflammation induced by LTA may further amplify the iron homeostasis disruption caused by Nrf2 deficiency, thereby promoting ferroptosis. Our findings support the notion that under specific pathological conditions such as LTA-induced inflammation, Nrf2 deficiency may promote ferroptosis and tissue damage by disrupting iron and lipid metabolism.

SLC24A2 and Calcium Signaling in Ferroptosis-Associated ALI

SLC24A2 is a sodium/potassium/calcium exchanger that mediates the efflux of intracellular calcium ions by exchanging four sodium ions, thereby maintaining intracellular calcium homeostasis. Calcium overload is closely related to SLC24A2 and is characterized by an abnormal increase in intracellular calcium ion concentration [28], which can lead to mitochondrial dysfunction, activation of calcium-dependent proteases, increased generation of ROS, and disruption of the cytoskeleton, ultimately causing cell death and inflammatory responses [28]. Calcium overload is a key factor in neuronal death during cerebral ischemia-reperfusion injury and is also associated with ferroptosis through various mechanisms, including the activation of calcium-dependent protein kinases, promotion of iron ion accumulation, and lipid peroxidation [29, 30]. In this study, we found that knockdown of SLC24A2 in LTA-induced ALI cells significantly alleviated calcium overload and ferroptosis. This was evidenced by reduced expression of calcium overload markers (TRPC1 and ORAI1), decreased levels of ferroptosis markers (such as PTGS2), and lower intracellular iron and ROS levels, which in turn led to reduced lipid peroxidation. Although SLC24A2 is classically considered a Na⁺/Ca²⁺ exchanger involved in calcium extrusion under physiological conditions, its functional role may shift under pathological stress. NCKX transporters can operate in a reverse mode when cellular energy metabolism is impaired, potentially contributing to intracellular Ca²⁺ accumulation [31]. In the context of LTA-induced injury, we observed that SLC24A2 upregulation was consistently associated with increased expression of calcium influx–related proteins, elevated intracellular Ca²⁺ levels, and enhanced ferroptotic stress. While the precise transport dynamics of SLC24A2 under inflammatory conditions require further investigation, our transcriptomic, molecular, and functional data collectively suggest that SLC24A2 may participate in linking calcium dysregulation to ferroptosis in ALI.

Implications for Therapeutic Targeting and Future Directions

Although transcriptomic analysis suggested that SLC24A2 may be regulated by NRF2, its causal role has so far been validated only in vitro, with in vivo studies remaining to be explored. In summary, this study suggests a potential protective role of NRF2 signaling that may involve SLC24A2 in LTA-induced ALI. Our findings suggest that NRF2 may protect against ferroptosis and inflammatory injury, possibly in association with reduced SLC24A2 expression. In contrast, loss of NRF2 leads to SLC24A2 upregulation, Ca²⁺ overload, intensified ferroptosis, and aggravated inflammation. These findings highlight a potential role of NRF2-associated regulation of SLC24A2 in maintaining calcium homeostasis, and suggest that targeting this axis may represent a promising therapeutic strategy for ALI.

Nevertheless, several limitations of this study should be acknowledged. Although our data suggest a potential regulatory relationship between NRF2 and SLC24A2 in LTA-induced ferroptosis during acute lung injury, the precise transcriptional regulatory mechanisms and downstream signaling pathways were not fully delineated. In particular, chromatin immunoprecipitation–based assays to directly confirm NRF2 binding to the SLC24A2 promoter, as well as ultrastructural characterization of ferroptosis by transmission electron microscopy, were not performed in the present study. In addition, although calcium overload was demonstrated in vitro, dynamic real-time calcium imaging and in vivo validation of calcium dysregulation were beyond the scope of this work. Finally, this study focused on an LTA-induced model of acute lung injury, and whether the NRF2–SLC24A2–ferroptosis axis is conserved across other etiologies of lung injury or inflammatory diseases remains to be determined. These limitations highlight important directions for future investigations to further elucidate the mechanistic and translational relevance of this pathway.

Supplementary Information

Below is the link to the electronic supplementary material.

Author Contributions

Ri-Xiang Huang: Writing – original draft, Writing – review & editing, Data curation. Tao Lu: Writing – original draft, Writing – review & editing, Data curation. Nan-Nan Liu: Resources, Technical support. Jiao-Jiao Sun: Resources, Technical support. Min Chen: Resources, Technical support. Jun Zhu: Resources, Technical support. Dan Chen: Resources, Technical support. Ya-Xian Wu: Resources, Technical support.Yuan Weng: Supervision, Project administration, Writing – review & editing. Zhi-Qiang Wang: Supervision, Project administration, Writing – review & editing, Funding acquisition, Conceptualization. All authors read and approved the final manuscript.

Funding

This work was supported in part by grants from the Wuxi Health Commission Scientific Research Project (No.Z202424).

Data Availability

No datasets were generated or analysed during the current study.

Declarations

Ethics Approval and Consent to Participate

The content of this manuscript involving animal research were approved by the Jiangnan University Animal Ethics Committee (No. JN.No20241215m0400601).

Consent for Publication

Not applicable.

Competing interests

The authors declare no competing interests.

Clinical Trial Number

Not applicable.