ADAM19 participated in peritoneal fibrosis by regulating M2 macrophage polarization in peritoneal dialysis patients

Abstract

Peritoneal fibrosis, driven by M2 macrophage polarization, limits the long-term application of peritoneal dialysis (PD). Although ADAM19 is known to mediate fibrosis in other organs, its specific role in PD-associated peritoneal fibrosis remains unclear. PD patients were enrolled in a single center and divided into three groups depending on the PD time. Demographic and clinical data were collected. We detected the expressions of ADAM19, Notch1, Fibrosis-associated protein, chemokines and inflammatory factors in the peritoneum dialysis effluent by real-time PCR and western-blot assays. Macrophages were identified through flow cytometry. Then we analysis the relationship between ADAM19 and clinical data in PD patients. Furthermore, we established mouse models for peritoneal fibrosis to verify the biological function of ADAM19 in regulating macrophage polarization. In the long-term group, the fibrotic proteins (Fibronectin, α-SMA) and inflammatory factors (IL-6, IL-10) and chemokines (CCL5, CCL2, CXCL16) were higher than short-term group and more macrophages polarized towards M2. ADAM19 expression was linearly correlated with dialysis time and Kt/v. The AUROC of ADAM19 was 0.738 to identify the predictive value for peritoneal dialysis adequacy. The cut-off of ADAM19 RNA level was 7.84. In logistic regression models, higher ADAM19 (≥ 7.84) was also independently associated with lower Kt/v (< 1.67). Additionally, the results revealed a moderate increment of M1 macrophage (CD86+) and enormous rise of M2 macrophage (CD206+) with high-glucose dialysis fluid in mice model. Furthermore, the 8-week G4.25% group showed significant growth of M2 macrophage compared to the 4-week G4.25% group, indicating that prolonged dialysis duration has a more pronounced effect on promoting M2 polarization of macrophages via ADAM19/Notch1 signaling pathway. Through stimulating chemokines and inflammatory factors, ADAM19 regulated macrophage polarization and was correlated to the progression of peritoneal fibrosis. ADAM19 is expected to be a novel indicator for detecting peritoneal ultrafiltration function in PD patients.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-026-51347-8.

Introduction

An estimated 3.8 million people worldwide currently rely on some form of dialysis for treatment of end-stage renal disease (ESRD)¹. And that number is growing every year. Nearly 15% of these patients are treated with peritoneal dialysis (PD), PD has a series of advantages: home-based and thus cost-saving, allowing a superior quality of life, it preserves better the residual renal function. It achieves outcomes similar to those of hemodialysis patients if the peritoneal dialysis is adequate².

However, the loss of peritoneal function and ultrafiltration failure caused by peritoneal fibrosis limit the application of PD³, especially among the patients with long range PD. There is no effective targeted treatment for progressive peritoneal fibrosis and no effective means of prevention, as the exact mechanism of peritoneal fibrosis remains incompletely elucidated and needs further investigation. In addition to the biochemical changes of uremia itself and the effects of peritonitis, the unphysiological PD solutions is responsible for the loss of mesothelial cells, the development of inflammation, angiogenesis and epithelial-to-mesenchymal transition (EMT)^4,5. Injured peritoneal mesothelial cells may trigger a cascade of cellular responses via various intercellular communications with macrophages, endothelial cells, and fibroblasts^6,7. Inappropriate or excessive activation of macrophages is an important factor leading to peritoneal pathological changes. However, the mechanism of human peritoneal macrophages in peritoneal fibrosis is still lacking.

A disintegrin and metalloproteinases (ADAMs) are a new gene family of proteins with sequence similarity to the reprolysin family of snake venomases that share the metalloproteinase domain with matrix metalloproteinases. ADAM19 is a metal matrix enzymolysis integrin, which mediates fibrosis by increasing macrophage infiltration via the Notch1/CCL2 pathway⁸. Abnormal high expression of ADAM19 was found in a variety of solid tumors and organ fibrosis lesions, including almost all renal diseases⁹. Despite this observation, the roles of ADAM19 in peritoneal fibrosis induced by macrophage activation need further study.

Materials and methods

Patients

This is a single center observational study included 195 patients who underwent PD and received regular follow-up at Hangzhou TCM Hospital Affiliated to Zhejiang Chinese Medical University from January to June in 2023. The exclusion criteria were as follows: received PD less than 3 months (20), patients received HD combined with PD treatment (8). patients received immunosuppressive or antibiotic therapy within 3 months (7); Patients underwent peritonitis episodes within 3months (10), patients without detailed follow-up data available (72). After exclusions, finally 78 patients who met the eligibility criteria were enrolled into our study (Study flowchart presented in Fig. 1). Ethical approval for this study was granted by the Ethics Committee of Hangzhou TCM Hospital Affiliated to Zhejiang Chinese Medical University (Approval No. 2023KLL059). The Ethics Committee of our hospital approved this study, which was conducted according to the ethical principles of the Helsinki Declaration. Written informed consent was obtained from all the study participants.

Fig. 1.

Flow diagram of the study population selection.

Clinical data

Demographics (sex, age, body mass index (BMI), history of peritonitis and diabetes, duration of PD and clinical data [white blood cell (WBC), hemoglobin (HB), Platelets (PLT), calcium (Ca), phosphorus (P), high sensitivity C-reactive protein (Hs-CRP), glucose, albumin], dialysis regimen, peritoneal equilibration test (PET)and Kt/v.

Sample collection and processing

After collecting the PD fluid from each patient, the samples were immediately stored at 4 °C and centrifuged as soon as possible to harvest the cells. This rapid processing workflow helped to maximize cell yield and maintain cell viability. Specifically, PD fluid from individual patients was centrifuged at 500 relative centrifuge force (RCF) for 10 min at 4 °C to separate cells from supernatant. Half of the harvested cell pellets were then washed with sterile PBS and immediately resuspended and thawed on ice immediately for flow cytometry. Meanwhile, the remaining cells were immediately stored at − 80 °C to avoid repeated freezing and thawing for the follow-up PCR and Western blot analysis.

Establishment of the peritoneal fibrosis mouse model

All mice were fed in the Laboratory Animal Center of Zhejiang Chinese Medical University and maintained under standard specific pathogen-free (SPF) conditions. To establish a widely recognized mouse model of peritoneal fibrosis, C57BL/6 mice were intraperitoneally injected with different concentrations of high-glucose dialysis fluid (G2.5% and G4.25% solutions, based on normal saline) to induce fibrotic changes in peritonaeum. The negative control mice were intraperitoneally injected with an equal volume of saline solution. The low-glucose group mice (G2.5%) received continuous injections for 4 weeks, while the high-glucose group mice (G4.25%) received injections for 4 and 8 weeks, respectively. After the experiment, all mice were initially anesthetized and sacrificed by a deep anesthesia with a high concentration of isoflurane (5%), and then rapidly euthanized by cervical dislocation to minimize suffering. And parietal peritoneal tissue and peritoneal fluid were collected as fast as possible. All experimental protocols were approved by the Institutional Animal Care and Use Committee of Zhejiang Chinese Medical University (Approval No.: IACUC-20250414-21). All methods were carried out in accordance with relevant guidelines and regulations, and were performed in accordance with the relevant guidelines and regulations, and are reported in compliance with the Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines (https://arriveguidelines.org).

RNA extraction and RT-qPCR

Collect the overnight peritoneal dialysis fluid of the patients, cells which were mainly mesothelial cells and mono-nuclear cells were immediately isolated from the PD solutions at 500 relative centrifuge force (RCF) at 4 °C for 10 min. RNA from the collected cells of different groups were extracted using Trizol Reagent (Accurate Biology) following the manufacturer’s instruction. Complementary DNA (cDNA) from 2 µg total RNA was synthesized using HiScript II Q RT SuperMix for qPCR (+ gDNA wiper) (Vazyme). The amplification reaction volume was 20 µL containing 10 µL ChamQ Universial SYBR qPCR Master Mix (Vazyme), 0.1 µL cDNA and corresponding forward-primers and reversed-primers. The relative expression levels of each examined gene were determined in triplicates. Amplification procedure was 95 °C for 3 min, followed by 39 cycles at 95 °C for 30 s, 60 °C for 45 s, finally 72 °C for 10 min. The relative expression levels of target genes were calculated using the 2^−ΔΔCt method. The endogenous housekeeping gene β-actin was used for normalization. The following primers were used respectively:

	Forward-primers	Reversed-primers
ADAM19	ttcccaggacttctccaggc	aatcatccctccagccctct
Notch1	ggattgcagtcgtccacgttga	ggtgaactgctctgaggagatc
IL-6	tgcaataaccacccctgacc	atttgccgaagagccctcag
IL-10	tcaaggcgcatgtgaactcc	gatgtcaaactcactcatggct
CCL2	cagccagatgcaatcaatgcc	tggaatcctgaacccacttct
CCL5	cctgctgctttgcctacattgc	acacacttggcggttctttcgg
CXCL16	cctatgtgctgtgcaagaggag	ctgggcaacatagagtccgtct
β-actin	agcgagcatcccccaaagtt	gggcacgaaggctcatcatt

Western blotting assay

Cells were harvested and fully lysed in RIPA lysis buffer (Beyotime Biotechnology) supplemented with Protease inhibitor (Beyotime Biotechnology), phosphatase inhibitor mixture (Beyotime Biotechnology) and PMSF (Macklin). Total protein was extracted from the samples and determined by BCA protein concentration assay kit (Beyotime Biotechnology). The same amount of protein was separated by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF) membranes. The membranes were incubated with 5% bovine serum albumin (BSA) for 1 h and immunoblotted with the primary antibodies overnight at 4 °C followed by the appropriate HRP-labelled secondary antibodies for 1 h at 37 °C. The corresponding antibodies were used: ADAM19 (Abcam), Notch1 (Immunoway), Fibronectin (Protein Technology), α-SMA (Protein Technology) and GAPDH (Protein Technology). GAPDH was used for normalization. All bands were acquired by chemiluminescence using the ECL Chemiluminescence Substrate Kit (Beyotime Biotechnology) and quantified using the software Image J.

Flow cytometry

The suspended cells were isolated from the PD solutions at 500 relative centrifuge force (RCF) at 4 °C for 10 min. The harvested mono-nuclear cells were stained with 5% BSA at room temperature for 30 min to block the FC receptor and then incubated with CD11b and CD206 antibodies at 4 °C for 30 min away from light. For CD45 and iNOS staining, cells were pretreated by transmembrane fluid at 4 °C for 30 min. M1 macrophages were sorted as CD45⁺CD11b⁺iNOS⁺CD206⁻ cells. M2 macrophages were sorted as CD45⁺CD11b⁺iNOS⁻CD206⁺ cells. All flow cytometry data were analyzed using FlowJo software.

In the mouse model of peritoneal fibrosis, peritoneal cells were collected from different groups. The harvested cells were isolated by centrifugation at 500 RCF, washed by sterile PBS, and analyzed by detailed flow cytometry. In the flow cytometry detection, viable cells were first gated using viability dye. Macrophages were identified by CD45, CD11b and F4/80 staining to assess their recruitment in the peritoneal cavity. Additionally, macrophage polarization was evaluated by staining for CD86 (marker of M1 macrophages) and CD206 (marker of M2 macrophages). The gating procedures including debris exclusion, doublet discrimination, live cell selection using a viability dye, macrophage identification, and corresponding controls are shown in Fig. S3.

The following antibodies were used respectively:

	Produce	Catalog number
BV421 mouse anti-human CD11b	BD Pharmingen	562632
APC/Cyanine7 anti-human CD206 (MMR)	Biolegend	321120
Brilliant violet 510 anti-human CD45	Biolegend	304036
iNOS monoclonal antibody AF488	eBioscience	53-5920-80
Fixable viability stain 510	BD Pharmingen	564406
Mouse BD Fc block	BD Pharmingen	553141
APC-Cy7 rat anti-mouse CD45 (30-F11)	BD Pharmingen	557659
CD11b BV605 M1/70	BD Pharmingen	563015
BV421 rat anti-mouse F4/80 (T45-2342)	BD Pharmingen	565411
Alexa Fluor 647 rat anti-mouse CD206 (MR5D3)	BD Pharmingen	565250
PE rat anti-mouse CD86 (GL1)	BD Pharmingen	561963
Tissue dissociation solution	Absin	Abs9482

Enzyme-linked immunosorbent assay (ELISA)

The PD solutions levels of cytokines were measured using commercially available ELISA kits (Multi-sciences (Lianke) Biotechnology) according to the manufacturer’s instructions. At the beginning, 96-well high-binding polystyrene ELISA plates were infiltrated with 1× washing buffer for 30 s. 50 µl per well of human serum, 50 µl per well of 1× detected buffer and 100 µl per well of corresponding detection antibody were added to the wells and allowed to incubate for 2 h at 25 °C. Plates were washed six times with 1× washing buffer. Then secondary horseradish peroxidase (HRP) detection antibodies were added and incubated for 45 min at 25 °C. After washing six times with 1× washing buffer, 100 µl per well of TMB Substrate Solution was added and incubated for 5–30 min at 25 °C in dark. Absorbance was measured at 450 nm and 570 nm using Varioskan LUX, followed by addition of 100 µl per well of Stop Solution. The respective standard curves were prepared from standard dilutions of each of the five ELISA kits. The sample concentration of each cytokine was determined and recorded.

Masson staining

Paraffin-embedded peritoneal tissue sections were deparaffinized in xylene and rehydrated through a graded ethanol series to distilled water. Masson staining was performed using a Masson stain kit (Solarbio) according to the manufacturer‘s instructions. Collagen fibers were stained in blue, while nuclei were stained in blue-black, and cytoplasm and muscle fibers stained in red.

Immunohistochemistry staining

Immunohistochemistry staining was performed using a standard protocol. Briefly, paraffin-embedded tissue sections were deparaffinized, rehydrated, and subjected to antigen retrieval in citrate buffer (pH 6.0). Endogenous peroxidase activity was quenched with 3% hydrogen peroxide, followed by blocking with 5% normal goat serum. Sections were incubated overnight at 4 °C with of ADAM19 antibody and Notch1 antibody, then were incubated with Mouse/Rabbit enhanced polymer detection system (ZSGB-Bio) and DAB kit (ZSGB-Bio).

Statistical analysis

All statistical analyses were performed using IBM SPSS software, version 22.0 (IBM Corp., Armonk, NY, USA). Continuous variables were expressed as mean ± standard, analyzed by an unpaired t-test or the Kruskal–Wallis H test or the nonparametric Mann–Whitney U test. Categorical data were analyzed using the chi-square test and were presented as frequency (percentage). Pearson linear regression was used to determine the relationship of adam19 with various clinical indicators. The receiver operating characteristic curve (AUROC) was created to explore the sensitivity and specificity of ADAM19 level thresholds to identify an optimal vancomycin threshold. The optimal cut-off points of ADAM19 were scored by the Youden index. Logistic regression analyses were used to analyze the risk factors for lower kt/v in PD patients.

The data from three independent experiments are presented as the mean ± standard and were analyzed using GraphPad Prism 5. A two-sided Student’s T-test was performed to compare the parameters between groups. p < 0.05 was considered statistically significant.

Results

Comparison of clinical data for the two groups according to PD duration

To investigate the impact of dialysis duration on peritoneal function, we first selected 30 patients with long-term dialysis (PD duration ≥ 60 months) and 25 patients with short-term dialysis (PD duration ≤ 12 months and > 3 months) for comparison. Table 1 shows the baseline information among all patients. There were no significant differences in baseline characteristics such as gender, age, and BMI between the two groups. However, the proportion of patients with diabetes in the short-term dialysis group was significantly higher than that in the long-term dialysis group, which is closely related to the selection criteria for peritoneal dialysis patients during different periods. Regarding dialysis regimens, 60% of patients in the long-term dialysis group used 2.5% dialysate for treatment, which was significantly higher than that in the short-term dialysis group. However, there was no significant difference in fasting blood glucose levels between the two groups. In terms of laboratory tests, apart from serum calcium, there were no significant differences in white blood cell count, hemoglobin, platelet count, and hs-CRP between the two groups. Assessments of dialysis adequacy and peritoneal function revealed that KT/v and PET in the long-term dialysis group were significantly lower than those in the short-term dialysis group, indicating that peritoneal function and dialysis adequacy significantly decline with the extension of dialysis duration.

Table 1.

Clinical manifestations of the PD patients grouped by the PD duration.

	Short-term (25)	Long-term (30)	P
Age (Years)	54.12 ± 11.22	53.23 ± 10.85	0.767
Gender (male/%)	16(64%)	17(56.7%)	0.580
History of diabetes(n/%)	11(44%)	2(6.7%)	0.001
History of peritonitiss(n/%)	2(8%)	3(10%)	0.797
BMI (kg/m2)	22.01 ± 2.86	21.89 ± 3.46	0.895
Dialysis prescription (with 2.5% peritoneal dialysate)	5(20%)	18(60%)	0.003
WBC(×109/L)	6.61 ± 2.01	6.91 ± 1.61	0.532
HB(g/L)	111.12 ± 17.20	111.30 ± 21.00	0.973
PLT(×109/L)	191.80 ± 50.84	190.33 ± 82.34	0.939
Albumin (g/L)	34.07 ± 4.90	33.87 ± 4.02	0.867
Glucose (mmol/L)	6.95 ± 1.51	5.34 ± 0.83	0.063
Ca (mmol/L)	2.24 ± 0.14	2.39 ± 0.20	0.004
P (mmol/L)	1.39 ± 0.27	1.51 ± 0.38	0.208
hs-CRP (mg/L)	3.01 ± 3.44	5.47 ± 5.76	0.160
KT/V	2.42 ± 0.56	2.02 ± 0.36	0.002
PET	0.66 ± 0.09	0.60 ± 0.08	0.022

BMI, body mass index; WBC, white blood cell; HB, hemoglobin; PLT, Platelets; Ca, calcium; P, phosphorus; Hs-CRP, high sensitivity C-reactive protein.

Macrophage recruitment and toward M2 polarization facilitate peritoneal fibrosis in long-term peritoneal dialysis

A multiplicity of studies has demonstrated that long-term exposure to PD solutions with hyperglycaemic, hyperosmotic and low pH triggered a series of pathological events such as peritonitis, neoangiogenesis and peritoneal fibrosis, which steadily lead to peritoneal membrane dysfunction and peritoneal ultrafiltration decliner. While recruitment of inflammatory cells including macrophage, which increases production of inflammatory cytokines was the key point. More importantly, increasingly studies have found that macrophage polarization to M2 plays an important role in the process of fibrosis.

Through detecting the proteins expression in PD solution, we found a significantly increased of fibrotic protein such as fibronectin (FN), and α-smooth muscle actin (α-SMA) in long-term PD group by western blotting compared with patients in short term group (Fig. 2A) which indicated a more severe peritoneal fibrosis occurs in patients with longer dialysis. We then examined the expression of pro-inflammatory cytokines secreted from M1 macrophage (IL-6) and anti-inflammatory cytokines secreted from M2 macrophage (IL-10) in fresh peritoneal dialysis effluent of patients by real-time PCR (Fig. 3A) and ELISA (Fig. 3B). We detected a markable increment in the number of macrophages in PD fluid cells, indicating an increasing recruitment of macrophages (Fig. 3C). Additionally, M2 macrophage was significantly increased (Fig. 3C), and the M2/M1 ratio was significantly higher in long-term PD group than in short-term PD group (Fig. 3D), manifesting that macrophage tends to adopt an anti-inflammatory phenotype as the duration of PD. As shown, these chemokines (CCL2, CCL5, CXCL16) were diversely unregulated in long-term PD group than in short-term PD group (Fig. 3E). Additionally, we performed complementary experiments using a mouse model of peritoneal fibrosis, intraperitoneally injected with high-glucose dialysis fluid (G2.5% and G4.25% solutions) for 4 or 8 consecutive weeks. We observed that the progression of peritoneal fibrosis in mice was aggravated under the influence of G2.5% and G4.25% PD solutions (Fig. S1A).

Fig. 2.

Peritoneal fibrosis progression with the extension of PD time. (A) The aggravated process of peritoneal fibrosis was evaluated by fibrosis-associated protein (Fibronectin, α-SMA) in western blotting experiment.

Fig. 3.

Macrophages were recruited and polarized during PD. (A,B) The up-regulated inflammatory cytokine levels secreted from M1 macrophage (IL-6) and M2 macrophage (IL-10) of fresh PD effluent of patients were measured by real-time PCR and enzyme-linked immunosorbent assay (ELISA). (C,D) Proportion of M1 (iNOS+/CD206−) and M2 (iNOS−/CD206+) macrophages in effluent were identified through flow cytometry, showing coincidence of recruited macrophages during PD. With the duration of PD time, more macrophages polarized toward M2. (E) The increasing expressions of chemokines (CCL2, CCL5, CXCL16) of fresh PD effluent of patients were measured by real-time PCR.

Fig. 4.

The up-regulated expression of ADAM19 of patients in long-term PD. (A) The protein levels of ADAM19 and Notch1 in patients with the treatment of PD. (B) The mRNA expressions of ADAM19 and Notch1 in patients with the treatment of PD. (C–E) The Line correlation of ADAM19 and clinical data from the above patients such as Kt/v, PD time, 4 h D/P. (F) The areas under the ROC curves of ADAM19.

To further identify the level of macrophages in peritoneal fluid of the two patient groups, we made a collection of fresh PD effluent of patients in short-term and long-term PD and gathered suspended cells from PD fluid through low-speed centrifugation. Then we examined the proportion of M1 (iNOS⁺/CD206⁻) and M2 (iNOS⁻/CD206⁺) macrophages through flow cytometry. we found the rate of M2 (iNOS⁻/CD206⁺)/M1 (iNOS⁺/CD206⁻) was significantly increased in long-term group, indicating that with the extension of PD time, more and more macrophages gradually polarized towards M2 (Fig. 3B). Meanwhile, we detected similar results in mice. We discovered the number of M2 (CD86⁻CD206⁺) macrophage was progressively increased and the number of M1 (CD86⁺CD206⁻) macrophage was moderately increased in G4.25% group compared to G2.5% group for 4 weeks (Fig. S2), indicating that macrophages tend to be polarized towards M2 with the duration of PD fluid. Strikingly, with the extension of the stimulating time of G4.25% PD fluid for the 8 weeks, the proportion of M2 macrophage significantly increased compared with the 4-week G4.25% group (Fig. S2), showing that prolonged dialysis duration has a more pronounced effect on promoting M2 polarization of macrophages. In summary, G4.5% PD fluid could improve M2 macrophage polarization compared to G2.5% PD fluid. Moreover, this enhancement of M2 macrophage becomes more pronounced with extended dialysis duration, thereby participating in the progression of peritoneal fibrosis.

Coincidence of elevated ADAM19 expression during long-term peritoneal dialysis

ADAM19 as a disintegrin and metalloproteinases has been extensively reported to be involved in the fibrotic process of a variety of diseases by recruiting macrophages. The effluent PD fluid cells consist of detached peritoneal mesothelial cells and macrophages. Macrophages serve as crucial regulators of the fibrotic process, promoting the occurrence of fibrosis by secreting various cytokines, and peritoneal mesothelial cells are the truly main drivers contributing to the progression of peritoneal fibrosis^6,10–12. In our study we found a significantly elevated ADAM19 mRNA and protein expression in the peritoneal fluid of long-term dialysis patients compared with short-term dialysis patients (Fig. 4A). Meanwhile, we detected the increase of cytoplasmic Notch1 along with ADAM19 overexpression, the accumulation of the Notch1 intracellular domain, showing ADAM19/Notch1 pathway was activated along with PD time (Fig. 4A,B). In mice model, we examined the expressions of ADAM19 and Notch1 in peritoneal mesothelial cells by IHC. We found the expression of ADAM19 progressively upgraded with the progression of peritoneal fibrosis in peritoneal mesothelial cells (Fig. S1B); and Notch1 simultaneously increases in tandem with ADAM19 (Fig. S1C). These results suggested that ADAM19/Notch1 signaling is hyperactivated during peritoneal fibrosis, which is consistent with the previous clinical observations. Our results declared that long-term PD could activate of ADAM19/Notch1 signal pathway, further induces macrophage polarization which facilitates peritoneal fibrosis. Altogether, ADAM19 may become an important indicator for the early assessment of peritoneal fibrosis and peritoneal function.

Predictive value of ADAM19 for PD adequacy

To further clarify the correlation between ADAM19 and peritoneal function while minimizing the confounding effect of significant differences in dialysis duration, we extended our study by including an additional 23 patients undergoing medium-term dialysis (PD duration > 12 and < 60 months), building upon the original cohort of 55 long-term and short-term dialysis patients. Among the three groups, levels of Kt/V and PET showed a progressive decline with increasing dialysis duration; however, no significant differences were observed among the groups. Regarding the history of diabetes, the short-term dialysis group had the highest proportion of patients. Significant differences were also noted in serum calcium levels across the three groups (Table 2).

Table 2.

Clinical manifestations of the PD patients in three groups.

	Short-term (25)	Medium term (23)	Long-term(30)	P
Age (years)	54.12 ± 11.22	55.87 ± 1025	53.23 ± 10.85	0.676
Gender (male/%)	16 (64%)	10 (43.5%)	17 (56.7%)	0.352
History of diabetes (n/%)	11 (44%)	6(26.1%)	2 (6.7%)	0.006
History of peritonitiss(n/%)	2 (8%)	2 (8.7)	3 (10%)	0.966
BMI (kg/m2)	22.01 ± 2.86	22.91 ± 2.69	21.89 ± 3.46	0.451
Dialysis prescription (with 2.5% peritoneal dialysate)	5 (20%)	5 (21.7%)	18 (60%)	0.002
WBC(×109/L)	6.61 ± 2.01	7.37 ± 1.94	6.91 ± 1.61	0.358
HB (g/L)	111.12 ± 17.20	116.36 ± 28.79	111.30 ± 21.00	0.659
PLT (×109/L)	191.80 ± 50.84	198.28 ± 62.68	190.33 ± 82.34	0.883
Albumin (g/L)	34.07 ± 4.90	36.57 ± 4.14	33.87 ± 4.02	0.59
Glucose (mmol/L)	6.95 ± 1.51	5.40 ± 1.48	5.34 ± 0.83	0.177
Ca (mmol/L)	2.24 ± 0.14	2.28 ± 0.22	2.39 ± 0.20	0.014
P (mmol/L)	1.39 ± 0.27	1.63 ± 0.45	1.51 ± 0.38	0.082
hs-CRP (mg/L)	3.01 ± 3.44	4.47 ± 6.24	5.47 ± 5.76	0.344
KT/V	0.66 ± 0.09	0.60 ± 0.14	0.60 ± 0.08	0.99
PET	2.42 ± 0.56	2.11 ± 0.47	2.02 ± 0.36	0.409
ADAM19	4.80 ± 3.52	5.77 ± 4.10	7.65 ± 3.41	0.006
IL-6	5.22 ± 3.49	5.06 ± 3.66	7.65 ± 5.18	0.049
Il-10	3.99 ± 3.19	4.37 ± 3.04	6.89 ± 4.71	0.012

BMI, body mass index; WBC, white blood cell; HB, hemoglobin; PLT, Platelets; Ca, calcium; P, phosphorus; Hs-CRP, high sensitivity C-reactive protein.

PD effluent was collected from all patients to detect the expression of ADAM19 and the inflammatory markers IL-6 and IL-10. The results demonstrated significant differences in ADAM19 expression among the three groups, with both ADAM19 and inflammatory markers (IL-6 and IL-10) progressively increasing as dialysis duration extended. Preliminary findings suggest that ADAM19 may serve as an important indicator for assessing peritoneal function. Therefore, we further stratified patients based on their Kt/V levels. The results showed that patients in the Kt/V ≥ 1.67 group exhibited significantly lower ADAM19 expression compared to the control group, whereas no significant differences were found in IL-10 and IL-6 levels. In addition, baseline characteristics and laboratory parameters showed no significant differences between the two groups stratified by Kt/V levels (Table 3).

Table 3.

Clinical manifestations of the PD patients grouped by Kt/v.

	Kt/V(≤1.67) (11)	Kt/V(>1.67) (67)	P
Age (years)	50.64 ± 7.56	54.9 ± 11.07	0.224
Gender (male/%)	9 (81.8%)	34 (50.7%)	0.55
History of diabetes (n/%)	2 (18.2%)	17 (25.4%)	0.607
History of peritonitis (n/%)	1 (9.1%)	6 (9.0%)	0.988
BMI (kg/m2)	22.43 ± 3.19	22.19 ± 3.06	0.816
Dialysis prescription (with 2.5% peritoneal dialysate)	6 (54.5%)	22 (32.8%)	0.164
WBC (×10^9/L)	6.55 ± 1.70	7.02 ± 1.87	0.441
HB (g/L)	114.09 ± 13.87	112.51 ± 23.56	0.829
PLT (×10^9/L)	183.55 ± 48.77	194.88 ± 64.85	0.582
Albumin (g/L)	34.97 ± 4.00	34.69 ± 4.56	0.849
Glucose (mmol/L)	5.83 ± 1.66	5.51 ± 1.22	0.437
Ca (mmol/L)	2.34 ± 0.22	2.35 ± 0.20	0.549
P (mmol/L)	1.55 ± 0.26	1.49 ± 0.39	0.641
hs-CRP (mg/L)	2.07 ± 2.64	4.87 ± 6.59	0.17
PD duration (months)	57.85 ± 44.28	40.54 ± 39.77	0.192
PET	0.63±0.0.11	0.62 ± 0.10	0.729
ADAM19	9.12 ± 3.42	5.70 ± 3.68	0.005
IL-6	6.59 ± 3.99	6.04 ± 5.61	0.492
Il-10	6.03 ± 5.61	5.51 ± 4.15	0.707

BMI, body mass index; WBC, white blood cell; HB, hemoglobin; PLT, Platelets; Ca, calcium; P, phosphorus; Hs-CRP, high sensitivity C-reactive protein.

Further simple linear correlation analysis revealed that ADAM19 expression was significantly negatively correlated with Kt/V levels (Fig. 4C). The AUROC was used to evaluate the predictive value of ADAM19 for PD adequacy (Fig. 4D,E). The area under the curve for ADAM19 was 0.738 (95% CI 0.567–0.969), with an optimal cutoff value of 7.84 for ADAM19 RNA level to maximize sensitivity and (1–specificity) (Fig. 4F).

Considering that many factors may affect PD adequacy in patients undergoing PD, we further explored the relationship between Kt/V and ADAM19 levels using logistic regression models (Table 4). After adjusting for variables such as hs-CRP, history of peritonitis, dialysis duration, glucose levels, dialysis regimen, history of diabetes, PET, serum calcium, we found that higher ADAM19 levels (≥ 7.84) were independently associated with lower Kt/V (< 1.67) (OR = 0.022; 95% CI 0.002–0.295).

Table 4.

Results of multivariate logistic regression analyses to identify risk factors associated with Kt/v.

Risk factor	Multivariate
	OR	95%CI	P
hs-CRP	1.671	0.933-2,802	0.089
Duration of PD	1.008	0.993–1.054	0.659
PET	0.607	0.000-13739.636	0.922
Dialysis prescription	0.059	0.003–1.044	0.054
History of peritonitis	0.783	0.037–16.725	0.875
History of diabetes	4.456	0.191-103.762	0.352
Hs-CRP (mg/L)	1.617	0.933–2.802	0.087
Glucose	0.559	0.237–1.320	0.184
ADAM19(≥ 7.84/<7.84)	0.022	0.002–0.295	0.004

Discussion

Peritoneal fibrosis remains a serious, life-threatening problem associated with the PD treatment failure. The initial 3 months of PD are a transitional period in which patients are adapting to therapy, and peritoneal membrane changes are not yet fully established. Published studies have frequently adopted PD duration > 3 months as an inclusion criterion to ensure adequate exposure to related factors and stable membrane function for meaningful analyses. And peritoneal fibrosis is diagnosed in 50% and 80% of PD patients within 1 and 2 years of treatment initiation^13–16. Given this, this study was conducted among PD alone receiving between 3 and 12 months for short-term PD group. There are several causes for technique failure, including catheter-related problems, clearance or ultrafiltration (UF) problems, peritoneal leakage, and the risk or diagnosis of encapsulating peritoneal sclerosis (EPS), and other factors¹⁷. Among these factors, it has been proved that peritoneal membrane dysfunction is responsible for about 30% of technique failure¹⁸, and clinical studies showed that peritoneal UF gradually declines 2–4 years after the initiation of PD¹⁹.

Typically, macrophages are not the direct primary producers of structural fibrotic proteins. Macrophages serve as crucial regulators of the fibrotic process, promoting or inhibiting fibrosis by secreting multiple cytokines under certain conditions^10,11,20. To be precise, mesothelial cells are the main drivers contributing to the progression of peritoneal fibrosis, which is also confirmed in our mouse experiments. In the current study, we showed that compared with short-term PD patients, the expressions of FN, α-SAM in the dialysate of patients at Long-term group were significantly increased accompanied by the decrease of Kt/v levels, reverified more obvious peritoneal fibrosis with long-stage PD. Meanwhile, we discovered that peritoneal fibrosis in mice was aggravated with G2.5% and G4.25% dialysis solution; and prolonged dialysis duration has a more pronounced effect on peritoneal fibrosis. Macrophages, the most abundant in PD effluents, It has been proved that the activation and recruitment of macrophage by high glucose-based PD solution were associated with peritoneal fibrosis²¹.

Generally, macrophages can be divided into classically activated macrophages (M1) and alternatively activated macrophages (M2)²². M1 Macrophage mainly secretes pro-inflammatory factors, such as TNF-α and IL-6, leading to cell apoptosis and inflammation. On the other hand, M2 macrophage mainly secretes anti-inflammatory factors, such as IL-10 and transforming growth factor-beta 1 (TGF-β1), promoting cell proliferation and matrix deposition²³. In our study, we investigated the expressions of pro-inflammatory cytokines IL-6 secreted from M1 macrophage and anti-inflammatory cytokines IL-10 secreted from M2 macrophage were all increased, especially in long-term PD patients. Further cell typing through flow cytometer showed M1 (iNOS⁺/CD206⁻) and M2 (iNOS⁻/CD206⁺) cells in dialysate increased progressively with the extension of dialysis time, the proportion of M2/M1 was enhanced, confirming the activated M2 polarization of recruited macrophages. These results were also confirmed in our animal experiments that M1 macrophage gradually polarized towards M2. Our study suggested that the initiation of peritoneal fibrosis may be a combination of the proinflammatory effect of M1 macrophage and the proliferative effect of M2 macrophage. As the duration of dialysis increased, a progressive shift from M1 to M2 macrophage was observed²⁴, and M2macrophage played an important role in peritoneal fibrosis.

In our study, we showed that, along with macrophage infiltration and peritoneal fibrosis process induced by long PD, not only the level of peritoneal fibrosis index and macrophages in peritoneal permeate increased, but also the level of ADAM19. The expression of ADAM19 in long-term PD with elevated fibrosis indexes was verified and significantly negatively correlated with total Kt/v. Further, AUROC and logistic analysis identified the predictive value of ADAM19 for PD adequacy. It suggested that ADAM19 may be associated with the process of peritoneal fibrosis and could be considered as a noninvasive indicator of peritoneal fibrosis.

To further explore the intrinsic mechanism of ADAM19 in peritoneal fibrosis. We made further analysis and observation. A lot of literature has confirmed the role of Notch signaling in regulating the differentiation, activation and metabolism of macrophage^25,26. ADAM19 can cleavage induces endocytosis of Notch’s extracellular portion along with the ligand by the signal-sending cell and the subsequent release of the Notch intracellular domain (NICD) which then translocated to the nucleus of the signal-receiving cell, and link with the process of cell proliferation, inflammatory damage and fibrosis repair²⁷. Recent research discovered that ADAM19 mediates renal fibrosis by increasing macrophage infiltration, it caused accumulation of the Notch1 intracellular domain, an upstream regulator of CCL2 expression⁸. CCL2 is regarded as a key chemotactic protein that recruits circulatory monocytes and tissue macrophages in renal injury and fibrosis²⁸. In our study, we sought to investigate whether the role of ADAM19 in peritoneal fibrosis is mediated by similar signals and pathways. We detected elevated cytoplasmic Notch1 with overexpression of ADAM19 in dialysate of long-term PD, accompanied by elevated expressions of CCL2, CCL5, and CXCL16 which are involved in stimulating macrophage recruitment. Consistent with previous clinical results, Notch1 showed a consistent upward trend alongside the stable growth in ADAM19 expression during the progression of peritoneal fibrosis in peritoneal fibrosis mice. Moreover, M2 macrophage has a more pronounced increasement with the extended dialysis duration, thus involving in the subsequent immune response of macrophage and accelerating the progression of peritoneal fibrosis. These findings provide orthogonal, cross-species validation of our conclusion that ADAM19 may promote peritoneal fibrosis by regulating the infiltration and polarization of M2 macrophage mediated by Notch1 pathway, ADAM19 and its activated Notch1 signal may be new targets for prevention and treatment of peritoneal fibrosis. ADAM19 is expected to be a novel indicator for detecting peritoneal ultrafiltration function in PD patients.

Our study also has some limitations that should be addressed in future studies. As is known, the presence of peritoneal fibrosis is primarily assessed by the peritoneal equilibration test, ultrafiltration volume evaluation, clinical manifestations with effluent biomarkers and CT imaging in clinical examination^29–31. Obtaining peritoneal biopsy samples from patients was not feasible in our study. Therefore, the induction of peritoneal fibrosis by long-term dialysis just be determined by establishing the mouse model of peritoneal fibrosis in our study. In addition, CD86 is a widely recognized as an M1 macrophage marker in human tissues and iNOS is a well-established M1 macrophage marker in murine systems. The reliability of iNOS in human macrophages is indeed limited. Nevertheless, previous research have used iNOS as an M1 macrophage marker to assess M1 polarization in human tissue^32,33.Moreover, iNOS is examined in human monocytic cell lines such THP-1 cells, U937 cells to evaluate the polarization and inflammation response of macrophages^34–37, suggesting iNOS also could be used as an indicator to indicate the polarization of human macrophages and other human cells. To further substantiate the analysis, we have performed complementary experiments using a mouse model of peritoneal fibrosis to support our results. The next research should further integrate clinical samples and multidimensional detection parameters to deeply explore the mechanisms underlying peritoneal fibrosis, which could provide a more solid theoretical foundation for the prevention and management of long-term dialysis-related complications.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

K.Y.X. and M.H.H. analyzed and interpreted the patient’s data. K.Y.X. performed the formal analysis and visualization. J.Y. and Y.Y. performed the methodology and investigation. K.Y.X. and Y.Y. performed the validation. Y.Y. and X.J. performed the resources. K.Y.X. and M.H.H. were major contributors in writing the manuscript. J.Y., X.J., and Y.Y. reviewed and edited the manuscript. All authors read and approve the final manuscript.

Funding

This research was supported by the Joint Fund of Zhejiang Provincial Natural Science Foundation of China under Grant No. LBY24H290006; Zhejiang Provincial Natural Science Foundation of China under Grant No. LMS25H290005; Medical Scientific Research Foundation of Zhejiang Province under Grant No.2025KY154; Medical Scientific Research Foundation of Zhejiang Province under Grant No.2025KY1146; The Construction fund of Key medical Disciplines of Hangzhou under Grant No. 2025HZGF12.

Data availability

The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

All procedures performed in studies involving human participants were by the ethical standards of the Institutional Review Board of Hangzhou TCM Hospital Affiliated to Zhejiang Chinese Medical University and with the 1964 Helsinki Declaration and its later amendments or comparable ethical standards (No. 2023KLL059).

Competing interests

The authors declare no competing interests.