Virulence genes and antimicrobial resistance profiles of Klebsiella pneumoniae isolated from urinary tract infections

Abstract

Introduction

Klebsiella pneumoniae (K. pneumoniae) is an opportunistic pathogen associated with urinary tract infections (UTIs) and exhibits increasing antibiotic resistance and virulence.

Methods

Ten K. pneumoniae isolates from UTIs were analyzed for antibiotic susceptibility using the disc diffusion method and classified as multidrug-resistant (MDR) if resistant to at least three antibiotic classes. PCR was employed to detect virulence genes (mrkA, mrkD, capP, entB) and resistance determinants (blaSHV, dfrA1, tetB, aadA1, sul1, qnr).

Results

All isolates were resistant to tetracycline, and 80% showed resistance to ampicillin-sulbactam. Six isolates (60%) were MDR. Virulence genes mrkA and mrkD were present in 70% of isolates, while capP and entB were detected in 60%. Resistance genes blaSHV, aadA1, tetB, sul1, dfrA1, and qnr were detected in 80%, 60%, 100%, 40%, 30%, and 40% of isolates, respectively. MDR isolates generally carried more virulence factors than non-MDR isolates.

Conclusion

Although the study involves a limited number of isolates, the coexistence of multidrug resistance and multiple virulence genes highlights the potential clinical risk of K. pneumoniae in UTIs. These findings underscore the importance of ongoing surveillance and cautious antibiotic use.

Introduction

Urinary tract infections (UTIs) are among the most common bacterial infections affecting millions of individuals annually and pose a significant clinical burden on healthcare systems worldwide. Among the etiological agents, Klebsiella pneumoniae (K. pneumoniae) has emerged as a major cause of both community-acquired and hospital-acquired UTIs, owing to its increasing prevalence and ability to colonize the urinary tract efficiently [1]. The escalating global apprehension regarding antimicrobial resistance (AMR) in pathogenic bacteria poses a substantial risk to public health and the viability of contemporary medicine. The extensive application and abuse of antibiotics in human and veterinary medicine have resulted in the emergence of multidrug-resistant (MDR) bacteria, complicating the treatment of illnesses [2, 3]. K. pneumoniae is a gram-negative opportunistic pathogen belonging to the Enterobacteriaceae family. Its ability to cause persistent and recurrent UTIs is largely attributed to its extensive arsenal of virulence determinants, including capsules, siderophores, adhesins, and biofilm-forming capabilities, which collectively enhance bacterial survival in hostile host environments [4]. Its notable capacity to get and transmit resistance genes, particularly those that code for extended-spectrum β-lactamases (ESBLs) and carbapenemases, has established it as a high-priority pathogen by the World Health Organization (WHO) [4, 5].

The harmful effect of K. pneumoniae is related to its antibiotic resistance and its array of virulence factors [6]. These characteristics facilitate the bacterium’s colonization, evasion of host immunological responses, and disease manifestation [6]. Principal virulence factors encompass capsular polysaccharides that confer protection against phagocytosis; lipopolysaccharide (LPS), a significant component of the outer membrane that promotes inflammation; and siderophores, which aid in iron uptake within the host environment [7]. Fimbriae, including type 1 and type 3 fimbriae, are essential for adhesion to host tissues and biofilm formation, augmenting bacterial survival and antibiotic resistance [6, 7]. Comprehending the presence and attributes of these virulence genes in K. pneumoniae from various sources is crucial for evaluating its pathogenic potential [6, 7].

The identification of specific virulence and antimicrobial resistance genes provides deeper insight into the pathogenicity and clinical relevance of K. pneumoniae isolates. Among the virulence determinants, the mrkA gene encodes the major structural subunit of type 3 fimbriae, which plays a pivotal role in biofilm formation and facilitates adhesion to abiotic surfaces, including urinary catheters [6]. Similarly, mrkD, which encodes the adhesive subunit of type 3 fimbriae, mediates binding to extracellular matrix components and enhances colonization of host tissues, thereby increasing persistence in urinary tract environments (16). Another essential virulence-associated region is the capP locus within the capsular polysaccharide synthesis cluster, which contributes to capsule formation and protects the bacterium from complement-mediated killing and phagocytosis [7]. Additionally, the siderophore-associated gene entB is crucial for enterobactin biosynthesis, enabling iron acquisition in nutrient-limited host conditions and supporting bacterial growth and virulence [8].

Alongside these virulence elements, K. pneumoniae frequently harbors multiple antimicrobial resistance genes that compromise treatment efficacy. The aadA1 gene confers resistance to streptomycin [9], while sul1 provides resistance to sulfonamides through the production of an alternative dihydropteroate synthase [10]. Resistance to β-lactam antibiotics is commonly mediated by blaSHV, which encodes SHV-type β-lactamases capable of hydrolyzing penicillins and early-generation cephalosporins [11]. The tetB gene is responsible for tetracycline resistance by encoding an efflux pump that actively expels the drug from bacterial cells [12]. Trimethoprim resistance is frequently linked to dfrA1, encoding a drug-resistant dihydrofolate reductase [13]. Moreover, the presence of plasmid-mediated quinolone resistance genes such as qnr further enhances bacterial survival by protecting DNA gyrase and topoisomerase IV from quinolone inhibition [14, 15].

The coexistence of these virulence and resistance determinants not only amplifies the pathogenic capacity of K. pneumoniae but also complicates clinical management by limiting the effectiveness of commonly used antimicrobial agents. Therefore, molecular detection and characterization of these genes are essential for understanding epidemiological patterns, guiding empirical therapy, and implementing effective infection control strategies in healthcare settings [16, 17].

Given the increasing prevalence of virulent and multidrug-resistant K. pneumoniae strains in UTIs, understanding the distribution of virulence genes and antimicrobial resistance profiles is essential for guiding effective treatment strategies, infection control, and public health surveillance. Therefore, comprehensive molecular characterization of clinical isolates is crucial for addressing emerging threats posed by this pathogen.

Materials and methods

Sample collection and bacterial isolation

A total of 60 urinary samples were collected from patients in hospitals across Tehran between January and March 2025. Samples were aseptically transferred to the laboratory and processed following standard clinical protocols.

K. pneumoniae was isolated using MacConkey broth enrichment, followed by plating on Eosin Methylene Blue (EMB) agar. Presumptive colonies were further purified on Brain Heart Infusion (BHI) agar. Identification of isolates was confirmed using Gram staining, standard biochemical assays, and PCR amplification of the 16 S rRNA gene.

DNA extraction using boiling

Bacterial isolates identified as K. pneumoniae were grown on suitable agar media for 24 h. Each isolate’s solitary colony was resuspended in 100 µL of sterile deionized water. The suspension was heated to 99 °C for 15 min with gentle agitation to lyse the bacterial cells and liberate DNA. The tubes were centrifuged at 1,000 × g for 5 min at 14 °C to sediment cellular debris. The supernatant, comprising the crude bacterial DNA extract, was transferred to fresh tubes and kept at -20 °C until utilized for Polymerase Chain Reaction (PCR) amplification.

Detection of virulence and antimicrobial resistance genes

PCR experiments were utilized to identify specific virulence genes in K. pneumoniae isolates. The PCR reaction mixture generally comprised 1 µL of each individual forward and reverse primer (10 pmol/µL), 0.6 µL of deoxynucleoside triphosphate (dNTPs; 10 mmol/L), 3 µL of 10x PCR buffer, 1.8 µL of MgCl2 (25 mmol/L), 0.1 µL of Taq DNA polymerase (5 U/µL), and 20 µL of distilled water (Yekta Tajhiz Azma PCR Master Mix Kit, Yekta Tajhiz Azma, Iran). Ultimately, 2.5 µL of the isolated DNA template was introduced into each 0.2-mL reaction tube. Thermal cycling parameters comprised an initial denaturation, succeeded by a predetermined number of cycles involving denaturation, annealing, and extension, culminating in a final extension phase. Amplified PCR products were confirmed by electrophoresis of 12 µL of the reaction product on a 1.5-2% agarose gel, stained with ethidium bromide, and seen under UV light. A 100-bp DNA ladder served as a molecular marker. Primers targeting pertinent virulence components of K. pneumoniae, including those encoding capsular polysaccharides, siderophores, and fimbriae, were constructed utilizing primer3plus (https://www.bioinformatics.nl › cgi-bin › primer3plus) (Table 1).

Table 1.

Sequence of primers used for virulence components of K. pneumoniae, including those encoding capsular polysaccharides, siderophores, and fimbriae

Name	Synbol	5’--------------------3’	Product Size	Tm (°C)	GenBank	Reference
Fimbriae major subunit	mrkA	F: GCAGCAGCGGATACTTACCT R: ACCAGCTGGATGTTCTGAGC	203 bp	60	OP437590.1	This study
Adhesive Subunit of Type 3 Fimbriae	mrkD	F: GCGCTTTACGCTGGAGATTA R: GGCCGACGGTGTATTTCTTA	464 bp	60	KF777787.1	This study
Capsular polysaccharide synthesis region	capP	F: CCTTCGTCACCTACGGAATG R: TGATCCTTCGATGATGTCCA	462 bp	60	AB742229.1	This study
Siderophore	entB	F: TGGAGAAAGTGGTGGCTAAT R: GCACGGTATCGTCTTCATCC	204 bp	60	OL373969.1	This study

Identifying specific antibiotic resistance genes was conducted utilizing PCR assays, analogous to discovering virulence genes. Oligonucleotide primers for genes linked to resistance against multiple antibiotic classes pertinent to K. pneumoniae (ESBLs, carbapenemases, aminoglycoside resistance genes, tetracycline resistance genes) were designed using primer3plus. The PCR configuration and parameters will adhere to the approach outlined for virulence gene identification. The amplified products will be examined by agarose gel electrophoresis to verify the existence of the target resistance genes (Table 2).

Table 2.

Oligonucleotide primers and amplification parameters for the identification of antibiotic resistance genes in K. pneumoniae

Name	Synbol	5’--------------------3’	Product Size	Tm (°C)	GenBank	Reference
Streptomycin	aadA1	F: AGAGGTAGTTGGCGTCATCG R: GGAGAATCTCGCTCTCTCCA	209 bp	60	KR028106.1	This study
Sulfonamide	sul1	F: GACGAGATTGTGCGGTTCTT R: AGAAGGATTTCCGCGACAC	205 bp	60	OR778837.1	This study
Beta-lactams	blaSHV	F: CAGCAGGATCTGGTGGACTA R: GCTTTGTTATTCGGGCCAAG	470 bp	60	HQ246165.1	This study
Tetracycline	tetB	F: TTTTATCGCTGCGTTGCTAA R: AGGTAAAGCGATCCCACCAC	466 bp	60	OR778836.1	This study
Trimethoprim	dfrA1	F: ATGGAGTGCCAAAGGTGAAC R: TTGGTACAAAAGGCGTGACA	456 bp	60	MK649937.1	This study
Quinolones	qnr	F: ACTTCGGATGAGGAGCAAAA R: CAAATCCTGGCGTGAGAAAT	198 bp	60	AY070235.1	This study

Antimicrobial susceptibility testing

The antibiotic susceptibility of K. pneumoniae isolates was assessed with the Kirby-Bauer disk diffusion technique on Mueller-Hinton agar. The method was executed strictly with the guidelines established by the Clinical and Laboratory Standards Institute (CLSI M100, https://www.nih.org.pk/wp-content/uploads/2021/02/CLSI-2020.pdf). Bacterial suspensions calibrated to a 0.5 McFarland standard were evenly distributed onto Mueller-Hinton agar plates. Commercially available antimicrobial disks (Streptomycin, Ampicillin-sulbactam, Tetracycline, Sulfonamide, Trimethoprim and Ciprofloxacin) were subsequently positioned on the inoculated agar surface. Plates were incubated under aerobic conditions at 37 °C for 18 to 24 h. The diameter of the inhibition zone surrounding each disk was measured and classified as susceptible, moderate, or resistant according to CLSI interpretation criteria.

Statistical analysis

The data acquired from the investigation, encompassing the prevalence of virulence and antimicrobial resistance genes and antibiotic sensitivity patterns, will be examined utilizing suitable statistical software (GraphPad Prism program). The threshold for statistical significance will be established at a P-value of less than 0.05.

Results

Ten unique strains of K. pneumoniae were successfully isolated from the total number of urinary samples collected and processed. The isolates were identified and verified using normal microbiological procedures and subsequently confirmed by molecular methods. Morphological and biochemical analyses were performed in this investigation, revealing that all 10 strains were Gram-negative, exhibiting large colonies with a dark metallic sheen on EMB agar. Biochemical assays revealed that all 10 bacteria tested positive for catalase, Voges-Proskauer, and citrate. The results indicated that all 10 strains tested negative for Indole and methyl red.

Antimicrobial susceptibility profiles

The antimicrobial susceptibility testing of the 10 K. pneumoniae isolates demonstrated diverse resistance patterns to the evaluated drugs. A significant prevalence of resistance was noted for Ampicillin-sulbactam, with 8 out of 10 (80%) isolates exhibiting resistance. Three (30%) isolates showed intermediate resistance to streptomycin, whereas six (60%) exhibited complete resistance and 1 (10%) isolate was susceptible. Four (40%) isolates showed resistance to Sulfonamide, whereas three (30%) isolates revealed resistance to Trimethoprim. Four (40%) isolates of ciprofloxacin demonstrated resistance, accounting for 40% of the total. All 10 isolates (100%) exhibited resistance to Tetracycline. 6 0f 10 identified K. pneumoniae bacteria (60%) were designated as multidrug-resistant (MDR), exhibiting resistance to a minimum of three distinct classes of drugs (Table 3).

Table 3.

Various antibiotic resistances profile of K. pneumoniae isolates

Bacterial Isolate		Aminoglycosides	Beta-lactams	Tetracycline	Folate Pathway Antagonists		Quinolones	Phenotype
		Streptomycin	Ampicillin-sulbactam	Tetracycline	Sulfonamide	Trimethoprim	Ciprofloxacin
Isolate 1	KP1	(R)	(R)	(R)	(R)	(R)	(I)	MDR
Isolate 2	KP2	(I)	(I)	(R)	(I)	(I)	(R)	Non-MDR
Isolate 3	KP3	(1)	(R)	(R)	(I)	(I)	(I)	Non-MDR
Isolate 4	KP4	(R)	(R)	(R)	(R)	(I)	(I)	MDR
Isolate 5	KP5	(R)	(R)	(R)	(S)	(I)	(R)	MDR
Isolate 6	KP6	(R)	(R)	(R)	(I)	(I)	(R)	MDR
Isolate 7	KP7	(R)	(R)	(R)	(R)	(R)	(I)	MDR
Isolate 8	KP8	(I)	(I)	(R)	(I)	(S)	(S)	Non-MDR
Isolate 9	KP9	(R)	(R)	(R)	(R)	(R)	(I)	MDR
Isolate 10	KP10	(S)	(R)	(R)	(S)	(S)	(S)	Non-MDR
Resistant number/ total number of bacteria) Resistance % (		6/10 (60%)	8/10 (80%)	10/10 (100%)	4/10 (40%)	3/10 (30%)	4/10 (40%)	60% MDR

Abbreviations: R Resistant, I Intermediate, S Susceptible, KP K. pneumoniae

Virulence gene detection

The examination of virulence gene profiles in the 10 K. pneumoniae isolates revealed the existence of multiple significant virulence factors. The mrkA gene, linked to fimbriae major subunit and biofilm production, was identified in 7 of 10 isolates (70%). The gene for the Adhesive Subunit of Type 3 Fimbriae (mrkD) was detected in 7 (70%) of the isolates. Additionally, siderophore synthesis (entB) genes were identified in 6 (60%) isolates. The capP gene, associated with heightened virulence, was identified in 6 (60%) isolates within the capsular polysaccharide production area (Table 4). The findings indicated that isolates KP2, KP3, KP8, and KP10, exhibiting a non-MDR phenotype, were devoid of the virulence genes entB and capP. Also, the virulence genes mrkA and mrkD were not detected in KP3, KP8 and KP10 isolates (Table 4).

Table 4.

Distribution of virulence genes in strains of K. pneumoniae isolated from chicken meat

Bacterial Isolate		Fimbriae major subunit	Adhesive Subunit of Type 3 Fimbriae	Capsular polysaccharide synthesis region	Siderophore	Phenotype
		mrkA	mrkD	capP	entB
Isolate 1	KP1	+	+	+	+	Highly virulence
Isolate 2	KP2	+	+	-	-	virulence
Isolate 3	KP3	-	-	-	-	Non- virulence
Isolate 4	KP4	+	+	+	+	Highly virulence
Isolate 5	KP5	+	+	+	+	Highly virulence
Isolate 6	KP6	+	+	+	+	Highly virulence
Isolate 7	KP7	+	+	+	+	Highly virulence
Isolate 8	KP8	-	-	-	-	Non- virulence
Isolate 9	KP9	+	+	+	+	Highly virulence
Isolate 10	KP10	-	-	-	-	Non- virulence
Positive number/ total number of bacteria (Distribution % (		7/10 (70%)	7/10 (70%)	6/10 (60%)	6/10 (60%)	---

Abbreviations: KP K. pneumoniae

Antimicrobial resistance gene detection

The molecular identification of antimicrobial resistance genes elucidated the genetic foundation for the detected phenotypic resistance. Genes that code for extended-spectrum β-lactamases (ESBLs) were widespread, with the blaSHV gene identified in 8 of 10 isolates (80%). Aminoglycoside genes, particularly aadA1, were discovered in 6 (60%) isolates, but the tetracycline tetB gene was present in 100% of the strains. Resistance genes for additional antibiotic classes comprised sul1 (sulfonamide resistance) in 4 (40%) isolates, dfrA1 (trimethoprim resistance) in 3 (30%) isolates, and qnr (quinolone resistance) in 4 (40%) isolates (Table 5). The analysis of antibiotic resistance gene profiles among the K. pneumoniae isolates revealed distinct patterns correlated with their multidrug-resistant (MDR) or non-MDR phenotypes. Notably, isolates KP2, KP3, KP8, and KP10, all categorized as non-MDR, were found to be devoid of the aadA1 antibiotic resistance gene. In contrast, the sul1 and qnr antibiotic resistance genes were detected in isolates KP1, KP4, KP7, and KP9, which were characterized as MDR. Further examination showed that the blaSHV antibiotic resistance gene was not detected in the non-MDR isolates KP2 and KP8. Additionally, the dfrA1 antibiotic resistance gene was identified in the MDR isolates KP1, KP7, and KP9. Interestingly, the tetB antibiotic resistance gene, associated with tetracycline resistance, was consistently detected in all 10 isolates, indicating a widespread presence of this particular resistance mechanism across both MDR and non-MDR strains.

Table 5.

Distribution of antibiotic resistance genes in strains of K. pneumoniae isolated from chicken meat

Bacterial Isolate		Streptomycin	Sulfonamide	Beta-lactams	Tetracycline	Trimethoprim	Quinolones	Phenotype
		aadA1	sul1	blaSHV	tetB	dfrA1	qnr
Isolate 1	KP1	+	+	+	+	+	+	MDR
Isolate 2	KP2	-	-	-	+	-	-	Non-MDR
Isolate 3	KP3	-	-	+	+	-	-	Non-MDR
Isolate 4	KP4	+	+	+	+	-	+	MDR
Isolate 5	KP5	+	-	+	+	-	-	MDR
Isolate 6	KP6	+	-	+	+	-	-	MDR
Isolate 7	KP7	+	+	+	+	+	+	MDR
Isolate 8	KP8	-	-	-	+	-	-	Non-MDR
Isolate 9	KP9	+	+	+	+	+	+	MDR
Isolate 10	KP10	-	-	+	+	-	-	Non-MDR
Positive number/ total number of bacteria) Distribution % (		6/10 (60%)	4/10 (40%)	8/10 (80%)	10/10 (100%)	3/10 (30%)	4/10 (40%)	---

Abbreviations: KP K. pneumoniae

Discussion

The present study demonstrates a high prevalence of multidrug-resistant (MDR) K. pneumoniae among isolates obtained from urinary tract infections, highlighting a concerning trend that aligns with recent surveillance studies worldwide. The observed 60% MDR rate is consistent with findings from hospital-based reports in Asia and the Middle East, where inappropriate antibiotic usage and limited infection control strategies have contributed to resistance development. Moreover, the coexistence of resistance and virulence determinants supports the concept that MDR strains may possess enhanced pathogenic potential [18, 19].

Resistance to tetracycline in all isolates (100%) indicates widespread dissemination of tetracycline resistance mechanisms, likely mediated by the tetB efflux system. Similar prevalence rates have been documented in clinical isolates from Iran, India, and China, suggesting that tetracycline has diminished therapeutic efficacy against K. pneumoniae in these regions. Overuse of tetracycline in clinical practice and animal husbandry may explain the persistence of these resistance determinants [20, 21].

The blaSHV gene was detected in 80% of the isolates; however, it is important to note that the SHV family includes both broad-spectrum β-lactamases (SHV-1, chromosomally encoded, responsible for innate resistance to ampicillin and amoxicillin) and extended-spectrum β-lactamases (ESBLs). Therefore, the presence of blaSHV alone does not necessarily indicate ESBL activity. Nevertheless, the frequent detection of SHV-type enzymes highlights their role as prominent resistance determinants in K. pneumoniae, particularly in regions with limited carbapenem stewardship [22, 23].

A positive correlation was observed between MDR phenotype and carriage of multiple virulence genes, including mrkA, mrkD, capP, and entB. Type 3 fimbriae encoded by mrkA and mrkD are essential for biofilm formation on urinary catheters and epithelial surfaces. Capsular synthesis genes such as capP enhance immune evasion by inhibiting complement-mediated killing and phagocytosis. Siderophore-mediated iron acquisition, particularly through entB, confers a survival advantage in iron-restricted host environments. These findings are consistent with prior studies demonstrating that MDR isolates often harbor larger virulence arsenals, contributing to persistence and therapeutic failure [24–26].

Compared with similar studies, the sample size in the present investigation is relatively limited; only 10 K. pneumoniae isolates were fully characterized. Therefore, conclusions regarding the general prevalence of resistance and virulence traits should be interpreted with caution. Nonetheless, the combined phenotypic and genotypic approach used in this study represents a methodological strength, allowing confirmation of resistance patterns and virulence determinants at the molecular level. This approach improves diagnostic accuracy over studies relying solely on disk diffusion assays [27].

Geographically, our isolates were collected from a limited region within Tehran, which may not fully reflect national trends. Additionally, the absence of sequencing-based strain typing restricts insights into clonal dissemination of resistant strains. Despite these limitations, the findings are consistent with international reports, suggesting that the observed patterns are not isolated events but part of a broader global resistance phenomenon [28, 29].

From a clinical perspective, the coexistence of MDR and high virulence potential may increase treatment failure, hospital stays, and patient morbidity. Meta-analyses have highlighted that MDR K. pneumoniae urinary tract infections are associated with adverse outcomes, particularly in ICU and catheterized patients. These observations underscore the need for continuous surveillance, stricter antibiotic policies, and effective infection control strategies [30, 31].

Future research should aim to expand the sample size and geographic coverage, incorporate whole-genome sequencing to assess clonal spread, and investigate plasmid-mediated gene transfer mechanisms [32, 33]. Evaluating alternative therapeutic approaches such as bacteriophages, antimicrobial peptides, or nanoparticle-based drug delivery systems may provide novel interventions. Strengthening antimicrobial stewardship programs and hospital infection control measures is imperative to curb the spread of MDR pathogens [15, 34, 35].

Study limitations

Although 60 urinary samples were collected, only 10 unique K. pneumoniae strains were successfully isolated and analyzed. This limited number of isolates may restrict the generalizability of our findings regarding the relationship between virulence and antimicrobial resistance. Nevertheless, each isolate was thoroughly characterized using both phenotypic and molecular approaches, providing meaningful preliminary insights. Future studies with larger sample sizes are needed to validate and expand upon these results. One notable limitation of the present study is that while the primers used were designed to detect blaSHV-type genes, including blaSHV-1, blaSHV-11, and blaSHV-12, the PCR-based approach alone cannot confirm which specific gene variant is responsible for ESBL production. To definitively determine the role of these genes in extended-spectrum β-lactamase activity, the PCR products would need to be sequenced and compared against a reference gene database. This limitation should be considered when interpreting the prevalence of ESBL-related resistance among the isolates.

Conclusion

The present study demonstrates a high prevalence of multidrug-resistant (MDR) K. pneumoniae among urinary isolates, accompanied by a substantial burden of virulence determinants, including mrkA, mrkD, capP, and entB. The frequent detection of resistance genes such as blaSHV and tetB explains the observed phenotypic resistance patterns and indicates extensive dissemination of resistance mechanisms within clinical settings. Importantly, MDR isolates consistently harbored a greater number of virulence genes compared with non-MDR strains, suggesting a critical link between antimicrobial resistance and pathogenic potential.

Collectively, these findings highlight the growing clinical challenge posed by highly virulent and MDR K. pneumoniae in urinary tract infections, which may contribute to treatment failure and increased risk of complications. Continuous molecular surveillance, rational antibiotic prescription, and implementation of effective infection control policies are essential for limiting further spread of resistant strains. Additionally, investment in alternative therapeutic strategies and advanced molecular typing methods is recommended to improve patient outcomes and reduce the public health impact of this escalating threat.

Authors’ contributions

Conceptualization, E.T., M.M.; methodology, H.M.; software, H.M. and M.M.; All authors reviewed the manuscript.

Funding

This research received no specific funding from public, commercial, or not-for-profit agencies.

Data availability

All datasets pertaining to the current study are available from the corresponding author, subject to reasonable request.

Declarations

Ethics approval and consent to participate

This study was conducted in accordance with the ethical principles outlined in the Declaration of Helsinki and its later amendments. Ethical approval was obtained from the Ethics Committee of the Islamic Azad University of Shahrekord Branch, Iran (approval code: IR.IAU.SHK.REC.1404).

Written informed consent to participate was obtained from all participants prior to their inclusion in the study

Ethical approval for this study was granted by the Ethics Committee of the Islamic Azad University of Shahrekord Branch, Iran, under reference IR.IAU.SHK.REC.1404.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.