Imidazopyridine derivatives as promising anti-Toxoplasma gondii agents: in vitro studies, in vivo testing, and molecular modeling analysis

Abstract

Toxoplasmosis continues to pose significant challenges to public health and animal husbandry, thereby generating an ongoing need for the development of novel therapies through innovative approaches. In response to the persistent pursuit of an optimal chemotherapeutic agent, the present study designed and synthesized new small molecules (6 and 9a–d) featuring an imidazopyridine scaffold linked to isatin derivatives via a hydrazide moiety. The efficacy of these compounds was evaluated against Toxoplasma gondii (ME49 strain) in both in vitro and in vivo murine models of chronic infection. Notably, most of the tested compounds exhibited significant antiparasitic activity. Compound 9a showed the lowest calculated LD₅₀ value, indicating strong potency, while compound 9c demonstrated excellent cysticidal activity in vitro, achieving 100% cyst mortality at concentrations ≥100 µg mL⁻¹. In vivo, compound 9c was the most effective treatment, reducing brain cyst burden by 82.7%. Molecular analyses indicated that compound 9c significantly reduced T. gondii DNA levels and strongly downregulated pro-inflammatory cytokines. Molecular docking analyses further validated the effective interactions between the synthesized compounds and the target enzyme T. gondii calcium-dependent protein kinase-1 (TgCDPK1). Collectively, these results highlight the promising anti-Toxoplasma potential of imidazopyridine–isatin hybrids, which provides a foundation for the further development of these hybrid molecules as therapeutic agents against toxoplasmosis.

Toxoplasmosis continues to pose significant challenges to public health and animal husbandry, thereby generating an ongoing need for the development of novel therapies through innovative approaches.

1. Introduction

Toxoplasma gondii is an obligate intracellular protozoan parasite with zoonotic potential, capable of infecting a wide range of warm-blooded species. Nearly one-third of the global population is estimated to be chronically infected.^1–5 Transmission occurs via multiple pathways, such as ingestion of contaminated food or water, transplacental (congenital) infection, organ transplants, and blood transfusions.⁶ While immunocompetent individuals typically remain asymptomatic, primary infection during pregnancy can lead to severe fetal outcomes, including ocular damage, cognitive impairments, intracranial calcifications, hydrocephalus, and congenital abnormalities.^7,8 Moreover, in immunocompromised individuals, reactivation of latent infection can trigger severe, often fatal, complications.^4,9

The intricate life cycle of T. gondii, which encompasses both sexual and asexual reproductive phases, complicates the development of effective therapeutic interventions. Sexual reproduction is restricted to the intestinal lining of feline definitive hosts, whereas asexual replication can take place within the nucleated cells of diverse intermediate hosts, including humans.⁵ At present, the conventional medical approach for treating T. gondii infection involves the combination of sulfonamides and pyrimethamine, which are effective only against the tachyzoite stage. However, within the context of maternity care, only spiramycin (Spy) has been approved by the National Medical Products Administration (NMPA) of China for therapeutic use. Also, it has limited efficacy against established infection.^10,11

While sulfonamides and pyrimethamine demonstrate efficacy primarily during the acute phase of infection, their application is limited by significant cytotoxicity.¹² Additionally, the use of alternative agents such as macrolides has been challenged due to emerging concerns regarding drug resistance.¹³ As a result, the currently available treatments suffer from significant drawbacks, including extended therapy periods, adverse toxic effects, and an inability to completely eliminate the parasite, particularly in immunocompromised patients.^14,15 Therefore, there exists a pressing need for the development of novel anti-toxoplasmosis agents that are effective not only against the acute phase of the infection but also capable of addressing chronic infection by reducing or eradicating tissue cysts, while exhibiting minimal toxicity.

Imidazopyridines have long been a subject of significant interest in both organic and medicinal chemistry.^16–18 These heterocyclic frameworks are prevalent in numerous pharmaceutical agents, exhibiting a diverse range of biological activities. Notable examples include saripidem I and alpidem II, which are used as hypnotic drugs, as well as zolpidem III (Ambien®), a widely prescribed treatment for insomnia (Fig. 1). Additionally, zolimidine IV (Fig. 1) serves as an effective gastroprotective agent.^19,20 Moreover, recent studies have expanded the potential therapeutic applications of imidazopyridines, highlighting their antibacterial,²¹ analgesic, anti-inflammatory,²² antiviral,²³ antitumor,²⁴ and antimalarial²⁵ properties.

Fig. 1. Chemical structure for some biologically active imidazopyridine, isatin and indole derivatives, as well as the target compounds (5, 9a–d).

Furthermore, these derivatives have demonstrated promising activity as anti-Toxoplasma agents.^26,27 For example, compound V (Fig. 1) has shown enhanced efficacy in inhibiting the invasion of T. gondii and related apicomplexan parasites. In vitro enzymatic assays further revealed its capacity to exhibit a polypharmacological profile, showing strong inhibitory activity against three essential parasitic kinases: TgPKG, TgCDPK1, and TgCK1α.²⁸ Also, Moine et al. synthesized a novel series of compounds based on a biphenylimidazoazine scaffold, designed as inhibitors of T. gondii proliferation in vitro. Among these, compound VI (Fig. 1) demonstrated a marked capacity to suppress intracellular replication of T. gondii, exhibiting an EC₅₀ ≤ 1 µM. Importantly, this compound showed no cytotoxic effects on human fibroblasts at the effective concentrations.²⁹

Isatin constitutes one of the most thoroughly studied scaffolds within the field of medicinal chemistry, owing to its capacity for diverse chemical modifications at multiple positions.^30,31 Isatin derivatives have been reported to demonstrate a wide range of biological activities, notably including antiviral,³² anticancer,³³ anti-mycobacterial,³⁴ antibacterial,³⁵ and antileishmanial effects.³⁶ Moreover, the isatin core and its derivatives have been employed in the design and preparation of several promising compounds targeting toxoplasmosis.^37,38 In addition, certain isatin-derived compounds, including indirubin VII (Fig. 1), have demonstrated notable anti-Toxoplasma activity, exhibiting efficacy at micromolar concentrations.³⁹ Furthermore, Arafa et al. developed an innovative series of compounds derived from the hybridization of isatin and triazole, demonstrating potent anti-Toxoplasma activity. Among these, compound VIII exhibited significant efficacy in both in vitro and in vivo assays, achieving the highest reduction percentages of tachyzoites in peritoneal fluid (98.1%) and liver impression smears (95.3%).⁴⁰ Moreover, indole derivatives, regarded as isosteres of the isatin scaffold, have demonstrated notable activity against Toxoplasma.⁴¹ For example, compounds IX and X have been documented to exhibit such activity.^42,43

Merging two or more pharmacophores into a single hybrid molecule is a well-established strategy in drug development, as it can enhance efficacy, expand the activity spectrum, and reduce the likelihood of cross-resistance compared to individual drugs. Building on previously reported data and our ongoing research on synthesizing novel anti-Toxoplasma agents,⁴⁴ this study utilized a hybrid pharmacophore approach to design and create five new compounds. These compounds are based on an imidazopyridine structure linked to an isatin scaffold through a hydrazide bond Fig. 1. Molecular docking studies demonstrated effective interactions with the target enzyme, calcium-dependent protein kinase 1 of T. gondii (TgCDPK1). Subsequently, these synthesized compounds were tested in vitro against Toxoplasma, followed by in vivo evaluation of their efficacy against chronic T. gondii infection in a mouse model.

2. Results and discussion

2.1. Chemistry

The synthetic pathways for the target hybrid molecules are outlined in Schemes 1 and 2. As shown in Scheme 1, the synthesis commenced with the condensation of 2-aminopyridine (1) and ethyl 2-chloroacetoacetate (2) in refluxing ethanol, yielding the key bicyclic intermediate, ethyl 2-methylimidazo[1,2-a]pyridine-3-carboxylate (3). This ester was then directly converted to the key compound, corresponding acid hydrazide 4, via reflux with hydrazine hydrate in aqueous ethanol.

Scheme 1. Reagents and conditions: (i) 1,2-dimethoxyethane, 90 °C, 6 h. (ii) N₂H₄·H₂0, ethanol, reflux, 3 h. (iii) Ethanol, reflux, 6 h.

Scheme 2. Reagents and conditions: (i) DMF/K₂CO₃/reflux 3 h. (ii) EtOH/reflux 10 h.

The final step in this scheme involved the condensation of hydrazide 4 with isatin (5) in ethanol, yielding the target acid hydrazone 6 with water as a byproduct. Scheme 2 details an alternative route to a series of derivatives. First, isatin (5) was N-alkylated by refluxing with various alkyl bromides (7a–d) in dimethylformamide (DMF), using potassium carbonate as a base, to produce the N-alkylisatin derivatives 8a–d. These alkylated isatins were then condensed with the pivotal acid hydrazide 4 in ethanol to furnish the second series of target compounds, the acid hydrazone derivatives 9a–d. The structures of all novel hybrid compounds were confirmed and characterized through comprehensive spectral analysis, including ¹H NMR and ¹³C NMR spectroscopy, as well as elemental analysis.

2.2. Biology

2.2.1. In vitro experiment

2.2.1.1. In vitro cytocidal activity of tested compounds against T. gondii ME49 cysts

The experiment assessed the efficacy of five novel test compounds (6, 9a–d) against chronic T. gondii (ME49 strain) brain cysts, using the established trypan blue exclusion assay to determine cyst viability. The cysts were subjected to a concentration gradient (1–1000 µg mL⁻¹) of each compound for 24 hours. Spiramycin served as the reference drug, and an untreated control group was included to establish a baseline of 100% viability.

The analysis revealed a clear dose–response relationship for all tested molecules; cyst mortality increased proportionally with compound concentration (Table 1). Among the test compounds, 9b and 9c emerged as the most potent, demonstrating complete (100%) cyst eradication at a concentration of 100 µg mL⁻¹. This maximal efficacy was sustained at the higher concentrations of 250 µg mL⁻¹ and 1000 µg mL⁻¹. Compound 9a also exhibited significant parasiticidal activity, achieving 100% cyst mortality, though this required the highest tested concentrations of 250 µg mL⁻¹ and 1000 µg mL⁻¹. In contrast, compound 6 induced only a moderate reduction in viability across the concentration range. Compound 9d proved to be the least effective of the series, showing minimal activity at all concentrations tested. A summary of the results, expressed as the percentage of non-viable cysts per 100, is provided in Table 1 for detailed comparison.

Table 1. The percentage of reduction in the number of T. gondii ME 49 brain cysts in post-treatment in vitro after incubation for 24 h in 100 cysts control.

Concentration (µg mL−1)	6	9a	9b	9c	9d
1	62%	31%	91%	93%	29%
2	70%	44%	96%	94%	29%
10	79%	91%	98%	96%	30%
50	83%	95%	99%	98%	50%
100	87%	99%	100%	100%	59%
250	91%	100%	100%	100%	68%
1000	78%	100%	100%	100%	70%

2.2.1.2. Calculation of median lethal dose (LD₅₀ and LD₉₀)

A positive correlation was observed between administered dose and cyst mortality for all compounds evaluated. To quantitatively assess their potency, probit analysis was conducted using SPSS software (version 7.5) to calculate the median lethal dose (LD₅₀) and the 90% lethal dose (LD₉₀). The resulting dose–response models revealed significant differences in cysticidal efficacy among the compounds, with LD₅₀ and LD₉₀ values detailed in Table 2.

Table 2. LD₅₀ and LD₉₀ values for the target compounds (6 and 9a–d).

Compound	LD50 (µg mL−1)	LD90 (µg mL−1)
6	158.30	189.27
9a	1.04	38.05
9b	144.70	117.77
9c	109.83	16.83
9d	254.19	1615.82

Analysis of the probit models identified compound 9a as the most potent agent, demonstrating the lowest LD₅₀ value (1.04 µg mL⁻¹) and a notably low LD₉₀ (38.05 µg mL⁻¹), indicating high efficacy across a broad dose range. Compound 9c also exhibited considerable activity, particularly in its ability to achieve 90% mortality at a low concentration (LD₉₀ = 16.83 µg mL⁻¹), despite a higher median lethal dose (LD₅₀ = 109.83 µg mL⁻¹). Compound 9b proved effective at elevated concentrations, achieving complete (100%) cyst death at 100 µg mL⁻¹, with corresponding LD values indicating moderate potency. In contrast, compounds 6 and 9d were characterized by higher LD₅₀ and LD₉₀ values, indicating lower antiparasitic activity compared with the other tested compounds. For compound 9d, the LD₉₀ value was estimated from the dose–response relationship, as 90% cyst mortality was not attained at the tested concentrations.

2.2.2. In vivo biological evaluation

2.2.2.1. Efficacy range of tested compounds based on brain cyst reduction in chronic toxoplasmosis

Building on the promising in vitro cytocidal assay results against T. gondii ME49 cysts, we are now advancing to in vivo efficacy studies using a murine chronic infection model. Our focus is on evaluating the ability of our target compounds to lower the brain cyst burden, a key indicator for effective anti-toxoplasmosis medications. The results revealed a striking differential efficacy across the treatment cohorts. The most potent activity was unequivocally demonstrated by compound 9c at the 1000 µg dose. This treatment group exhibited a profound, highly significant reduction in cerebral cyst load of 82.68% translating to a mere 25.67 cysts on average, compared to the infected, untreated controls. The statistical confidence here is very high, with a p-value of less than 0.001. In addition, compound 9b also exhibited highly efficacious activity, achieving a substantial 75.28% reduction in cyst load at the 1000 µg mL⁻¹ dose. Compound 9a demonstrated clear, dose-dependent efficacy. Its activity was strong at the high dose (64.05% reduction at 1000 µg mL⁻¹) and observable but more modest at the lower dose (31.23% at 250 µg mL⁻¹). Compound 6 showed moderate, dose–responsive activity. It achieved a 51.68% reduction at the highest tested dose (1000 µg mL⁻¹) and a 22.47% reduction at the 250 µg mL⁻¹ dose. Conversely, the minimal effect was observed in the group administered the 9d compound at the lowest tested dose of 250 µg. This regimen resulted in a negligible cyst reduction of only 6.96%, with a mean cyst count of 138. Importantly, this minor decrease was not statistically significant, indicating it is not distinguishable from the natural variation one might see in the control group. For a comprehensive view of the dose–response relationships and the performance of all other experimental groups, Table 3 provides the precise numerical data, including standard deviations, and Fig. 2 provides a graphical representation of the percentage reduction across all treatments.

Table 3. The % reduction in the brain cyst burden in different treated groups^a.

Group	Treatment	Mean number of brain cysts<br>(10 successive fields, mean ± SD)	% Reduction in the number of T. gondii brain cysts
I	Infected non treated	148.33 + 7.64	—
II	Treated with spiramycin	40 + 5***	73.03
IIIa	6 1000	71.67 + 7.64***	51.68
IIIb	Compound 6 250	115 + 5**	22.47
IVa	Compound 9a 1000	53.33 + 7.64***	64.05
IVb	Compound 9a 250	102 + 7.94**	31.23
Va	Compound 9b 1000	36.66 + 7.93***	75.28
Vb	Compound 9b 250	95.5 + 6.36**	35.62
VIa	Compound 9c 1000	25.67 + 4.04***	82.68
VIb	Compound 9c 250	81 + 4***	45.39
VIIa	Compound 9d 1000	98.33 + 2.52***	33.71
VIIb	Compound 9d 250	138 + 7	6.96

^aT, test for analysis of variance group. *** Highly significant difference from control group (p-value < 0.001). ** Statistically significant difference from infected control at p-value < 0.01.

Fig. 2. Graphical representation of the percentage reduction across all treatments.

2.2.3. Survival rate analysis

The majority of experimental groups exhibited complete survival of mice throughout the duration of the study, with the exception of those administered compound 9b. Specifically, in the cohort receiving 1000 µg of compound 9b, the average number of surviving mice following treatment was 2.2. In contrast, the group treated with 250 µg of compound 9b demonstrated a higher mean survival count of 3.9.

2.2.4. Molecular quantification of toxoplasmosis infection and host cytokine gene expression

Results obtained showed a significant decrease in parasite load in all treated groups compared to the infected nontreated group, Group II, indicating variable antiparasitic activity. Among the treated groups, the strongest reduction in parasites was experienced by Group VIIa (compound 9c at 1000 µg mL⁻¹), which is similar to spiramycin's reduction, followed by Group via (compound 9b at 1000 µg mL⁻¹), which suggests a dose-dependent antiparasitic action. The low-dose-treated groups (250 µg mL⁻¹) generally recorded higher levels of parasites compared to their corresponding high-dose-treated groups. Of special concern, IVb, Va, and VIIIb groups exhibited negligible decline, indicating lower efficacy of compounds a, b, and e at 250 µg mL⁻¹.

Pro-inflammatory (IL-6, TNF-α) and immunoregulatory (TGF-β) cytokine expression levels were elevated significantly in the infected non-treated group (Group II) compared with the non-infected control (Group I), evidencing intense immunity to T. gondii infection. Treatment with spiramycin (Group III) caused a significant but modest reduction in IL-6 and TGF-β, while TNF-α remained elevated, which indicates partial immunomodulation. Amongst the tested compounds, Groups VIa and VIIa (compounds 9b and 9c, both at 1000 µg mL⁻¹) were significantly downregulated for IL-6, TGF-β, and TNF-α relative to Group II, with expression levels reaching or comparable to those of the non-infected control. This suggests that these compounds possess anti-inflammatory and immunoregulatory properties in addition to their antiparasitic activity. Groups receiving the smaller doses (IVb, Vb, VIIIb) had less suppression of cytokine expression, indicating a dose-dependent effect (Fig. 3).

Fig. 3. Relative quantification (RQ) of T. gondii DNA and cytokine gene expression (IL-6, TGF-β, and TNF-α) in experimental mouse groups. a: p-value < 0.0001, b: p-value < 0.001, c: p-value < 0.05.

2.3. Molecular docking

Calcium-dependent protein kinase 1 (TgCDPK1) is essential for controlling a number of T. gondii physiological processes, such as adhesion, secretion, parasite movement, host-cell invasion, and egress.⁴⁵ TgCDPK1's crystal structure research showed a unique ATP binding site that is larger than that of a human kinase homolog. This structural feature implies that TgCDPK1 has a tiny glycine gatekeeper residue, which makes it possible for enzyme inhibitors to target a hydrophobic cavity next to the ATP binding site.^45,46 As a result, TgCDPK1 has great promise for the creation of inhibitors that target T. gondii infections.

Using the AutoDock, molecular docking was utilized to determine the binding patterns of the five most potent inhibitors 6, 9a, 9b, 9c and 9d to TgCDPK1. Docking parameters were verified as valid by redocking experiment revealing RMSD of 1.2849 from the cocrystal ligand (Fig. S1). Following docking, the protein ligand interaction analysis was conducted on the selected binding poses of the five inhibitors under investigation at the TgCDPK1 active site with the lowest docking score values. All five inhibitors had substantial binding affinities for TgCDPK1, as evidenced by docking score values that were either lower or comparable to the reference cocrystal ligand inhibitor Table 4.

Table 4. Docking scores (Kcal mol⁻¹) of 6, 9a, 9b, 9c and 9d into TgCDPK1.

Compound	Docking scores (Kcal mol−1)
6	−9.1
9a	−8.7
9b	−8.7
9c	−9.6
9d	−9.3
Ref	−8.7

In comparison to inhibitors 9a and 9b, which possess alkyl-substituted isatin moieties and exhibited activity comparable to the reference compound, inhibitor 6 with an unsubstituted isatin moiety and inhibitor 9d with arylalkyl-substituted isatin moieties demonstrated significantly higher affinity for the enzyme TgCDPK1. Notably, compound 9c, featuring an N-benzyl substitution, exhibited the lowest docking scores, indicative of the strongest binding affinity toward TgCDPK1. These findings are consistent with the previous experiment results obtained from both and in vivo assays against T. gondii.

In general, the imidazopyridine core was engaged in π-ion stacking with Glu135, while the isatin ring formed hydrophobic interactions. The substituents on the isatin ring were situated within the extended hydrophobic cavity, resulting in variations in affinity among the compounds. Also, compounds with high scores, including 6, 9c, and 9d, are illustrated in Fig. 4.

Fig. 4. Interaction analysis of compounds 6, 9c and 9d inside TgCDPK1 target enzyme.

The isatin moiety of compound 6 participated in hydrophobic interactions with Leu57, Val65, Ala78, and Leu181, in addition to a π–sulfur interaction with Met112. Its imidazo[1,2-a]pyridine scaffold was involved in π-ion stacking with Glu135 and Lys338. The two interactions with Met112 and Lys338 increased the affinity of compound A in spite of lacking a hydrophobic substituent on the isatin ring. The isatin moiety of compound 9c exhibited interactions similar to those of compound 6, with the exception that Met112 was excluded and Val130 was included in the interaction. The benzyl substituent on isatin was located within the extended hydrophobic cavity, establishing hydrophobic contact with Val65, Ala78, Lys80, and Ile194, alongside the π–sulfur interaction with Met112. The imidazopyridine core also engaged in π-ion stacking with Glu135. A similar interaction pattern to compound 9c was noted with compound 9d. These interactions resulted in nearly identical docking scores for these three compounds.

Regarding compounds 9a and 9b, the common interactions were observed for both the imidazo[1,2-a] pyridine and isatin scaffolds, as seen in Fig. 5. The alkyl substituent on the isatin ring was involved in hydrophobic interactions inside the extended hydrophobic cavity, but still less efficient than the aromatic derivatives, driving their docking scores higher. Hydrophobic interactions, consequently, are the primary factor contributing to the significant inhibitory activity of the compounds examined against TgCDPK1. The intermolecular interactions involving similar amino acid residues suggest comparable binding modes for the analyzed inhibitors within the hydrophobic pocket of the ATP-binding site of TgCDPK1, which is consistent with their similar experimental activities.

Fig. 5. Interaction analysis of compounds 9a and 9b inside TgCDPK1 target enzyme.

2.4. Prediction of pharmacokinetics

Compounds 6, 9a, 9b, 9c, and 9d were thoroughly assessed for drug-likeness and ADME characteristics using the SwissADME web server.⁴⁷ The evaluation of drug similarity included the use of Lipinski's rule of five (RO5)^48,49 as well as six physicochemical traits that are associated with drug-likeness: size, polarity, solubility, flexibility, saturation, and lipophilicity.^50,51 A detailed understanding of the in silico pharmacokinetics prediction of the investigated drugs is provided by Table 5 and Fig. S2. The analysis revealed that the reported reference ranges and the majority of the expected physicochemical attributes of compounds 6, 9a, 9b, 9c and 9d were significantly aligned. These compounds also exhibit moderate water solubility, as indicated by log S (Ali)⁵² and log S (ESOL) values,⁵³ with the exception of compounds 9c and 9d, which are poorly soluble (on log S (Ali)).

Table 5. Summary of the physicochemical characteristics and the ADMET parameter determined by SwissADME.

	6	9a	9b	9c	9d
Physicochemical properties
Molecular weight g mol−1 (≤500)49	319.32	347.37	375.42	409.44	423.47
Num. Heavy atoms	24	26	28	31	32
Num. arom. Heavy atoms	15	15	15	21	21
Saturation: sp3 hybridization (not less than 0.25)54	0.06	0.16	0.24	0.08	0.12
Num. Rotatable bonds (not more than 9 rotatable bonds)	3	4	5	5	6
Num. H-bond acceptors (≤10)49	4	4	4	4	4
Num. H-bond donors (≤5)49	2	1	1	1	1
XLOGP3 [4] (lipophilicity: Desirable between – 0.7 and +5.0)	3.29	3.84	4.8	4.97	5.43
TPSA (Topological polar surface area between 20 and 130 Å2)52	87.86 Å2	79.07 Å2	79.07 Å2	79.07 Å2	79.07 Å2
Water solubility	Moderately soluble	Moderately soluble	Moderately soluble	Poorly soluble	Poorly soluble
Log S (ESOL)53	−4.16	−4.58	−5.26	−5.68	−5.98
Log S (Ali)52	−4.81	−5.2	−6.19	−6.37	−6.85
Pharmacokinetic properties
BBB permeation55	No	No	No	Yes	No
GIT absorption55	High	High	High	High	High
Cytochromes P450: 3A4, 2C9, 2C19, 2D6, 1A2 inhibitor56	Inhibition of CYP1A2 and 2C9	Inhibition of CYP1A2, 2C9, 2C19 and 3A4	Inhibition of CYP1A2, 2C9, 2C19 and 3A4	Inhibition of CYP1A2, 2C9 and 2C19	Inhibition of CYP1A2, 2C9, 2C19 and 3A4
P-Glycoprotein substrate57	No	No	No	No	No
Bioavailability score58	0.55	0.55	0.55	0.55	0.55

Due to a low number of sp³ hybridized carbons relative to the total carbon count, only the saturation parameter—which measures the fraction of carbons in sp³ hybridization—deviates from the desired range.⁵⁴ High anticipated GIT absorption, no blood–brain barrier crossing (apart from compound 9c), and no potential binding of P-glycoprotein via the egg-boiled model by Dania⁵⁵ incorporated in the SwissADME⁴⁷ were among their encouraging pharmacokinetic characteristics. Additionally, among other variables, they showed potential suppression of two cytochromes P450 (CYP1A2 and 2C9).⁵⁶

Ultimately, the SwissADME platform's extensive in silico predictive drug-likeness and pharmacokinetics studies of compounds 6, 9a, 9b, 9c, and 9d have illuminated their interesting drug-likeness characteristics and potential as useful candidates for additional drug development initiatives.

2.5. In silico predicted toxicity

The OSIRIS Property Explorer,⁴⁵ which evaluates potential toxicity hazards such as mutagenicity, tumorigenicity, irritant, and reproductive effects, was used to examine the possible toxicity of the five derivatives 6, 9a, 9b, 9c and 9d. To find possible risks, this tool compares the molecules under investigation to others in its database that have been the subject of in vitro and in vivo investigations based on functional group similarities. The findings showed that all compounds had low risk on the toxicity examined parameters, as shown in Table 5. Additionally, we used the ProTox-III⁵⁹ online server to forecast the substances under study's acute toxicity. With a predicted LD₅₀ value of 2991 mg kg⁻¹ (except 9c has a value of 1485 mg kg⁻¹), they were categorized as potentially harmful and dangerous, falling into toxicity class 5 based on the data shown in Table 5, with the exception of compound 9c, which falls into class 4 (harmful). These substances, which have a toxicity rating of five out of six, are regarded as less potentially hazardous if consumed orally except for compound 9c.

3. Conclusion

This investigation centered on the rational design to synthesize a novel class of molecular hybrids compounds (6 and 9a–d), constructed by covalently tethering an imidazopyridine pharmacophore to isatin moieties via a hydrazide-based linker system. The antiprotozoal efficacy of this library was assessed through both in vitro assays against the ME49 strain of Toxoplasma gondii and in vivo evaluation using a murine model of chronic toxoplasmosis. A structure–activity relationship (SAR) analysis revealed that the majority of the synthesized derivatives possessed marked parasiticidal activity, with analogues 9a and 9c distinguished as lead candidates. In particular, 9c demonstrated robust in vivo performance, achieving an 82.7% reduction in cerebral cyst burden, while 9a stood out for its superior intrinsic potency, reflected in the lowest median lethal dose (LD₅₀) among the series. Mechanistic interrogation indicated that 9c acts, at least in part, through suppression of parasitic DNA replication and attenuation of host pro-inflammatory cytokine cascades. Complementing these findings, in silico molecular docking studies substantiated the target engagement hypothesis, revealing favorable binding interactions with the calcium-dependent protein kinase TgCDPK1. Collectively, these imidazopyridine–isatin conjugates constitute a structurally novel and pharmacologically versatile chemotype, warranting further lead optimization and preclinical development as anti-toxoplasmosis agents.

4. Materials and methods

4.1. Chemistry

Melting points were measured using the Electrothermal IA 9000 apparatus, and no corrections were applied to these values. Elemental analyses (FLASH 2000 CHN analyzers, Thermo Scientific (USA)) were carried out at the Regional Center for Mycology and Biotechnology (RCMB), Al-Azhar University, Nasr City, Cairo. Chemical shifts are reported in δ (ppm), while coupling constants are expressed in Hz. Thin-layer chromatography (TLC) was employed to monitor the reactions, utilizing silica gel on aluminum sheets (60 F254, Merck) with a chloroform/methanol (9.8 : 0.2 v/v) eluent, which was subsequently visualized using iodine-potassium spray. Compounds 3 and 4 were synthesized according to previously established methods.⁶⁰

4.1.1. General methodology for the synthesis of the target compounds 6, 9a, 9b, 9c and 9d

A solution containing equimolar amounts (0.001 mol) of acid hydrazide 4 and selected isatin derivatives, namely isatin, N-ethylisatin, N-isobutylisatin, N-benzylisatin, and/or N-ethylphenylisatin (0.001 mol), was prepared in absolute ethanol (15 mL) and refluxed for 10 hours. After cooling, the precipitated product was isolated via filtration and purified by recrystallization from ethanol, affording the desired acid hydrazone derivatives 6, 9a, 9b, 9c and 9d, respectively, in pure form.

4.1.1.1. 2-Methyl-N′-(3-oxoindolin-2-ylidene)imidazo[1,2-a]pyridine-3-carbohydrazide (6)

Yellow powder, m.p. 287–288 °C, yield (84%). HPLC: R_T 5.90 min (purity: 99.90%); ¹H NMR (500 MHz, DMSO-d₆): δ = 2.75 (s, 3H, CH₃), 6.91 (d, 1H, J = 8.5 Hz, H–Ar), 7.05 (t, 1H, J = 8.0 Hz, H–Ar), 7.14–7.17 (m, 1H, H–Ar), 7.32–7.35 (m, 1H, H–Ar), 7.49–7.55 (m, 2H, H–Ar), 7.64 (d, 1H, J = 9.0 Hz, H4-isatin), 9.34 (d, 1H, J = 7.5 Hz, H5-imidazopyrdine), 11.22 (s, 1H, NH), 13.36 (s, 1H, NH). ¹³C NMR (126 MHz, DMSO-d₆) δ = 17.16 (CH₃), 111.67, 114.80, 116.92, 120.58, 121.22, 123.20, 128.41, 129.05, 137.33, 142.74, 146.83, 148.42, 156.88, 157.92, 163.07, 183.52 (C O–isatin). Analysis for C₁₇H₁₃N₅O₂ (319.32), calcd.: % C, 63.94; H, 4.10; N, 21.93; found: % C, 64.03; H, 4.22; N, 22.06.

4.1.1.2. N′-(1-Ethyl-3-oxoindolin-2-ylidene)-2-methylimidazo[1,2-a]pyridine-3-carbohydrazide (9a)

Yellow powder, m.p. 242–243 °C, yield (79%). HPLC: R_T 6.70 min (purity: 99.66%); ¹H NMR (500 MHz, DMSO-d₆): δ = 1.18 (t, 3H, J = 7.5 Hz, CH₃), 2.78 (s, 3H, CH₃), 3.77 (q, 2H, J = 7.5 Hz, CH₂), 7.13–7.18 (m, 2H, H–Ar), 7.20 (d, 1H, J = 8.0 Hz, H–Ar), 7.42–7.45 (m, 1H, H–Ar), 7.51–7.54 (m, 1H, H–Ar), 7.61 (d, 1H, J = 7.5 Hz, H–Ar), 7.67 (d, 1H, J = 9.0 Hz, H4-isatin), 9.37 (d, 1H, J = 7.0 Hz, H5-imidazopyrdine), 13.31 (s, 1H, NH). ¹³C NMR (126 MHz, DMSO-d₆) δ = 13.15 (CH₃), 17.33 (CH₃), 51.87 (CH₂), 110.57, 114.86, 117.03, 120.07, 121.11, 123.67, 128.45, 129.09, 131.98, 133.75, 142.94, 148.19, 148.63, 157.93, 160.92, 186.02 (C O–isatin). Analysis for C₁₉H₁₇N₅O₂ (347.37), calcd.: % C, 65.69; H, 4.93; N, 20.16. Found: % C, 65.82; H, 5.03; N, 20.28.

4.1.1.3. N′-(1-Isobutyl-3-oxoindolin-2-ylidene)-2-methylimidazo[1,2-a]pyridine-3-carbohydrazide (9b)

Yellow powder, m.p. 227–228 °C, yield (88%). HPLC: R_T 6.66 min (purity: 99.95%); ¹H NMR (500 MHz, DMSO-d₆): δ = 0.89 (d, 6H, J = 7.0 Hz, 2CH₃), 2.04–2.10 (m, 1H, CH), 2.79 (s, 3H, CH₃), 3.56 (d, 2H, J = 7.5 Hz, CH₂), 7.12–7.18 (m, 2H, H–Ar), 7.20 (d, 1H, J = 8.0 Hz, H–Ar), 7.40–7.44 (m, 1H, H–Ar), 7.51–7.54 (m, 1H, H–Ar), 7.60 (d, 1H, J = 7.5 Hz, H–Ar), 7.66 (d, 1H, J = 9.0 Hz, H4-isatin), 9.36 (d, 1H, J = 7.5 Hz, H5-imidazopyrdine), 13.32 (s, 1H, NH). ¹³C NMR (126 MHz, DMSO-d₆) δ = 16.14 (CH₃), 20.45 (2CH₃), 27.32 (CH), 53.01 (CH₂), 114.38, 117.00, 119.90, 120.99, 123.69, 128.44, 129.09, 131.91, 136.35, 143.67, 145.14, 148.62, 150.32, 157.92, 161.51, 187.17 (C O–isatin). Analysis for C₂₁H₂₁N₅O₂ (375.16), calcd.: % C, 67.18; H, 5.64; N, 18.65. Found: % C, 67.30; H, 5.76; N, 18.77.

4.1.1.4. N′-(1-Benzyl-3-oxoindolin-2-ylidene)-2-methylimidazo[1,2-a]pyridine-3-carbohydrazide (9c)

Yellow powder, m.p. 231–232 °C, yield (77%). HPLC: R_T 8.61 min (purity: 99.92%); ¹H NMR (500 MHz, DMSO-d₆): δ = 2.80 (s, 3H, CH₃), 5.00 (s, 2H, CH₂), 7.00 (d, 1H, J = 8.5 Hz, H–Ar), 7.09–7.17 (m, 2H, H–Ar), 7.23–7.26 (m, 1H, H–Ar), 7.30–7.37 (m, 5H, H–Ar), 7.49–7.53 (m, 1H, H–Ar), 7.60 (d, 1H, J = 8.00 Hz, H–Ar), 7.65 (d, 1H, J = 9.0 Hz, H4-isatin), 9.37 (d, 1H, J = 8.00 Hz, H5-imidazopyrdine), 13.26 (s, 1H, NH). ¹³C NMR (126 MHz, DMSO-d₆) δ 16.66 (CH₃), 50.93 (CH₂), 114.86, 116.91, 121.06, 122.34, 122.92, 123.85, 124.20, 125.35, 126.54, 127.85, 129.27, 132.42, 134.50, 136.15, 150.23, 153.60, 159.33, 161.25, 184.96 (C O–isatin). Analysis for C₂₄H₁₉N₅O₂ (409.44), calcd.: % C, 70.40; H, 4.68; N, 17.10. Found: % C, 70.53; H, 4.78; N, 17.22.

4.1.1.5. 2-Methyl-N′-(3-oxo-1-phenethylindolin-2-ylidene)imidazo[1,2-a]pyridine-3-carbohydrazide (9d)

Yellow powder, m.p. 210–212 °C, yield (83%). HPLC: R_T 9.79 min (purity: 99.36%); ¹H NMR (500 MHz, DMSO-d₆): δ = 2.72 (s, 3H, CH₃), 2.90 (t, 2H, J = 7.5 Hz, CH₂–Ph), 3.96 (t, 2H, J = 8.00 Hz, CH₂–N), 7.10–7.17 (m, 4H, H–Ar), 7.22–7.25 (m, 4H, H–Ar), 7.37–7.40 (m, 1H, H–Ar), 7.50–7.53 (m, 1H, H–Ar), 7.58 (d, 1H, J = 7.00 Hz, H–Ar), 7.65 (d, 1H, J = 9.0 Hz, H4-isatin), 9.34 (d, 1H, J = 7.5 Hz, H5-imidazopyrdine), 13.22 (s, 1H, NH). ¹³C NMR (126 MHz, DMSO-d₆) δ 17.33 (CH₃), 33.47 (CH₂), 52.95 (CH₂), 110.72, 114.32, 114.81, 116.97, 119.82, 120.98, 123.63, 127.02, 128.41, 128.90, 129.40, 131.87, 136.24, 138.63, 143.02, 146.93, 148.59, 155.89, 157.80, 161.04, 178.02 (C O–isatin). Analysis for C₂₅H₂₁N₅O₂ (423.47), calcd.: % C, 70.91; H, 5.00; N, 16.54. Found: % C, 71.03; H, 5.11; N, 16.66.

4.2. Biology

4.2.1. In vitro experiment

4.2.1.1. Isolation of T. gondii cysts from chronically infected mice brains

T. gondii ME49 cysts were isolated from Swiss albino mice chronically infected via intraperitoneal inoculation with 10 cysts.⁶¹ Two months post-infection, brains were homogenized in PBS (pH 7.2) containing 1% Tween 80 to disrupt tissue and release cysts.⁶² The homogenate was filtered through a 40 µm cell strainer to remove debris,⁶³ followed by Percoll gradient centrifugation (30%/90%) for cyst purification.⁶⁴ After two PBS washes, cysts were resuspended in RPMI-1640 medium supplemented with antibiotics (100 U mL⁻¹ penicillin, 100 µg mL⁻¹ streptomycin, and 0.25 µg mL⁻¹ amphotericin B).⁶³

4.2.1.2. Experimental design

The study assessed the antiparasitic efficacy of five compounds, 6, 9a, 9b, 9c, and 9d, compared with a reference drug, spiramycin, and an untreated infected control. Each treatment was applied at concentrations of 1 µg mL⁻¹, 2 µg mL⁻¹, 10 µg mL⁻¹, 250 µg mL⁻¹, and 1000 µg mL⁻¹. The drugs were dissolved in DMSO to 50 mg mL⁻¹, and the final concentration of solvent was not higher than 2.00%.⁶⁴

Group I (control): untreated cysts in RPMI-1640 only.

Group II infected, treated with compound 6.

Group III infected, treated with compound 9a.

Group IV infected, treated with compound 9b.

Group V infected, treated with compound 9c.

Group VI infected, treated with compound 9d.

Group VII (drug control) infected, treated with spiramycin.

4.2.1.3. Initial cytocidal assay

In 96-well plates, 100 cysts per well⁶⁵ were exposed to each compound for 24 hours at 37 °C with 5% CO₂. Each concentration was tested in triplicate⁶⁶

4.2.1.4. Viability assessment by trypan blue exclusion

Following incubation, cysts were stained with 0.4% trypan blue for 5 minutes. Viable (unstained) and non-viable (blue-stained) cysts were counted using a hemocytometer under a light microscope at 400× magnification. The number of viable cysts in each treated sample was compared to the control group (untreated cysts in RPMI-1640 only), which was set to 100 cysts.⁶⁷

4.2.1.5. Calculation of percentage reduction

The percentage reduction in viable cysts was calculated as follows:Percentage reduction (%) = [(number of viable cysts in control − number of viable cysts in treated group)/number of viable cysts in control] × 100.

4.2.1.6. Calculation of LD₅₀ and LD₉₀

Probit analysis is used to define the lethal concentration values (Finney, 1971).⁶⁸ Values were expressed as mean ± S.E., and the obtained data were analyzed using SPSS v. 7.5 for Windows (SPSS Inc. 2008).

4.2.2. In vivo experiment

4.2.2.1. Experimental animals

The study utilized seventy-eight male Swiss albino mice, aged between 6 and 8 weeks, with body weights ranging from 20 to 25 grams. The mice were housed in the animal facility of Theodor Bilharz Research Institute under controlled environmental conditions (temperature and light cycle). They were kept in wired cages and had free access to standard mouse feed and water throughout the study in accordance with animal welfare standards and with approval from the Institutional Animal Care and Use Committee (IACUC), approval number KFS-IACUC/288/2025.

4.2.2.2. Parasite strain

The avirulent ME49 strain of T. gondii was sourced from the Theodor Bilharz Research Institute in Giza, Egypt. It was maintained by serial oral passage in mice, with reinoculation occurring every 8 weeks using 0.1 mL of brain homogenate containing approximately 20 cysts derived from previously infected animals as described by ref. 69.

4.2.2.3. Drug information

Spiramycin was obtained from Sigma-Aldrich, Germany. The preparation followed the protocol outlined in a previous study,⁷⁰ with a final dosage of 100 mg kg⁻¹ given orally for 10 days.

4.2.2.4. Preparation of the inoculum

The brain of a previously infected mouse was homogenized in 1 mL of 0.85% saline solution. An aliquot of 0.1 mL of the brain suspension was placed on a glass slide, and the number of tissue cysts was counted under a high-power objective lens (×40) using a tissue homogenizer technique, as previously described.⁷¹

4.2.2.5. Grouping of mice

Mice were randomly divided into 8 groups, 6 mice each, according to Table 6.

Table 6. Predicted toxicity for the studied compounds.

	Chronic toxicity risksa (OSIRIS)				Acute oral toxicityb (ProTox-III)
	MUT	TUM	IRRIT	RE	LD50 (mg kg−1)	Toxicity class (1–6)
6	Low	Low	Low	Low	2991	5
9a	Low	Low	Low	Low	2991	5
9b	Low	Low	Low	Low	2991	5
9c	Low	Low	Low	Low	1485	4
9d	Low	Low	Low	Low	2991	5

^aToxicity include MUT (mutagenicity), TUM (tumorigenicity), IRRIT (irritation), and RE (reproductive effects).

^bThe toxicity class: class 1 (fatal if LD₅₀ ≥ 5 mg kg⁻¹), class 2 (fatal if 5 ≥ LD₅₀ ≥ 50 mg kg⁻¹), class 3 (toxic if 50 ≥ LD₅₀ ≥ 300 mg kg⁻¹), class 4 (harmful if 300 ≥ LD₅₀ ≥ 2000 mg kg⁻¹), class 5 (potentially harmful if 2000 ≥ LD₅₀ ≥ 5000 mg kg⁻¹), and class 6 (nontoxic if LD₅₀ > 5000 mg kg⁻¹).

Group I	Non-infected non-treated
Group II	Infected non-treated control group
Group III	Infected treated with spiramycin 100 mg kg−1
Group IVa	Infected treated with compound 6 1000 µg mL−1
Group IVb	Infected treated with compound 6 250 µg mL−1
Group Va	Infected treated with compound 9a 1000 µg mL−1
Group Vb	Infected treated with compound 9a 250 µg mL−1
Group VIa	Infected treated with compound 9b 1000 µg mL−1
Group VIb	Infected treated with compound 9b 250 µg mL−1
Group VIIa	Infected treated with compound 9c 1000 µg mL−1
Group VIIb	Infected treated with compound 9c 250 µg mL−1
Group VIIIa	Infected treated with compound 9d 1000 µg mL−1
Group VIIIb	Infected treated with compound 9d 250 µg mL−1

4.2.2.6. Treatment and euthanasia

Treatment of mice started 30 days p.i. with two different concentrations of each compound dissolved in DMSO and given orally, and continued for 3 successive days. Scarification of mice takes place 40 days p.i., where the death rate of mice was calculated.

4.2.2.7. Quantification of brain cysts

Smears were prepared from 0.5 mL of saline homogenate derived from one hemisphere of each mouse's brain, as previously described.⁷² After air-drying, the smears were stained using Giemsa stain and examined under an oil immersion objective lens.⁷³ The parasite burden was assessed microscopically by counting the number of cysts in 10 high-power fields (HPFs) from each smear.

The percentage reduction (R%) in cyst count was calculated using the following formula:R% = [(C − E)/C] × 100where C represents the mean cyst count or size in the control group (GI), and E is the corresponding mean in each treated group.

4.2.2.8. Molecular quantification of toxoplasmosis infection and host cytokine gene expression

The brain tissue samples were homogenized with the lysis buffer of a magnetic bead-based DNA purification kit (Qiagen Co.) to obtain total DNA. In addition, RNA was extracted from blood using a magnetic bead-based RNA purification kit (Qiagen Co.). A NanoDrop2000 spectrophotometer (Thermo Fisher, USA) was used to determine the concentration and the purity of the DNA and RNA that was pulled out. In RNA samples, reverse transcription was done to produce a complementary DNA (cDNA), followed by cDNA synthesis using RevertAid First Strand cDNA Synthesis kit (Thermo Fisher, USA). Relative quantification was carried out using 2× Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher, USA) and specifically designed primers in Table 7. The cycling parameters were: 95 °C for 15 min followed by 40 cycles of (95 °C denaturation for 20 s, annealing specific to each primer for 20 s, 72 °C extension for 25 s). The relative quantitation was calculated using the formula {2^−ΔΔC_t} to determine the level of expression of genes encoding pro-inflammatory and immunoregulatory cytokines (IL-6, TNF-α, and TGF-β), in addition to detecting and quantifying T. gondii infection.

Table 7. Primer sequences for toxoplasmosis detection and cytokine markers.

Gene	Primer sequence	Reference
β-Actin	Sense: GGGAATGGGTCAGAAGGACT	74
	Antisense: CTTCTCCATGTCGTCCCAGT
IL-6	Sense: ACAAGTCCGGAGAGGAGACT	75
	Antisense: GTGACTCCAGCTTATCTCTTGGT
TGF-β	Sense: CGTGGAAATCAACGCTCCAC	76
	Antisense: CCACGTAGTAGACGATGGGC
TNF-α	Sense: ACCCTCACACTCACAAACCA	77
	Antisense: GGCAGAGAGGAGGTTGACTT
Toxo ITS1	Sense: GATTTGCATTCAAGAAGCGTGATAGTA	78
	Antisense: AGTTTAGGAAGCAATCTGAAAGCACATC

4.2.2.9. Statistical analysis

Data in this study were presented as mean with SD. Statistical analysis was performed using GraphPad Prism 8 (San Diego, CA, USA). T-Test, one-way or two-way ANOVA was used. p-Value < 0.05 was determined to be statistically significant. a: p-Value < 0.0001, b: p-value < 0.001, c: p-value < 0.05.

4.3. Molecular modeling

The RCSB PDB provided the structural coordinates of the TgCDPK1 protein in pdb format (Code 6BFA⁷⁹). Water and other non-protein moieties were removed using AutoDockTools, and hydrogen atoms were added.⁸⁰ The 2D and 3D geometric structures of the ligand compounds were made using Marvin Sketch.⁸¹ In the current docking study, AutoDock Vina was chosen to predict protein–ligand interactions and binding affinities.⁸² The grid box, which measured 22.5 Å × 17.4 Å × 14.7 Å, was defined by the center of the co-crystallized ligand (x, y, z; 1.1, −22.2, −31.3). Discovery Studio Visualizer was used to analyze and display the docking results.⁸³

Ethical statement

The animal study was approved by the institutional Animal Care and use committee (KFS-IACUC), Kafrelsheikh University: ethical approval number (KFS-IACUC/288/2025). The study was conducted in accordance with ARRIVE guidelines, as well as complying with the local legislation and institutional requirements.

Author contributions

Ahmed Sabt: writing – review & editing, writing – original draft, supervision, methodology, investigation, data curation, conceptualization. Hend Okasha: methodology, data curation. Writing – original draft, Hanaa Farag; methodology, data curation. Writing – original draft. Zeinab H. Fahmy & Eman A. H. Selim; data curation, software, methodology. Hoda Atef Abdelsattar Ibrahim: writing – review & editing, validation, conceptualization, data curation. Mohamed G. Thabit: methodology, investigation, data curation. Abdullah F. Radwan: investigation, data curation. Wagdy M. Eldehna, writing – review & editing, supervision, formal analysis, conceptualization. RehamR.Mostafa; writing – original draft, methodology, formal analysis, conceptualization.

Conflicts of interest

The authors declare no conflict of interest. The authors alone are responsible for the content and writing of the paper.

Data availability

All required data inserted in manuscript and supplementary information (SI). Supplementary information is available. See DOI: https://doi.org/10.1039/d6ra04816a.