Orlistat potentiates the gemcitabine effect in inhibiting the malignant biological behavior of nasopharyngeal carcinoma by downregulating PKM2

Abstract

Background

Gemcitabine (GEM)-based chemotherapy is essential for treating recurrent or metastatic nasopharyngeal carcinoma (NPC). However, the limited sensitivity, coupled with the associated toxicities and side effects, hinder its overall efficacy. Orlistat (Orli), a US FDA-approved weight loss drug and fatty acid synthase (FASN) inhibitor, can slow NPC progression and improve treatment outcomes, but these effects are largely unstudied.

Methods

The cell counting kit-8 (CCK-8) assay, colony formation assay, scratch wound healing assay, glucose uptake assay, online soft SynergyFinder analysis and xenograft assay were conducted to evaluate the effect of Orli combined with GEM on NPC inhibition in vitro and in vivo. Additionally, lentivirus transfection, and bioinformatics analyses were employed to explore the underlying mechanisms.

Results

In vitro experiment revealed that Orli inhibited cell proliferation, colony-formation, glycolysis and migration ability of NPC while also demonstrating a synergistic effect when combined with the chemotherapeutic agent GEM. Mechanistically, the data showed that Orli significantly reduced pyruvate kinase M2(PKM2) expression, which significantly suppressed NPC cell proliferation and migration, thereby enhancing the therapeutic effect of GEM both in vitro and in vivo.

Conclusions

Oril may serve as a promising chemosensitizer in conjunction with GEM to improve the prognosis of patients with NPC.

Supplementary Information

The online version contains supplementary material available at 10.1007/s12672-026-05186-8.

Introduction

Nasopharyngeal carcinoma (NPC) which mainly occurs in East and Southeast Asia has reported better clinical outcomes and a reduction in recent years due to developments in diagnosis and treatment method [1]. However, 70% of NPC cases are still diagnosed at advanced stages, leading to poor prognosis of these advanced cases [2, 3]. In recent years, referring to the result of landmark GEM20110714 study [4], induction or adjuvant chemotherapy regimen composing of gemcitabine(GEM) plus platinum has been recommended as the first-line regimen for recurrent or metastatic NPC (RM-NPC) patients [5]. However, in one case, descent sensitivity to chemotherapy drug severely impaired the therapeutic effect of chemotherapy regimen, continuous increase of chemotherapy dose does not increase efficacy and survival rate [6].Take gemcitabine as an illustration, gemcitabine, also known as 2′,2′-difluoro 2′-deoxycytidine (dFdC), is a specific deoxycytidine nucleoside analog of fluorinated pyrimidine which play as a backbone role in NPC chemotherapy [7]. Monotherapy GEM was also recommended as salvage treatment based on the National Comprehensive Cancer Network guidelines. Nevertheless, the survival benefit of GEM exerting on RM-NPC patients remains limited. It has been reported that GEM momotherapy only extended the median time to progression ranging from 3.6 to 5.1 months which remain a huge room for improvement [8, 9]. In other case, the toxic and side effect such as myelosuppression also hinder the chemotherapy process [10]. Therefore, novel therapeutic strategies with good efficacy and low toxic and side effect in patients with RM-NPC are of urgent need.

Orlistat (Orli) is a safe and commonly used weight loss agent approved by the Food and Drug Administration (FDA) in the US [11]. Orli exerted its weight-loss effect by primarily and potently suppressing fatty acid synthase (FASN) and activating adipose triglyceride lipase (ATGL) [12], leading to the decreasing absorption of fats from the human diet. Apart from its powerful effect on losing weight, Orli recently has been reported to demonstrated potential antitumor activity in various types of cancers in vitro and in vivo, including lung cancer, breast cancer, prostate cancer, and ovarian cancer [13–15]. However, the role of Orli in NPC progression and clinical significance in NPC related chemotherapy, such as in combination with GEM, remains largely unexplored.

In the present work, by mainly utilizing the human NPC cell lines C6661 and HK1, we found that through downregulating PKM2 expression, Orli significantly suppressed the growth and migration of NPC cells and enhanced GEM therapeutic effect in vitro and in vivo.

Materials and methods

Cell lines and culture methods

A normal nasopharyngeal cell line, NP69, was acquired from Pricella (CAT#CL-0804) and maintained in NP69SV40T medium, also sourced from Pricella (CAT#CM-0804). Human NPC cell lines C6661, CNE1, CNE2 and HK1 were purchased from XY Biotechnology (CAT#XY-H432, CAT#XY-H135, CAT#XY-H136 and CAT#XY-H572, respectively) and cultured in Roswell Park Memorial Institute-1640 (RMPI-1640) supplemented with 10% fetal bovine serum and 0.1% penicillin-streptomycin. All cell lines were incubated at 37℃ in a 5% CO₂ humidified incubator. Mycoplasma testing was conducted on all cell lines, yielding negative results.

Orlistat preparation

Orlistat was purchased from the company in powder form and is recommended to be dissolved with DMSO. When in use, the control group needs to add an equal volume of DMSO to ensure the rigor of the experiment.

Cell proliferation assay

Cell proliferation viability was assessed using a cell counting kit-8 (CCK-8) assay according to the manufacturer’s instructions (CAT#FH783, DOJINDO, Japan). Briefly, cells were digested and then plated in 96-well plates at a density of 1 × 10³ cells per well. At 12, 24, 36 and 48 h, 100 µl detection reagent (comprising 10 µl of reagent and 90 µl of cultured medium) was added to each cell and subsequently incubated at 37℃ for 2 h. After incubation, cell proliferation viability was then measured using a microplate reader at 450 nm absorbance.

Colony formation assay

NPC cells were digested and seeded into a 6-well plate at a density of 400 cells per well with 2 ml complete cultured medium and then incubated for 10–14 days. Next, the plates were fixed with methanol at room temperature for 0.5 h and stained with Giemsa dye for 20 min. After rinsing, the plates were photographed, and the number of clones was counted by two independent observers.

Scratch wound healing assay

Briefly, NPC cells were digested and then seeded into a 6-well plate at a density of 1 × 10⁵ cells per well with 2 ml complete cultured medium. Once a monolayer formed, a 10 µl pipette tip was utilized to create a scratch wound in each well. After being washed twice with PBS, the complete cultured medium was replaced with serum-free medium. Photographs of three randomly selected microscopic fields (×200) were taken at 12, 24, and 36 h to evaluate the migratory capacity of the cells. The wound healing area was quantified using ImageJ software, while GraphPad 9.0 software was utilized to analyze the cell migration ratio.

Reverse transcription-quantitative PCR (RT-qPCR)

Treated cells were harvested, and total RNA was extracted from NPC cells using TRIzol Reagent (Life Technologies, Carlsbad, CA, USA). Then, complementary DNA (cDNAs) were synthesized with reverse transcriptase (Promega, Madison, WI, USA) according to the manufacturer’s instructions. RT-qPCR reactions were conducted using SYBR Select Master Mix (Invitrogen) following the manufacturer’s protocols. All primers utilized are listed as follows: β-actin, Forward Primer: CATGTACGTTGCTA TCCAGGC, Reverse Primer༚CTCCTTAATGTCACGCACG AT; PKM2, Forward Primer༚AAGGGTGTGAACCTTCCTGG; Reverse Primer༚GCTCGACCC CAAACTTCAGA; BAX, Forward Primer༚TCAGCGCCTTTGTGAGGAG, Reverse Primer༚CAGGCAAGGATCAGGTAGGTG༛BCL-2, Forward Primer༚GAGC CATCTCAGTGTGTGGAG, Reverse Primer༚TCTGGGTAGCTTTGTCTTCCT; MMP2, Forward Primer༚TCGGAATGGGACAGACCTACT, Reverse Primer༚TCAAAGGGGTCACATTGCTCC༛Forward Primer༚TGTACCGCTATGGTTACA CTCG, Reverse Primer༚GGCAGGGACAGTTGCTTCT.

In vivo mouse study

Male BALB/c nude mice (4–5 weeks) were purchased from the Guangdong Medical Laboratory Animal Center (Guangzhou, China). In the xenograft tumor model, 1.0 × 10⁶ C6661 or HK1 cells were subcutaneously injected into the dorsal skin of the mice. Once the tumor volume reached approximately 4 × 4 × 4 mm, treatment commenced with Orli (100 mg/kg, administered intraperitoneally (i.p.), every other day, Cat#T0686, TargetMol, Shanghai, China) and GEM (50 mg/kg, administered i.p. twice a week, Cat#T0251, Targetmol, Shanghai, China). Tumor dimensions (long (L) and short (S) diameters) were measured daily using calipers. After 17–19 days, mice were euthanized, and tumors were excised, weighed and subjected to paraformaldehyde fixation and paraffin embedding for further analysis. The tumor volume (TV) was calculated using the formula: TV = (L × S²)/2. In the mice survival model, for ethical considerations, the survival was determined by sacrificing the mice when TV reached 2 × 2 × 2 cm, in line with the Use of Animals in Cancer Research and the Guidelines for the Welfare.

Synergy assessment using CCK-8 detection and online SynergyFinder

Human NPC cell lines C6661 and HK1 were digested and seeded into 96-well plates at a density of 1 × 10³ cells per well. Cells were treated with either a single agent (Orli or GEM) or a combination (GEM plus Orli). The concentration gradients for Orli and GEM were based on recently published literature [16]. Cell viability was assessed after 48-h treatment using a constant dilution ratio or both agents, with Orli concentrations of 31.25, 62.5, 125, 250 and 500 µM, and GEM concentrations of 3.125, 6.25, 12.5, 25 and 50 µM. The results were analyzed using the online software SynergyFinder (https://synergy-finder.fimm.fi). Vital indices, including drug synergy scores calculated with the “inhibition index” (the inhibition index = 100 - Cell Survival Percent), were derived utilizing the response surface model and zero interaction potency (ZIP) calculation method [17]. Synergy intensity was defined as follows: red regions indicated ZIP synergy scores > 0, signifying synergism and scores > 10 indicated strong synergistic effects [18]. Heatmaps illustrating drug combination responses were employed to determine the therapeutic significance of the combination.

Immunohistochemistry (IHC)

IHC was carried out on paraffin-embedded sections of NPC tissue, following the standard protocol utilizing primary antibodies targeting PKM2(CAT#4053, 1:1000, CST, USA) and Ki67 (CAT#ZM0167, 1:1000, ZSGB-BIO, China). Two pathologists independently evaluated and scored the staining intensity in the sections. The percentage positivity of the antigen staining was rated on a scale from 0 to 4: 0 (0%), 1 (1–25%), 2 (26–50%), 3 (51–75%), and 4 (> 75%). The intensity of staining was assessed using a 4-point scale: 0 (no staining), 1 (weak staining, light yellow), 2 (moderate staining, yellowish brown), and 3 (strong staining, brown). Following that, the antigen expression score was determined by multiplying the percentage positivity score by the staining intensity score, yielding a possible range from 0 to 12. The method was referred to the literature [19].

Western blot (WB)

Total protein extracts were prepared and subjected to electrophoresis on a 10% sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE). Following electrophoresis, the proteins were transferred to polyvinylidene fluoride (PVDF) membranes. To ensure that nonspecific binding was minimized, the membranes were then blocked using a solution of 5% non-fat dry milk in Tris-buffered saline (TBS). Subsequently, the membranes underwent immunoblotting, where they were incubated with both primary antibodies, PKM2(CAT#4503,1:1000, CST, USA), β-actin(CAT#4970,1:1000, CST, USA) FASN(CAT#3180,1:1000, CST, USA), HK2(CAT#2867,1:1000, CST, USA), GAPDH(CAT#181602, 1:1000, ABCAM, USA) and to facilitate the detection of specific proteins of interest. Detection of the targeted proteins was achieved through the use of an enhanced chemiluminescence (ECL) solution, specifically FDbio-Femto (FD8030). The visualization of the proteins on the membrane was performed using a chemiluminescence detection system, namely the Universal Hood II from Bio-Rad.

Cell transfection

The plasmid that stably overexpresses PKM2 was acquired from GeneCopoeia (USA). Initially, HEK293 cells were successfully transfected with the plasmid for 24 h utilizing Lipo-fectamine 2000 and OpitiMEM as transfection reagents. Subsequently, the medium was substituted with conventional culture medium. After a period of 48 h, the supernatants that contained the targeted recombinant lentiviruses were collected and filtered. The NPC cells were subsequently transfected with these lentiviruses for 48 h, after which 1 µg/mL of puromycin (Merck, Germany) was introduced to each well to select for stably transfected cells. Following this, the cells were moved to conventional culture medium. The effectiveness of PKM2 overexpression was assessed via qPCR or Western Blot analysis.

Metabolic experiments

The Lactate Colori-metric Assay Kit II (CAT#K627, Biovision, CA, USA) and Glucose Uptake Colorimetric Assay Kit (CAT#K676, Biovision, CA, USA) were employed to assess glycolysis in NPC cells, following the manufacturer’s protocols. Optical density (OD) readings were taken using a microplate reader after incubation.

Statistical analysis

Prism 9.0 was used for statistical analysis. The data were presented as means ± standard deviation (SD). Student’s t-test and one-way ANOVA were employed to compare statistical significance between groups. The Kaplan-Meier method was applied for survival analysis. P < 0.05 was considered statistically significant.

Results

Orli inhibited cell proliferation, colony-formation, glycolysis and mobility viability of NPC in vitro

The CCK-8 assay was performed to assess the anti-proliferative activity of Orli (Fig. 1A) on human NPC cells. Results showed that Orli significantly inhibited the proliferation of C6661, and HK1 cells in a time-dependent manner (Fig. 1B and C), A colony formation assay revealed that 100 µM Orli effectively suppressed colony formation in both cell lines (Fig. 1D and G). Previous studies have shown that Orli alters glucose metabolism in various cancers, including hepatocellular carcinoma [20]. Therefore, we investigated the impact of glycolysis levels after treatment. Results revealed that Orli at 100 µM reduced glucose uptake, which is the initial and crucial step in the glycolytic pathway in C6661 cells (Fig. 1H). Orli also decreased lactate levels, indicating a hindrance in glycolysis in C6661 cells (Fig. 1I). Additionally, the scratch wound healing assay showed that Orli markedly reduced the migratory capacity of C6661 cells (Fig. 1J and K). Collectively, these findings suggest that Orli inhibits the proliferation, colony-formation, glycolysis and migration of NPC cells in vitro.

Fig. 1.

Orli inhibits the proliferation, colony-formation, glycolysis and migration of NPC cells in vitro. A Chemical structure of Orli (https://www.pubchem.ncbi.nlm.nih.gov/). B, C Cell counting kit-8 results of C6661 (B) and HK1 (C) after Orli (0, 10, 50 and 100 µM) treatment. D–G Colony formation assay results of C6661 (D, E) and HK1 (F, G) after Orli (100 µM) treatment. H Glucose uptake levels in C6661 after Orli (100 µM) treatment for 48 h. I Lactate levels in C6661 after Orli (100 µM) treatment for 48 h. J, K Scratch wound healing assay results of C6661 after Orli (50 µM) treatment. ns. no significance; *P < 0.05, ** P < 0.01, *** P < 0.001,**** P < 0.0001

Orli synergistically enhances the cytotoxic effects of GEM against NPC cells in vitro and in vivo

A recent study introduced a methodology for evaluating the synergistic effect of combination drugs, prompting us to conduct a cell viability assay to explore the potential effect of Orli combined with GEM for NPC treatment. We varied Orli concentrations from 31.25 µM to 500 µM and GEM from 3.125 µM to 50 µM. The ZIP synergy scores and corresponding inhibition indices were calculated using the SynergyFinder tool. The average (and maximum) proportions indicating drug interaction and cytotoxicity against NPC cells were 4.133 (9.41) for HK1 cells and 7.718 (28.62) for C6661 cells (Fig. 2A and B). This indicates that the combination of Orli (lowest concentration: 50µM) and GEM (lowest concentration: 6.25µM) in HK1 or the combination of Orli (lowest concentration: 25µM) and GEM (lowest concentration: 12.5µM) in C6661 could produce significantly synergistic effects in reducing NPC cell viability, with ZIP synergy scores exceeding 0. The result of colony formation assay verified that Orli (25µM) enhanced the inhibiting effect of GEM (12.5 µM) (Fig. 2C). Furthermore, compared with GEM treatment alone, the combination of Orli and GEM also significantly inhibited the NPC cell growth (Fig. S1D, E) and cell migration(Fig. S1E-F). Subsequently, in vivo models were used to evaluate the potential enhancing effect of Orli when combined with GEM. It was found that compared with the control group, GEM alone significantly inhibit HK1 tumor growth. More importantly, GEM and Orli combination markedly reduced tumor volume and weight compared, indicating that Orli effectively enhanced the inhibition of HK1 tumor growth in vivo (Fig. 2D and F, Fig. S2A). A similar pattern was observed in C6661 tumors, the combination with Orli led to substantial tumor size reductions (Fig. 2G and I, Fig. S2B). The result of qPCR detection also indicated that Orli decreased PKM2 mRNA expression in both HK1(Fig. S2C) and C6661 (Fig. S2D) subcutaneous tumors. The result of complete blood count, liver and kidney function tests indicated that the combination of GEM and Orli at therapeutic doses not cause significant liver and kidney function or blood toxicity (Fig. S2E-2S2L). Overall, these findings imply that Orli enhances the cytotoxic effects of GEM against NPC cells both in vitro and in vivo.

Fig. 2.

Orli synergistically enhances the cytotoxic effects of GEM against NPC cells in vitro and in vivo. A Heatmaps of Orli and GEM combination against HK1 cells. B Heatmaps of Orli and GEM combination against C6661 cells. Synergy intensity was defined as follows: red regions indicate ZIP synergy scores > 0, signifying synergism, and scores > 10 denote strong synergistic effects. The white rectangle represents the concentrations that encompass the region of greatest synergy. The varying shades of red regions denote the intensity of synergism, while the X- and Y-axes, corresponding to the sides of the white rectangle, denote the concentrations at which the drug combination maximized cell viability inhibition. C Colony formation assay using Orli (25µM) and GEM (12.5µM) on C6661 cells; D–F A xenograft assay using HK1 was conducted after Orli (100 mg/kg, i.p., every other day) and GEM (50 mg/kg. i.p., twice a week) combination therapy, with D showing tumor images post-sacrifice, E illustrating tumor size, and F displaying tumor weight. G–I A xenograft assay using C6661 was conducted after Orli (100 mg/kg) and GEM (50 mg/kg. i.p., twice a week) combination therapy, with G presenting tumor images post-sacrifice, H depicting tumor size, and I indicating tumor weight. ns. no significance; *P < 0.05, ** P < 0.01, *** P < 0.001,**** P < 0.0001. Error bars denote for the s.e.m

Orli enhances the inhibitory effect of GEM in vitro by downregulating PKM2

Orli is a generally recognized inhibitor of FASN which is over-expressed in human tumor tissues including NPC and catalyzes de novo synthesis of fatty acids on which tumor cells depend [21, 22]. For example, Kao et al. [23] reported that FASN is closely associated with the poor prognosis such as disease-specific survival, distal metastasis-free survival in NPC patients. The analysis of a NPC GEO(Gene Expression Omnibus)dataset GSE102349 also showed a trend that FASN was correlating with poor prognosis survival outcomes of NPC patients (Fig. S3A). Evidence suggests that PKM2 acts as a downstream mediator of FASN, promoting malignancy progression [24, 25]. PKM2 was correlating with poor prognosis survival outcomes of NPC patients (Fig. 3A). This suggests that PKM2 may play a role in the way Orli slows down the progression of NPC. Therefore, we focus our attention on the possible regulation of PKM2 by Orli. The analysis of a NPC GEO༈Gene Expression Omnibus༉dataset GSE102349 indicated that PKM2 was correlating with poor prognosis survival outcomes of NPC patients (Fig. 3A). The present study found that PKM2 levels were elevated in NPC cell lines compared with a normal NP69 cells (Fig. 3B). Orli in various concentration (10, 100µM) treatment reduced PKM2 mRNA expression in both HK1 (Fig. 3C) and C6661 cells (Fig. 3D). Furthermore, the result of qPCR detection also indicated that Orli decreased PKM2 mRNA expression in both HK1 (Fig. S2C) and C6661 (Fig. S2D) subcutaneous tumors. Consistently, the result of WB detection suggested that Orli treatment decreased PKM2 protein expression in both HK1 (Fig. S3B) and C6661 cells (Fig. S3C) Furthermore, the IHC detection of subcutaneous tumor indicated that Orli treatment reduce PKM2 expression (Fig. S3D-E) and Ki67 expression (Fig. S3F-G). After PKM2 was overexpressed successfully in both HK1 and C6661 cells (Fig. 3E, Fig. S3H), though the colony formation assay, we found that the inhibitory effects produced by Orli was negated in these two cell lines (Fig. 3F and G). The result of qPCR detection indicated Orli treatment significantly increased the apoptosis related gene Bax expression and decreased the BCL-2 expression (Fig. S3I). Orli treatment reduced the cell fraction in S-phase and induced the G2-phase arrest (Fig. S3J-K). Furthermore, cell viability assays revealed that Orli and GEM alone significantly inhibited HK1 cell proliferation. However, PKM2 overexpression negated these inhibitory effects (Fig. 3H). Similar trend was observed in inhibition on cell growth (Fig. 3I) and lactate production (Fig. S3L) of C6661 cells when treated with Orli and GEM. Collectively, these findings suggest that Orli may hinder the malignant biological behavior of NPC and enhance the inhibitory effect of GEM in vitro by downregulating PKM2.

Fig. 3.

Orli enhances the inhibitory effect of GEM in vitro by downregulating PKM2. A Prognostic significance of PKM2 for overall survival of NPC patients analyzed using the GEO dataset GSE102349. B PKM2 mRNA expression of NPC cell lines and normal nasopharyngeal cell line. C, D PKM2 mRNA expression of HK1 (C) and C6661 (D) after Orli (10,100 µM) treatment. E qPCR analysis of the overexpression efficacy of PKM2 in HK1 and C6661. F Colony formation assay using HK1 cells after Orli (100 µM) treatment. G Colony formation assay using C6661 cells after Orli (100 µM) treatment. H Cell viability of HK1 with PKM2 overexpression after Orli (89.45 µM) and GEM (5 µM) treatment. HK1 was initially treated by Orli or GEM for 24 h and then the culture medium was replaced with the one containing both Orli or GEM and targeted recombinant lentiviruses (with Vector and overexpression of PKM2) and HK1 was treated for another 24 h. I Cell viability of C6661 with PKM2 overexpression after Orli (106.6 µM) and GEM (5 µM) treatment. C6661 was initially treated by Orli or GEM for 24 h and then the culture medium was replaced with the one containing both Oril or GEM and targeted recombinant lentiviruses (with Vector and overexpression of PKM2) and C6661 was treated for another 24 h. ns. no significance; *P < 0.05, ** P < 0.01, *** P < 0.001,**** P < 0.0001

Orli enhances the inhibitory effect of GEM in vivo by downregulating PKM2

To further verify the role of PKM2 in hindering the malignant biological behavior of NPC and enhancing the inhibitory effect of GEM via downregulating PKM2, we established a xenograft model by subcutaneously injecting C6661 cells into nude BALB/c mice. Results showed Orli significantly reduced the growth rate of C6661 tumors compared with the control group, with the combination treatment demonstrating the most pronounced inhibitory effect. However, no significant difference in the tumor growth rate or weight was found between the Orli or combination treatment groups and the control group after PKM2 overexpression in C6661 cells (Fig. 4A–C, Fig. S4A). The result of qPCR detection also further verified that Orli alone and the combination significantly decreased PKM2 mRNA expression in C6661 (Fig. S4B) subcutaneous tumors, and the effect was reversed by PKM2 overexpression. Taken together, these results indicate that Orli inhibits the cell viability of NPC cells and enhances the inhibitory effect of GEM in vivo by downregulating PKM2.

Fig. 4.

Orli enhances the inhibitory effect of GEM in vivo by downregulating PKM2. A–C A xenograft assay was performed using human NPC cell C6661 with PKM2 overexpression after Orli and GEM combination therapy, with A showing tumor images post-sacrifice, B illustrating tumor size, and C displaying tumor weight. ns. no significance; *P < 0.05, ** P < 0.01, *** P < 0.001,**** P < 0.0001

Discussion

The prognosis of patients with recurrent or metastatic NPC remains poor. Although conventional chemotherapies, such as GEM-based regimens, are the primary treatment, they often lead to reduced sensitivity and worse outcomes. Consequently, there is a pressing need to enhance the sensitivity to the chemotherapy agent GEM. The present study found that PKM2 downregulation, facilitated by the FDA-approved weight-loss drug Orli, significantly inhibited the proliferation, colony formation, and migratory capabilities of human NPC cells. Additionally, Orli enhanced the effectiveness of GEM both in vitro and in vivo. Thus, Orli and GEM combination may be a promising therapeutic strategy that warrants further clinical investigation.

The inhibition of FASN, a target of Orli, leads to a significant reduction in the absorption and utilization of dietary fats in the human intestine. Notably, emerging evidence suggests that FASN may also play a role in the anti-tumor effects of Orli. Chuang et al. [26] found that Orli inhibited the growth of prostate cancer cells, particularly LNCap and PC3, and increased their sensitivity to radiotherapy. Grube et al. [27] demonstrated that Orli reduced cell viability and impeded the progression of gliomas by suppressing FASN expression. Furthermore, Orli has been shown to enhance the sensitivity of various cancer types to chemotherapy through the downregulation of FASN. For instance, Papaevangelou et al. [28] confirmed that FASN inhibition by Orli increased the sensitivity of ovarian cells to cisplatin. Almeida et al. [29] reported that Orli exerted a synergistic effect with cisplatin and paclitaxel on oral squamous cell carcinomas by downregulating cyclin B1. Cheng et al. [30] noted that FASN promoted gallbladder cancer progression and FASN inhibition via Orli reduced the sensitivity of cancer cells to GEM. Collectively, the inhibition of FASN by Orli may enhance the efficacy of certain chemotherapy agents and impede the progression of various cancers. However, there is a paucity of research on the role of Orli in the progression and treatment of NPC. The current study found that FASN inhibition by Orli significantly reduced the proliferation, colony-forming ability, and migration of human NPC cells both in vitro and in vivo. Remarkably, Orli demonstrated a synergistic effect with the standard chemotherapy drug GEM in both experimental settings. These findings suggest that Orli could serve as a highly effective and safe chemosensitizer for NPC therapy.

Glycolysis provides substantial energy for tumor growth and metastasis [31, 32]. Pyruvate kinase serves as a crucial and rate‑limiting enzyme, converting phosphoenolpyruvate and adenosine diphosphate into pyruvate and adenosine triphosphate, thereby playing a significant role in the glycolytic pathway [33, 34]. Among the various isoforms of pyruvate kinase, PKM2 is upregulated in various cancers, including pancreatic ductal adenocarcinoma [35], breast cancer [36], and liver cancer [37]. Furthermore, the upregulation of PKM2 has shown considerable predictive value in the highly therapeutic response to chemotherapy agents such as 5‑fluorouracil and epirubicin in breast cancers [38]. Previous studies have demonstrated that PKM2 inhibition increased the sensitivity of tumor cells to chemotherapy, including cisplatin [39]. For example, Deng et al. [40] reported that metformin increased the response of cholangiocarcinoma cells to GEM by suppressing PKM2, underscoring the role of PKM2 in modulating cell sensitivity to chemotherapy. However, studies exploring the role of PKM2 in NPC are limited, with only two studies demonstrating that PKM2 inhibition can reduce NPC cell proliferation in vitro [41, 42], while the in vivo effect of PKM2 inhibition and its implications for chemotherapy remain largely unexplored. Our study found that higher PKM2 levels in NPC cells compared to normal cells. Furthermore, the inhibition of PKM2 using Orli significantly enhanced the therapeutic effect of GEM on NPC both in vitro and in vivo.

Conclusion

In summary, the present study has demonstrated Orli inhibits the proliferation, migration and glucose uptake of NPC cells. Additionally, it has revealed a synergistic effect when combined with the chemotherapy agent GEM, primarily through the inhibition of PKM2 expression. This study presents a promising therapeutic option for patients with NPC and lays the groundwork for future translational clinical trials involving the combination of Orli and GEM in NPC treatment. Nevertheless, there are limitations, including the lack of direct and comprehensive evidence that elucidates how FASN inhibition by Orli affects NPC through PKM2 and its downstream pathways that contribute to NPC progression, which should be addressed in subsequent research.

Electronic Supplementary Material

Below is the link to the electronic supplementary material.

Author contributions

P.Z and S.O designed the study, supervised the experiments, and revised the paper and gave the final approval of the manuscript. P.Z and Q.C conceived the experiments, performed the majority of experiments, analyzed the data, and drafted the paper. All authors read and approved the final version of manuscript.

Funding

Not applicable.

Data availability

The datasets used and analyzed during the current study were available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

The research is conducted in alignment with the ARRIVE guidelines. All experiments involving animals adhered to the standards for the care and use of laboratory animals and received approval from the ethics committee at South China University of Technology.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.