B3GNT6 suppresses colorectal cancer progression by inhibiting the KRAS/ERK signaling pathway

Abstract

Background

Colorectal cancer (CRC) is one of the most common malignancies with high morbidity and mortality worldwide. B3GNT6 as been predicted to serve as a prognostic indicator for CRC patients, but its biological function and underlying mechanism in CRC remain largely unclear.

Objective

Our investigation was designed to clarify the biological function and molecular mechanism of B3GNT6 in CRC progression.

Methods

The mRNA and protein expression levels of B3GNT6 in CRC tissues and cell lines were examined using RT-qPCR and western blot assay. CCK-8, flow cytometry, and TUNEL staining were used to evaluate cell proliferation, cell cycle distribution, and apoptosis in vitro and in vivo. The migratory and invasive abilities of cells were determined by Transwell assay. Cell autophagy was analyzed by immunofluorescence staining. The expression of apoptosis-related proteins and key components in the KRAS/ERK signaling pathway was detected using RT-qPCR and western blot analysis.

Results

B3GNT6 was significantly downregulated in CRC tissues and cell lines. Functionally, B3GNT6 overexpression inhibited cell proliferation, autophagy, migration, and invasion, induced G2 phase cell cycle arrest and apoptosis, whereas these effects were abolished by KRAS overexpression. In vivo experiments further confirmed that B3GNT6 overexpression suppressed tumor growth and autophagy, and promoted apoptosis. Mechanistically, B3GNT6 overexpression inhibited the activation of the KRAS/ERK signaling pathway, while upregulation of KRAS had the opposite effect.

Conclusion

B3GNT6 inhibits colorectal cancer progression by blocking the KRAS/ERK signaling pathway. Thus, B3GNT6 may serve as a promising diagnostic and prognostic biomarker as well as a potential therapeutic target for CRC.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12896-026-01160-y.

Introduction

Colorectal cancer (CRC) is a common malignant tumor of the gastrointestinal tract with high morbidity and mortality [1]. Currently, the treatment of colorectal cancer is mainly based on surgical intervention combined with radiotherapy. However, various complications of surgical resection, adverse effects of radiotherapy, and resistance to drugs affect the efficacy [2, 3]. Therefore, exploring the underlying mechanisms of CRC occurrence, development, and metastasis is important for finding effective therapies to treat CRC.

B3GNT6, also known as core 3 synthase, is located in the q13.5 region of human chromosome 11 [4]. B3GNT6, as a member of the O-GlcNAc transferase (OGT) family, is involved in a variety of cellular processes, such as n-glycan synthesis, cell migration, and signal transduction [5]. Recent studies have shown that aberrant expression of B3GNT6 is associated with the development of various cancers. Cao et al. revealed that IGF2BP2 enhanced the stability of B3GNT6 mRNA via m6A methylation in pancreatic carcinoma [6]. In addition, B3GNT6 was downregulated in colorectal cancer tissues, and this downregulation is closely associated with poor prognosis of CRC patients, supporting its potential as a prognostic biomarker [7]. However, the potential mechanisms of B3GNT6 in CRC progression are not clear.

Abnormal gene expression and dysregulation of signaling pathways play a crucial role in the development of colorectal cancer [8]. The KRAS/ERK signaling pathway is an important intracellular signal transduction pathway that plays a key role in the regulation of cell proliferation, differentiation and metabolism [9, 10]. The KRAS/ERK signaling pathway is initiated by the binding of growth factors to receptor tyrosine kinases (RTKs), which triggers the recruitment of GRB2-SOS complexes, thereby promoting the exchange of guanine nucleotides on KRAS. Activated KRAS recruits RAF kinase to the plasma membrane, initiating a phosphorylation cascade through MEK1/2 to ERK1/2. Phosphorylated ERK translocates to the nucleus to regulate transcription factors and cell cycle regulators, thereby promoting oncogenic processes [11]. Aberrant activation of this pathway has been closely associated with the development and progression of a variety of malignant tumors. A report from Sun et al. suggested that Transgelin-2 is identified as a novel target for pancreatic cancer treatment by regulating the KRAS-ERK pathway [12]. Hoshida et al. suggested that L-OHP and 5-FU promote EMT via activation of the KRAS/ERK pathway in colon cancer cells [9]. However, it remains to be elucidated whether B3GNT6 plays a role in CRC by regulating the KRAS/ERK signaling pathway.

Therefore, the present study is the first to demonstrate that B3GNT6 inhibits CRC progression by suppressing the KRAS/ERK signaling pathway. These findings extend previous studies and provide a novel mechanism underlying CRC development, which may offer a potential target for CRC diagnosis and therapy.

Materials and methods

Patients and specimens

A total of thirty colorectal cancer patients who had not undergone chemotherapy or radiotherapy before surgery were enrolled in this study. During the colorectal cancer resection procedure, colorectal cancer tissues and their paired paracancerous normal tissues were collected. These specimens were subsequently stored at -80 °C for subsequent analysis. The research was approved by the Ethics Committee of Nanjing Medical University (Approval no. 2022 − 715). Written informed consent was obtained before the operation.

Cell culture and treatment

The colorectal cancer cell lines (Caco2, HT29 and SW480) and FHC cells were procured from the ATCC (Manassas, VA, USA) and cultivated in RPMI-1640 medium (FI201-01, Transgen) supplemented with 10% FBS (FS201-02, Transgen) and 1% penicillin/streptomycin (FG101-01, Transgen) with 5% CO2 at 37 °C to conduct subsequent experiments.

Cell transfection

HT29 and SW480 cells were cultivated in RPMI-1640 medium until they reached 80% confluence. To overexpress B3GNT6 or KRAS in HT29 and SW480 cells, the control-plasmid, B3GNT6-plasmid and KRAS-plasmid were obtained from GenePharma. These plasmids were transfected into cells by Lipofectamine 3000 reagent (Thermo Fisher Scientific, USA) following the protocol for 48 h. After transfection, Western blot analysis and RT-qPCR analysis were applied to assess the transfection efficiency.

MTT assay

HT29 and SW480 cells were seeded into 96-well plates and cultured for 0, 24, 48–72 h at 37 °C. Subsequently, cells were treated with 10 µl MTT solution (C0009S, Beyotime) and continuously incubated for an additional 4 h. Then, 100 µl dimethyl sulfoxide (DMSO) was added to dissolve formazan crystals for 3 h at 37 °C. The optical density (OD) at 570 nm was measured by a microplate reader (DR-200Bs, Diatek).

Cell cycle analysis

The cell cycle distribution was determined using the Cell Cycle Assay Kit (40301ES60, Yeasen). HT29 and SW480 cells were collected and fixed with 75% pre-cooled ethanol for 24 h. Subsequently, the cells were resuspended in 500 µL of staining buffer, and 10 µL of propidium iodide/ribonuclease (PI/RNase) staining solution was added. The mixture was incubated at 37 °C for 30 min. Finally, the cell cycle distribution was analyzed by a flow cytometer (BD FACSCanto II).

Cell apoptosis analysis

The cell apoptosis was measured using the Annexin V-FITC/PI Staining Kit (40302ES50; Yeasen). HT29 and SW480 cells were collected and resuspended in 300 µL of binding buffer. Then, 5 µL of Annexin V-FITC and 10 µL PI buffer were added to the cell suspension, and the mixture was incubated under appropriate conditions for 10 min. After the staining was completed, the cell apoptosis was analyzed using a flow cytometer (FACSCanto II, BD Biosciences).

Transwell assay

Transwell assay was used to detect the migration and invasion ability of HT29 and SW480 cells. For the migration assay, cells were added to 200 µL serum-free medium in the upper chamber, followed by 500 µL RPMI 1640 medium containing 10% FBS in the lower chamber. For the invasion analysis, 50 µL Matrigel (diluted 1:3 with serum-free medium, 354248, Corning) was used to precoated the Transwell chambers (3422, Corning) for about 2 h. Then the cells were seeded in Matrigel coated upper Transwell chambers, and 500 µL RPMI 1640 medium containing 10% FBS was added to the lower chamber. After incubation at 37 °C for 48 h, cells on the lower surface of the membrane were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet dye (C0121, Beyotime) for 20 min. The stained cells were counted and representative images were obtained by an inverted microscope (IX51, OLYMPUS).

Immunofluorescence

HT29 and SW480 cells were fixed with 4% paraformaldehyde (P1110, Solabio) for 10 min to stabilize the cellular structure. Then permeabilization treatment was performed using a 0.5% Triton X-100 solution (1139ML100, BioFroxx) for 20 min. Next, the cells were blocked in 5% BSA (V900933, Sigma) for 30 min, and incubated with the anti-LC3 antibody (14600-1-AP, Proteintech) and anti-p62 antibody (18420-1-AP, Proteintech) at 37 °C for 1 h. Subsequently, the corresponding secondary antibody (SA00003-2, Proteintech) was added and the incubation was continued for another 1 h. The cell nuclei were stained with DAPI staining solution (C1005, Beyotime) for 15 min. Finally, the cells were rinsed repeatedly with PBS, and the cellular fluorescence images were obtained using an immunofluorescence microscopy (MicroPublisher, Q-IMAGING).

Animals

Balb/c-Nude mice (male, 4–6 weeks, 15–20 g) were purchased from the Animal Centre of GemParmatech (Nanjing, China). Subsequently, these mice were housed and acclimated in a specific pathogen-free (SPF) grade animal experimental facility with a 12-hour light-12-hour dark cycle, controlled temperature at 22 ± 2 °C and relative humidity stabilized within 40%-60%. All animals were treated under an approved protocol by the Nanjing Medical University Animal Care and Use Committee (2022-2-25).

Colorectal tumor model

The mice were randomly allocated into three groups (n = 6), including the Model group, Model+control-plasmid group and Model+B3GNT6-plasmid group. The Model group received an injection of untransfected colorectal cancer cells. The mice were placed on a sterile operating table, and the skin on their backs or bilateral armpits was disinfected with 75% alcohol. A 1-ml syringe was used to draw up the colorectal cancer cell suspension. The cell suspension was injected into the backs or bilateral armpits of the mice. After cell inoculation, the mice were placed in a specific breeding environment. The general condition of the mice was regularly observed, and the size of the tumors was measured with a vernier caliper once a week. The tumor volume was calculated using the following formula: V = (length × width²)/2. On the 28th day, representative images of the mice and their tumors were taken. Mice were euthanized by carbon dioxide asphyxiation. Briefly, mice were placed into a euthanasia chamber, and carbon dioxide was introduced at a flow rate of 5 L/min. After 2–3 min, mice lost consciousness. CO₂ infusion was maintained for at least 1 additional minute after respiratory arrest to ensure irreversible death.

TUNEL staining

Apoptotic cells in the tumor tissues were detected by TUNEL assay (G1504, Servicebio). In brief, the tumor tissues were fixed with 4% paraformaldehyde (80096618, sinoreagent) for 20 min, and 2–3 μm paraffin sections were prepared after dehydration. After that, the sections were dewaxed in xylene, washed with anhydrous ethanol and soaked in 0.2% Triton X-100 (30188928, sinoreagent). After staining with DAPI solution (D8417-1MG, Sigma), the sections were photographed and counted under an optical microscope (Eclipse Ci-L, Nikon).

Quantitative real-time PCR (RT-qPCR)

Total RNA from colorectal cancer cell lines and colorectal cancer tissues was extracted by TRIzol^® reagent (YFXM0011P, Yfxbio Biotech) following the manufacturer’s instructions. HiScript III qRT SuperMix (R323, Vazyme) was used for reverse transcription. Then, real-time PCR was carried out using ChamQ Universal SYBR qPCR Master Mix (Q711, Vazyme) with a CG Real Time PCR system (Heal Force). The relative mRNA levels were analyzed by the 2^−∆∆Ct method and GAPDH was used as control gene. Primers are presented in Table 1.

Table 1.

Primer sequences used in qRT-PCR

Gene	Forward primer (5’-3’)	Reversed primer (5’-3’)
B3GNT6	ttcctcaacctcacgctcaa	atgagctggccggagaac
BCL2	gccttctttgagttcggtgg	gaaatcaaacagaggccgca
Bax	aagaagctgagcgagtgtct	gttctgatcagttccggcac
KRAS	agtgccttgacgatacagct	cctccccagtcctcatgtac
GAPDH	AGGTCGGAGTCAACGGATTT	TGACGGTGCCATGGAATTTG

Western blot assay

Total protein extraction was conducted by RIPA Lysis Buffer (ThermoFisher Scientific, USA) and quantified by the Easy II Protein Quantitative Kit (DQ111-01, TIANGEN). Equal amounts of protein were subject to SDS-PAGE and transferred onto PVDF membranes (Merck Millipore, GER), followed by blocking with specific primary antibodies, including anti-KRAS (12063-1-AP, Proteintech, 1:5000), p-ERK (28733-1-AP, Proteintech, 1:2000), ERK (11257-1-AP, Proteintech, 1:2000), B3GNT6 (21291-1-AP, Proteintech, 1:2000), Bax (50599-2-Ig, Proteintech, 1:2000), Bcl-2 (12789-1-AP, Proteintech, 1:2000) and GAPDH (60004-1-Ig, Proteintech, 1:50000) overnight at 4 °C. After washing, the membranes were incubated with secondary antibody and were visualized with the EasySee^® Super Western Blot Kit (DW111-01, TIANGEN).

Statistical analysis

Data are presented as the mean ± standard deviation (SD). All experiments were performed with at least three independent biological replicates. Prior to parametric statistical analysis, normality and homogeneity of variance were confirmed. Comparisons between two groups were assessed by Student’s t-test, and differences among multiple groups were analyzed using one-way ANOVA followed by Tukey’s post hoc test. All statistical analyses were performed using GraphPad Prism 8.0 software. A p-value of < 0.05 was considered statistically significant.

Results

B3GNT6 was down-regulated in CRC tissues and CRC cell lines

To investigate the role of B3GNT6 in CRC progression, we first examined its expression in CRC tissues. RT-qPCR revealed that B3GNT6 levels were significantly lower in tumor tissues than in adjacent normal tissues (Fig. 1A). Similarly, in CRC cell lines (Caco2, HT29, SW480), B3GNT6 expression was markedly decreased compared to that in FHC cells, with the most pronounced downregulation observed in HT29 and SW480 cells. Based on these findings, HT29 and SW480 were selected for further experiments (Fig. 1B-D).

Fig. 1.

Expression of B3GNT6 in CRC tissues and cells. (A) RT-qPCR analysis of B3GNT6 protein in CRC tissue and adjacent normal tissue. (B) Relative mRNA levels of B3GNT6 in CRC cell lines and FHC were evaluated by RT-qPCR. (C and D) B3GNT6 expression in in CRC cell lines (Caco2, HT29, SW480) and FHC were assessed by western blot analysis. n = 3 (biological replicates). *P < 0.05, **P < 0.01, ***P < 0.001, **** P < 0.0001

B3GNT6 overexpression suppressed proliferation and promotes apoptosis in CRC cells

To investigate the functional role of B3GNT6 in CRC progression, control-plasmid or B3GNT6-plasmid were transfected into HT29 and SW480 cells. RT-qPCR and western blot analysis confirmed that B3GNT6-plasmid increased B3GNT6 expression in CRC cell lines (HT29, SW480) compared to the control-plasmid group (Supplementary Fig. 1A-F). Functional assays revealed that B3GNT6 overexpression significantly inhibited cell proliferation, as evidenced by MTT assays showing time-dependent growth suppression (Fig. 2A-B). Furthermore, we assessed the cell cycle distribution and cell apoptosis using FCM and found that cell cycle was arrested at the G2 phase and that apoptotic cells were enhanced in B3GNT6-plasmid transfected cells relative to controls (Fig. 2C-H). Results in Fig. 2I-N suggested that the B3GNT6-plasmid up-regulated the expression of Bax, while notably suppressed Bcl-2 mRNA level and protein expression in HT29 and SW480 cells. Collectively, these results indicate that B3GNT6 plays a critical role in regulating CRC cell proliferation, cell cycle progression, and apoptosis.

Fig. 2.

Effect of B3GNT6 on CRC cell proliferation, apoptosis and cell cycle. (B) HT29 and SW480 cells were transfected with control-plasmid or B3GNT6-plasmid for 48 h. (A and B) Cell proliferation of HT29 and SW480 cells at 0, 24, 48 and 72 h were confirmed by MTT assay. (C-H) Cell apoptosis and cell cycle distribution were analyzed by flow cytometry. (I-K) Western blot and RT-qPCR analysis detected Bax and Bcl-2 expression in HT29 cells. (L-N) Western blot and RT-qPCR analysis detected Bax and Bcl-2 expression in SW480 cells. n = 3 (biological replicates). **P < 0.01, ***P < 0.001, **** P < 0.0001

Overexpression of B3GNT6 suppressed cell migration, invasion and autophagy in CRC cells

To assess the influence of B3GNT6 on migration and invasion of CRC cells, we performed Transwell and Matrigel assays. As displayed in Fig. 3A-F, the invasive and migratory capacity of HT29 and SW480 cells were suppressed after B3GNT6 overexpression. Moreover, immunofluorescence was applied to detect the protein levels of autophagy-related genes LC3B and P62. The B3GNT6-plasmid decreased the expression of LC3B and increased the expression level of P62 in HT29 and SW480 cells (Fig. 4A-C). These results suggested that high B3GNT6 levels inhibit CRC cell migration, invasion and autophagy.

Fig. 3.

Effect of B3GNT6 on CRC cell migration and invasion. (A-C) Invasion and migration of HT29 cells were detected by Transwell assay. (D-F) Invasion and migration of SW480 cells were detected by Transwell assay. Scale bar: 100 μm. n = 3 (biological replicates). ***P < 0.001, **** P < 0.0001

Fig. 4.

Effect of B3GNT6 on CRC cell autophagy. (A-C) Immunofluorescence staining revealed LC3B and P62 expression in HT29 and SW480 cells. Scale bar: 100 μm. n = 3 (biological replicates). **P < 0.01

Overexpression of B3GNT6 inactivated the KRAS/ERK signaling pathway

The KRAS/ERK pathway plays a key role in human cancer. Next, we confirmed the function of B3GNT6 in regulating the KRAS/ERK pathway in the development of CRC. Decreased KRAS and p-ERK expression were observed in the B3GNT6-plasmid transfected HT29 and SW480 cells, compared to the control-plasmid group (Fig. 5A-H). These results strongly suggested that B3GNT6 has a regulatory effect on the KRAS/ERK signaling pathway in CRC.

Fig. 5.

Effect of B3GNT6 on the KRAS/ERK pathway. (A) KRAS, p-ERK, and ERK protein expression in HT29 cells were evaluated by western blot assay. (B) KRAS/GAPDH ratio in HT29 cells. (C) The p-ERK/ERK ratio in HT29 cells. (D)The mRNA expression of KRAS in HT29 cells was determined by RT-qPCR analysis. (E) KRAS, p-ERK, and ERK protein expression in SW480 cells were evaluated by western blot assay. (F) KRAS/GAPDH ratio in SW480 cells. (G) The p-ERK/ERK ratio in SW480 cells. (H)The mRNA expression of KRAS in SW480 cells was determined by RT-qPCR analysis. n = 3 (biological replicates). **P < 0.01, ***P < 0.001

Overexpression of B3GNT6 regulated CRC cell biological behaviors via KRAS/ERK pathway

To explore whether B3GNT6 influences the properties of CRC cells by regulating the KRAS/ERK pathway, CRC cells were transfected with B3GNT6-plasmid and/or KRAS-plasmid. As depicted in Fig. 6A-B, in comparison with the B3GNT6-plasmid+control-plasmid group, overexpression of KRAS enhanced the viability of HT29 and SW480 cells. Additionally, in B3GNT6-plasmid+KRAS-plasmid co-transfected CRC cells, the apoptosis of CRC cells was significantly suppressed, and the proportion of cells in the G2 phase was decreased, compared with B3GNT6-plasmid+control-plasmid transfected cells (Fig. 6C-H). Western blot and RT-qPCR analysis further revealed that KRAS overexpression notably decreased Bax expression and increased the expression of Bcl-2 in CRC cells (Fig. 6I-N). Transwell assay demonstrated that the migratory and invasive capacity of CRC cells remarkably enhanced with the overexpression of KRAS (Fig. 7A-F). Moreover, KRAS overexpression promoted cell autophagy (Fig. 8A-C) and the activation of the KRAS/ERK pathway (Fig. 9A-H), suggesting that the upregulation of KRAS counteracted the effects of B3GNT6 overexpression on the biological behaviors of CRC cells.

Fig. 6.

KRAS overexpression rescued B3GNT6-mediated suppression of CRC proliferation. HT29 and SW480 cells were co-transfected with B3GNT6-plasmid+KRAS-plasmid or B3GNT6-plasmid+control-plasmid. (A and B) MTT assay was applied to assess HT29 and SW480 cell proliferation. (C-H) Cell apoptosis and cell cycle distribution were analyzed by flow cytometry. (I-K) Western blot and RT-qPCR analysis detected Bax and Bcl-2 expression in HT29 cells. (L-N) Western blot and RT-qPCR detected Bax and Bcl-2 expression in SW480 cells. n = 3 (biological replicates). **P < 0.01, ***P < 0.001

Fig. 7.

KRAS overexpression rescued B3GNT6-mediated suppression of CRC migration and invasion. HT29 and SW480 cells were co-transfected with B3GNT6-plasmid+KRAS-plasmid or B3GNT6-plasmid+control-plasmid. (A-C) Invasion and migration of HT29 cells were detected by Transwell assay. (D-F) Invasion and migration of SW480 cells were detected by Transwell assay. Scale bar: 100 μm. n = 3 (biological replicates). ****P < 0.0001

Fig. 8.

KRAS overexpression rescued B3GNT6-mediated suppression of CRC cell autophagy. HT29 and SW480 cells were co-transfected with B3GNT6-plasmid+KRAS-plasmid or B3GNT6-plasmid+control-plasmid. (A-C) Immunofluorescence staining revealed LC3B and P62 expression in HT29 and SW480 cells. Scale bar: 100 μm. n = 3 (biological replicates). **P < 0.01

Fig. 9.

KRAS overexpression rescued B3GNT6-mediated suppression of the KRAS/ERK pathway in CRC. HT29 and SW480 cells were co-transfected with B3GNT6-plasmid+KRAS-plasmid or B3GNT6-plasmid+control-plasmid. (A) KRAS, p-ERK, and ERK protein expression in HT29 cells were evaluated by western blot assay. (B) KRAS/GAPDH ratio in HT29 cells. (C) The p-ERK/ERK ratio in HT29 cells. (D)The mRNA expression of KRAS in HT29 cells was determined by RT-qPCR analysis. (E) KRAS, p-ERK, and ERK protein expression in SW480 cells were evaluated by western blot assay. (F) KRAS/GAPDH ratio in SW480 cells. (G) The p-ERK/ERK ratio in SW480 cells. (H) The mRNA expression of KRAS in SW480 cells was determined by RT-qPCR analysis. n = 3 (biological replicates). **P < 0.01, ***P < 0.001, ****P < 0.0001

Overexpression of B3GNT6 inhibited tumor growth in vivo

To further confirm the role of B3GNT6 in CRC, in vivo experiments were carried out. Transfected SW480 cells were injected into nude mice. Results in Fig. 10A-C confirmed that B3GNT6 overexpression led to a reduction in tumor size and weight, demonstrating its significant inhibitory effect on tumor formation. TUNEL assay further indicated that B3GNT6 overexpression promoted cell apoptosis (Fig. 10D-E). Immunofluorescence staining revealed lower LC3B levels and higher P62 levels in B3GNT6-plasmid treated tumor-bearing mice, compared with control-plasmid-treated mice (Fig. 11A-C). Moreover, the protein expression of KRAS and p-ERK was significantly decreased in the B3GNT6-plasmid-treated group (Fig. 11D-G). In summary, these results suggest that B3GNT6 overexpression inhibits the growth of CRC cells in vivo by inactivating the KRAS/ERK signaling pathway.

Fig. 10.

Effect of B3GNT6 on tumor growth in CRC mouse model. Nude mice were subcutaneously injected with SW480 cells and treated with B3GNT6-plasmid or control-plasmid. (A) Representative images of xenografted tumors. (B and C) Effects of B3GNT6 on tumor weights and volumes. (D and E) TUNEL assay assessed apoptosis in B3GNT6-treated tumors. Scale bar: 50 μm. n = 3 (biological replicates). **P < 0.01, ****P < 0.0001

Fig. 11.

Effect of B3GNT6 on autophagy and the KRAS/ERK pathway in CRC mouse model. Nude mice were subcutaneously injected with SW480 cells and treated with B3GNT6-plasmid or control-plasmid. (A-C) Immunofluorescence confirmed LC3B and P62 expression in B3GNT6 -treated tumors. Scale bar: 50 μm. (D) KRAS, p-ERK, and ERK protein expression in tumor tissue were evaluated by western blot assay. (E) KRAS/GAPDH ratio in tumor tissue. (F) The p-ERK/ERK ratio in tumor tissue. (G)The mRNA expression of KRAS in tumor tissue was determined by RT-qPCR analysis. n = 3 (biological replicates). **P < 0.01, ***P < 0.001

Discussion

Colorectal cancer (CRC) is one of the most morbid and lethal malignancies worldwide, and its tumor progression is driven by the dysregulation of key signaling pathways, including the KRAS/ERK [13], Wnt/β-catenin [14], and PI3K/AKT pathways [15]. Despite advances in immunotherapy and targeted therapies, the 5-year survival rate for CRC remains poor [16]. Therefore, it is crucial to explore underlying factors influencing CRC progression and identify novel molecular regulators. To the best of our knowledge, the present study demonstrates for the first time that B3GNT6 suppresses colorectal cancer progression by inhibiting the KRAS/ERK signaling pathway-a critical advancement beyond the previously reported correlation between low B3GNT6 expression and poor CRC prognosis [7]. Unlike prior studies that only identified B3GNT6 as a potential prognostic biomarker, our work uncovers a novel functional role and mechanistic basis for B3GNT6 in CRC, highlighting it as a potential therapeutic target.

B3GNT6 is a member of the β-1,3-N-acetylglucosaminyltransferase family, which is involved in the progression of CRC. Xiao et al. [7] performed bioinformatics and GSEA analyses and predicted that low B3GNT6 expression is associated with activated KRAS/ERK signaling and poor prognosis in CRC. However, this study only provided correlative bioinformatic evidence without any functional or mechanistic validation. In the present study, we found that B3GNT6 expression was significantly reduced in CRC tissues compared to adjacent normal tissues, a trend confirmed in several CRC cell lines (HT29, SW480). The balance between cell proliferation, apoptosis and cell cycle is important for maintaining cellular homeostasis [17]. Bcl-2, an anti-apoptotic protein, mainly functions to stabilize the mitochondrial membrane. Bax, a pro-apoptotic protein, increases the permeability of the mitochondrial membrane [18]. Ran et al. revealed that ADORA2A promotes proliferation and suppresses apoptosis via activating the PI3K/AKT pathway in CRC [19]. In addition, a report by Fu et al. suggested that CD147 promotes proliferation, migration, and invasion, and suppresses apoptosis in CRC cells via regulating the Rap1 signaling pathway [20]. Importantly, we determined whether B3GNT6 overexpression was able to influence the biological behavior of CRC cells, and subsequently confirmed that B3GNT6 overexpression impaired CRC cell proliferation by inducing G2 phase arrest and apoptosis, consistent with the upregulation of Bax and downregulation of Bcl-2. Additionally, B3GNT6 suppressed migration and invasion, indicating its role in inhibiting metastatic potential. Consistent with the results of the in vitro experiments, overexpression of B3GNT6 decreased the volume and weight of transplanted tumors in nude mice, while increasing apoptosis, suggesting its tumor-suppressive effects in CRC.

Autophagy is a spontaneous process of cellular self-degradation, and the survival of tumor cells often depends on autophagy [21]. Many studies have shown that autophagy is closely related to tumor cell apoptosis. Jin et al. revealed that YAP inhibits autophagy and promotes colorectal cancer progression by upregulating Bcl-2 expression [22]. Moreover, Chen et al. suggested that the MEX3A/circMPP6 complex promotes colorectal cancer progression via suppressing autophagy [23]. Consistent with these results, our data showed that B3GNT6 overexpression decreased LC3B while increasing P62, implying that B3GNT6 inhibited autophagy in CRC cells. However, the role of autophagy in the pathogenesis of CRC is complex in nature, and its function is dual depending on the cellular environment. Contrary to our findings, Wang et al. revealed that circSEC24B enhances autophagy and induces colorectal cancer chemoresistance by regulating the deubiquitination of SRPX2 [24]. The role of autophagy in CRC is influenced by the tumour microenvironment, stage of development and regulatory pathways. Although B3GNT6 overexpression inhibited both KRAS/ERK signaling and autophagy, and these effects were reversed by KRAS overexpression, it remains unclear whether autophagy is a primary mechanism or a downstream consequence of KRAS/ERK inhibition. Furthermore, the in vivo findings reinforce the potential clinical relevance of B3GNT6 as a therapeutic target.

The KRAS/ERK pathway is a major oncogenic driver of CRC, regulating proliferation, survival and metastasis [25]. Our study focused on the regulation of the KRAS/ERK pathway with the B3GNT6 and uncovered valuable molecular mechanisms. A key novelty of our study is the identification of B3GNT6, a glycosyltransferase, as a novel upstream inhibitor of the KRAS/ERK pathway in CRC. Unlike most known KRAS regulators, which include growth factors, GAPs, GEFs (e.g., SOS1), or downstream effectors [26, 27], B3GNT6 functions in glycan synthesis [28], suggesting a distinct regulatory mode. We propose two potential mechanisms: B3GNT6 may modulate glycosylation of KRAS or its upstream regulators (e.g., SOS, GAP, or receptor tyrosine kinases), thus altering their stability, localization, or interactions; alternatively, B3GNT6 may indirectly suppress KRAS signaling through glycan-mediated effects on the tumor microenvironment. In contrast to other KRAS modulators such as Transgelin-2 [27] or chemotherapeutic agents [29], B3GNT6 acts through glycosylation-dependent mechanisms, an under-explored layer of KRAS regulation in CRC. Our results showed that B3GNT6 overexpression significantly downregulated KRAS protein levels and p-ERK, suggesting an upstream inhibitory effect on the KRAS/ERK pathway. To verify this regulatory hierarchy, we performed rescue experiments. The results showed that after KRAS overexpression significantly reversed the phenotypes of tumor cells induced by B3GNT6 overexpression, such as inhibition of proliferation, reduction of migration and invasion ability and enhancement of apoptosis. These results confirm that B3GNT6 functions as a tumor suppressor by acting at an upstream node of the KRAS/ERK signaling pathway in CRC. Notably, this study provides the first direct experimental evidence that B3GNT6 negatively regulates the KRAS/ERK signaling pathway in CRC, establishing a causal regulatory relationship that extends beyond previous bioinformatic predictions. This novel regulatory mechanism extends our understanding of B3GNT6 function in CRC and represents the main mechanistic contribution of the present work. Identification of B3GNT6 as an upstream inhibitor of the KRAS/ERK has important therapeutic implications for CRC. Given the high frequency of KRAS mutations and limited efficacy of current targeted therapies, targeting B3GNT6 represents a novel strategy for KRAS-driven CRC. However, further work is needed to clarify its glycosylation-dependent mechanism, optimize delivery systems for in vivo application, and evaluate potential off-target effects.

There were also some limitations of this study. Although in vitro rescue experiments suggested an association between B3GNT6 and KRAS, direct correlation analysis of their expression in CRC tissues was not performed in this study, and we will collect more clinical samples to systematically explore the correlation between B3GNT6 and KRAS expression in future research, so as to further support the regulatory relationship between B3GNT6 and the KRAS/ERK signaling pathway in CRC progression. In terms of mechanistic depth, the precise molecular mechanism by which B3GNT6 regulates KRAS remains unclear. As a glycosyltransferase, it may modulate KRAS activity, stability, localization, or interactions via glycosylation or protein–protein binding, which requires further investigation using Co-IP, mRNA stability assays, promoter analysis, and glycosylation detection. For autophagy assessment, autophagy was only evaluated by LC3B and P62 immunofluorescence; Western blot analysis of LC3B-II/I and P62 is needed to validate these changes, and the hierarchical relationship and crosstalk between autophagy and the KRAS/ERK pathway also require clarification using specific autophagy modulators (e.g., chloroquine, rapamycin) combined with KRAS/ERK pathway regulators. Also, the present study only focused on the KRAS/ERK signaling pathway, and potential crosstalk with PI3K/AKT and Wnt/β-catenin pathways remains to be explored; additionally, loss-of-function (siRNA/shRNA) studies are needed to confirm the physiological necessity of B3GNT6. With respect to cell line and in vivo model, KRAS mutation status was not systematically evaluated in the cell lines used, and isogenic wild-type/mutant cell lines will help clarify mutation-dependent effects; furthermore, the subcutaneous xenograft model lacked in vivo rescue experiments, and future orthotopic/metastasis models and genetic B3GNT6 knockout models will improve clinical relevance. Finally, for clinical validation, larger patient cohorts with complete follow-up are required to validate B3GNT6’s correlation with clinicopathological features and survival.

Taken together, our study identified B3GNT6 as a novel CRC tumor suppressor through the inhibition of the KRAS/ERK pathway and regulation of autophagy. Our findings advance the field by providing the first experimental validation of B3GNT6 as a functional upstream regulator of KRAS/ERK signaling, rather than a mere prognostic biomarker. These findings provide new insights into the role of B3GNT6 in CRC progression and suggest that B3GNT6 is a potential therapeutic target.

Conclusion

Our study identified B3GNT6 as a novel CRC tumor suppressor through the inhibition of the KRAS/ERK pathway and regulation of autophagy. These findings provide new insights into the role of B3GNT6 in CRC progression and suggest that B3GNT6 is a potential therapeutic target.

Supplementary Information

Below is the link to the electronic supplementary material.

Abbreviations

CRC

Colorectal cancer

B3GNT6

Beta-1,3-N-acetylglucosaminyltransferase6

OGT

O-GlcNAc transferase

RT

qPCR-Reverse transcription quantitative real-time polymerase chain reaction

CCK

8-Cell Counting Kit-8

TUNEL

Terminal deoxynucleotidyl transferase dUTP nick end labeling

KRAS

Kirsten rat sarcoma viral oncogene homolog

ERK

Extracellular regulated protein kinases

RTKs

Receptor tyrosine kinases

ATCC

American Type Culture Collection

FBS

Fetal bovine serum

RPMI

1640-Roswell Park Memorial Institute 1640 medium

RIPA

Radioimmunoprecipitation assay

SDS

PAGE-Sodium dodecyl sulfate-polyacrylamide gel electrophoresis

PVDF

Polyvinylidene fluoride

Author contributions

Changwen Jing and Zhuo Wang contributed to data collection, statistical analysis, data interpretation and manuscript preparation. Haixia Cao, Yuetong Yu, and Bingzhe Li contributed to data collection and data interpretation. Rong Ma contributed to data collection and manuscript preparation. All authors have read and approved the final manuscript.

Funding

This study was supported by the National Natural Science Foundation (grant no. 82203045), the Jiangsu Social Development Project (grant no. BE2021745), Wu Jieping medical foundation (grant no. 320.6750.2024-24-7), and the grant from Health Commission of Anqing City (grant no. AQWJQL202512).

Data availability

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

The research was approved by the Ethics Committee of Jiangsu Cancer Hospital (Approval no. 2022 − 715) in compliance with the Helsinki Declaration. Written informed consent was obtained before the operation.

Consent for publication

All patients agreed for publication.

Competing interests

The authors declare no competing interests.