Generation of an induced pluripotent stem cell line from a patient with Loeys–Dietz syndrome

Abstract

Loeys–Dietz syndrome (LDS) is a rare autosomal dominant connective tissue disorder caused by pathogenic variants in genes involved in the TGF-β signaling pathway. Here, we report the generation of a human induced pluripotent stem cell (iPSC) line derived from peripheral blood mononuclear cells (PBMCs) of an LDS patient carrying a heterozygous TGFBR1 mutation (c.679G > A, p.Glu227Lys). The iPSC line exhibits normal morphology, expresses pluripotency markers, maintains chromosomal integrity, and demonstrates trilineage differentiation capacity. This patient-specific iPSC line provides a valuable platform for modeling LDS pathogenesis and investigating vascular disease mechanisms.

1. Resource table

Unique stem cell lines identifier	BFVSBi008-A
Institution	Baszucki Family Vascular Surgery Biobank
Contact information of the reported cell line distributor	Dr. Nazish Sayed
Type of cell lines	iPSC
Origin	Human
Additional origin info (Applicable for human ESC or iPSC)	BFVSBi008-A; Age 32, Sex: male, Ethnicity: White
Cell Source	PBMCs
Method of reprogramming	Integration-free Sendai virus expressing human OCT4, SOX2, KLF4, and c-MYC
Clonality	Clonal
Evidence of the reprogramming transgene loss	RT/q-PCR
Type of Genetic Modification	Missense mutation
Associated disease	Loeys-Dietz syndrome (LDS)
Gene/locus	TGFBR1 gene (c.679G > A, p.Glu227Lys)
Date archived/stock date	BFVSBi008-A: 1–15-2025
Cell line repository/bank	https://hpscreg.eu/cell-line/BFVSBi008-A
Ethical approvals	The Administrative Panel approved the generation of the lines on Human Subjects Research (IRB) under IRB #62122, “Human Induced Pluripotent Stem Cells for Studying Cardiac and Vascular Diseases.”

2. Resource utility

The patient carries a pathogenic TGFBR1 variant (c.679G > A, p. Glu227Lys) and was diagnosed with Loeys–Dietz syndrome, presenting with severe vascular manifestations including thoracic aortic aneurysm, dissection, and arterial tortuosity. This patient-derived iPSC line provides a robust platform to investigate LDS disease mechanisms and evaluate therapeutic strategies.

3. Resource details

Loeys–Dietz syndrome (LDS) is a rare autosomal dominant connective tissue disorder characterized by hypertelorism, arterial tortuosity, widespread aneurysms, craniosynostosis, and craniofacial abnormalities such as cleft palate or bifid uvula (Loeys et al. 2005). The prevalence of LDS remains unknown due to limited case reports and small patient cohorts (Gouda et al. 2022). LDS shares several clinical features with Marfan syndrome (MFS), including aortic root aneurysm, arterial tortuosity, scoliosis, and arachnodactyly (Renard et al. 2010). However, LDS is associated with a more aggressive vascular phenotype, characterized by accelerated aneurysm progression and a markedly increased risk of aortic rupture compared with MFS (Maleszewski et al. 2009). LDS is primarily caused by pathogenic variants in genes involved in the transforming growth factor-β (TGF-β) signaling pathway, including TGFBR1, TGFBR2, SMAD3, TGFB2, and TGFB3 (Inamoto et al. 2010, van de Laar et al. 2011, Cardoso et al. 2012). These variants are predominantly missense mutations that disrupt normal TGF-β signaling, resulting in dysregulated downstream signaling activity and altered extracellular matrix organization (Takeda et al., 2016). Previous studies have demonstrated that pathogenic TGFBR1 variants cause lineage-specific smooth muscle cell defects in LDS, which can be partially reversed by combinatorial treatment with activin A and rapamycin (Zhou et al. 2021).

Modeling LDS remains challenging due to substantial genetic heterogeneity and variable clinical expressivity among affected individuals. Patient-derived induced pluripotent stem cells (iPSCs) provide a powerful platform to recapitulate disease-relevant genetic backgrounds and phenotypes in vitro. These iPSCs can be differentiated into vascular cell types, enabling mechanistic investigation of LDS-associated vascular dysfunction and facilitating therapeutic discovery.

Here, we generated an iPSC line (BFVSBi008-A) from PBMCs obtained from a 32-year-old male patient diagnosed with LDS who experienced severe vascular manifestations. The patient carries a heterozygous pathogenic TGFBR1 variant, c.679G > A (p.Glu227Lys). Reprogramming was performed using integration-free Sendai virus vectors expressing the four Yamanaka factors (OCT3/4, SOX2, KLF4, and c-MYC). The resulting iPSC line was expanded to passage 14 and exhibited typical human pluripotent stem cell morphology (Fig. 1A). Pluripotency was confirmed by quantitative RT-PCR analysis demonstrating robust expression of NANOG and SOX2, comparable to control iPSCs and significantly higher than differentiated cardiomyocytes used as negative controls (Fig. 1B). Immunofluorescence staining further confirmed expression of pluripotency markers NANOG, SOX2, and OCT3/4 (Fig. 1C; scale bar = 200 μm). Trilineage differentiation assays demonstrated the capacity of BFVSBi008-A iPSCs to generate derivatives of endoderm, mesoderm, and ectoderm, as confirmed by lineage-specific marker expression (Fig. 1D). Retention of the disease-causing TGFBR1 mutation was verified by Sanger sequencing (Fig. 1E). By passage 15, Sendai viral genomes were no longer detectable (Fig. 1F). The iPSC line tested negative for mycoplasma contamination (Fig. 1G) and exhibited a normal karyotype by genome-wide analysis (Fig. 1H). Short tandem repeat analysis confirmed genetic concordance between the iPSC line and the donor PBMCs.

Fig. 1.

4. Materials and methods

4.1. Reprogramming of PBMC to iPSCs

As described previously (Manhas et al., 2024), peripheral blood mononuclear cells (PBMCs) were isolated from whole blood using Percoll density gradient medium (GE Healthcare, #17089109). PBMCs were maintained in StemPro^®-34 SFM medium supplemented with 100 ng/mL stem cell factor (SCF; PeproTech, #300–07), 100 ng/mL Flt3 ligand (Thermo Fisher Scientific, #PHC9414), 20 ng/mL interleukin-3 (IL-3; PeproTech, #200–03), 20 ng/mL erythropoietin (EPO; Thermo Fisher Scientific, #PHC9631), and 20 ng/mL interleukin-6 (IL-6; Thermo Fisher Scientific, #PHC0063), with media changes every two days. A total of 2 x 10⁵ PBMCs were reprogrammed using the CytoTune^™-iPSC 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific, #A16517) according to the manufacturer’s protocol and cultured in StemPro^™-34 medium until day 7 post-transduction. iPSC colonies typically appeared between days 10 and 15 and were manually picked and expanded for further characterization.

4.2. Cell culture

iPSCs were maintained in StemMACS^™ iPS-Brew XF medium with media changes every other day. Upon reaching approximately 85% confluence, cells were enzymatically dissociated using TrypLE^™ Express (Gibco) and passaged onto Matrigel-coated plates at a density of 1.2 x 10⁵ cells per well of a 6-well plate. Cells were cultured in medium supplemented with 10 μM Y-27632 ROCK inhibitor (Selleck Chemicals, #Y27632) for the first 24 h following passaging. Cells typically reached confluence within 3–4 days.

4.3. Trilineage differentiation

Trilineage differentiation was performed at passage 20. Ectoderm and endoderm differentiation were carried out using the Human Pluripotent Stem Cell Functional Characterization Kit (R&D Systems, #SC027B) and the STEMdiff^™ Definitive Endoderm Differentiation Kit (STEMCELL Technologies, #05110), respectively, according to the manufacturers’ instructions. Mesoderm differentiation was induced using RPMI 1640 medium supplemented with B27 minus insulin (Gibco, #11875–085 and #A18956-01) and 6 μM CHIR99021 (Selleck Chemicals, #S2924) (see Table 1).

Table 1.

Characterization and validation.

Classification	Test	Result	Data
Morphology	Photography Bright field	Normal	Fig. 1A
Phenotype	Quantitative analysis (RT-qPCR)	mRNA expression of SOX2 and NANOG	Fig. 1B
	Qualitative analysis (Immunocytochemistry)	Positive expression of pluripotency markers: Oct3/4, NANOG, SOX2	Fig. 1C
Genotype	Karyotype: G-banded analysis (20 metaphase spreads)	Normal karyotype: 46 XY for BFVSBi008-A	Fig. 1H
Identity	Microsatellite PCR (mPCR) or STR analysis	N/A	N/A
		16 loci tested, 100% matching identity	Submitted in archive with journal
Mutation analysis	Sequencing	N/A	N/A
	Southern Blot OR WGS	N/A	N/A
Microbiology and virology	Mycoplasma	Luminescence: Negative	Fig. 1G
Differentiation potential	Directed differentiation, Immunofluorescence staining for 2 markers per germ layer	Positive Immunofluorescence staining of three germ layer markers Ectoderm: PAX6, OTX2 Endoderm: SOX17, FOXA2, Mesoderm: BRACHYURY, TBX6	Fig. 1D
Donor screening	HIV 1 + 2 Hepatitis B, Hepatitis C	N/A	N/A
Genotype additional info	Blood group genotyping	N/A	N/A
	HLA tissue typing	N/A	N/A

4.4. Immunofluorescence

At passage 25, iPSCs were seeded onto coverslips in 24-well plates. Cells were fixed with 4% formaldehyde for 15 min at room temperature and permeabilized with 0.5% Triton X-100 for 10 min. After washing, cells were blocked in PBS containing 0.1% Tween-20 and 3% bovine serum albumin for 1 h at room temperature. Cells were incubated overnight at 4 °C with primary antibodies (Table 2), followed by incubation with Alexa Fluor-conjugated secondary antibodies (Table 2) for 1 h at room temperature. Nuclei were counterstained with DAPI (1:2500 dilution). Coverslips were mounted and fluorescence images were acquired using a KEYENCE fluorescence microscope.

Table 2.

Reagents details.

Antibodies used for Immunocytochemistry
	Antibody	Dilution	Company Cat #	RRID
Pluripotency Markers	Rabbit Anti-NANOG	1:200	Proteintech Cat# 142951–1-AP,	AB_1607719
	Mouse IgG2bκ Anti-OCT-3/4	1:200	Santa Cruz Biotechnology Cat# sc-5279,	AB_628051
	Mouse IgG1κ Anti-SOX2	1:200	Santa Cruz Biotechnology Cat# sc-365823,	AB_10842165
Ectoderm Markers	Goat Anti-OTX2	1:200	R&D Systems Cat# 963273	AB_2157172
	Rabbit Anti-Pax6	1:100	Thermo Fisher Scientific Cat# 42–6600	AB_2533534
Endoderm Markers	Goat Anti-SOX17	1:200	R&D Systems Cat# 963121	AB_355060
	Rabbit Anti-Foxa2	1:250	Thermo Fisher Scientific Cat# 701698	AB_2576439
Mesoderm Markers	Goat Anti-Brachyury	1:200	R&D Systems Cat# 963,427	AB_2200235
	Rabbit Anti-Tbx6	1:200	Thermo Fisher Scientific cat # PA5-35102	AB_2552412
Secondary Antibodies	Alexa Fluor 488 Goat Anti-Mouse IgG1	1:1000	Thermo Fisher Scientific #A-21121	AB_2535764
	Alexa Fluor 488 Donkey Anti-Goat IgG (H + L)	1:1000	Thermo Fisher Scientific #A-11055	AB_2534102
	Alexa Fluor 555 Goat Anti-Rabbit IgG (H + L)	1:500	Thermo Fisher Scientific #A-21428	AB_141784
	Alexa Fluor 647 Goat Anti-Mouse IgG2b	1:250	Thermo Fisher Scientific #A-21242	AB_2535811
Primers	Target	Forward/Reverse primer (5′-3′)
Sendai Virus	Sendai Virus genome	Mr04269880_mr
Genotyping	TGFBR1 (c.679G > A)	Fwd: TACCATTGCTTGTTCAGAGAACA Rev: AGGAAAAGCAAATGTTACAGACC
House-Keeping Gene	GAPDH	HS02758991_g1
Pluripotency marker	SOX2	HS01053049_s1
Pluripotency marker	NANOG	HS02387400_g1

4.5. RT-PCR

Total RNA was extracted from passage 15 iPSCs using TRIzol^® reagent in combination with the Direct-zol^™ RNA Microprep Kit (Zymo Research, #R2062). cDNA synthesis was performed using the iScript^™ cDNA Synthesis Kit (Bio-Rad, #1708891). Quantitative PCR was carried out using TaqMan^™ Gene Expression Assays (Applied Biosystems^™, #4444556) with probes listed in Table 2 to assess expression of NANOG, SOX2, and Sendai virus (SEV).

4.6. Karyotyping

Chromosomal integrity was assessed at passage 20 by G-banded karyotypic analysis performed by Cell Guidance Systems (Cambridge, UK).

4.7. Short tandem repeat analysis

Genomic DNA was isolated from PBMCs and iPSCs at passage 21 using the QIAamp^® DNA Micro Kit (Qiagen, #56304). STR profiling was performed using the CLA IdentiFiler^™ Direct PCR Amplification Kit (Thermo Fisher Scientific, #A44660) and analyzed by capillary electrophoresis on an ABI 3130xl Genetic Analyzer (Azenta Life Sciences).

4.8. Mycoplasma detection

Mycoplasma contamination was assessed at passage 24 using the MycoAlert^™ PLUS Mycoplasma Detection Kit (Lonza, #LT07-705).

Data availability

Data will be made available on request.