ABSTRACT
Background and Aims
Human adenoviruses (HAdVs) are common viral pathogens causing pediatric diarrheal disease worldwide. This study aimed to investigate the prevalence and genotypic diversity of HAdV strains among hospitalized children (< 5 years of age) with acute gastroenteritis (AGE) in Tehran, Iran, during two distinct periods: 2021–2022 and 2023–2024.
Methods
A total of 398 stool samples (200 from 2021 to 2022 and 198 from 2023 to 2024) were collected. HAdV detection and genotyping were performed using PCR and sequencing of the hexon hypervariable regions (HVRs 1–7) and fiber genes. Phylogenetic analysis was conducted to determine lineages and genotypic clusters (GTCs).
Results
The HAdV positivity rate increased from 14% (28/200) in 2021–2022 to 20.2% (40/198) in 2023–2024. Nine distinct types were identified across four species (HAdV‐B, ‐C, ‐D, and ‐F), encompassing both enteric and non‐enteric types. HAdV‐F41 and HAdV‐C2 were the most prevalent types. Molecular characterization of HAdV‐F41 strains revealed the circulation of hexon‐based GTC1 and fiber‐based GTC2 genotypic clusters. These strains were further classified into hexon‐lineage 1 and fiber‐lineage 2, consistent with the lineage 2b/subtype G3 classification.
Conclusion
Our findings highlight a significant increase in HAdV prevalence and a diverse range of circulating genotypes. The dominance and evolution of HAdV‐F41 lineage 2b/subtype G3 underscore the importance of continuous molecular surveillance to monitor emerging genotypic shifts and inform public health strategies for HAdV‐associated gastroenteritis in Iran.
Keywords: HAdV‐F41, human adenovirus, lineage
1. Introduction
Human adenoviruses (HAdVs) are non‐enveloped, linear double‐stranded DNA viruses that were first isolated in 1953 from human adenoidal tissue, and belong to the genus Mastadenovirus within the family Adenoviridae [1, 2]. The genome is approximately 35 kb in length and encodes about 30–40 proteins. The HAdVs are separated into seven species (A–G), and subdivided into 110 types [2, 3, 4]. Historically, HAdV types were defined by serological neutralization; however, current classification increasingly relies on genomic characterization of the three major capsid proteins: the hexon (containing hypervariable regions), the penton base (responsible for cell attachment), and the fiber (mediating receptor binding) [5, 6]. This multi‐gene approach is essential for identifying intertypic recombination events, which are major drivers of HAdV evolution [5, 7].
HAdVs are associated with a wide range of clinical manifestations, primarily affecting the gastrointestinal, respiratory, ocular, and renal systems. Although less common, severe conditions such as hemorrhagic cystitis, hepatitis, hemorrhagic colitis, pancreatitis, nephritis, and meningoencephalitis have also been reported [8]. Species HAdV‐F (types 40 and 41) are the primary enteric HAdVs associated with acute gastroenteritis (AGE) [2]. While other species (HAdV‐B, ‐C, ‐D, and ‐G) are sporadically detected in stool samples, their role as primary enteric pathogens is less established [9, 10, 11, 12, 13, 14]. Globally, enteric HAdV‐F species are estimated to be responsible for 1%–32% of AGE cases in children [15, 16, 17, 18].
HAdV‐F41 is the second leading cause of viral gastroenteritis in toddlers after rotavirus [19]. Unlike other species, HAdV‐F40 and HAdV‐F41 show limited potential for intertypic recombination [20, 21, 22]. However, genetic diversity in HAdV‐F41 is driven by polymorphisms and mutations within the hexon's hypervariable regions (HVR1–7), leading to its classification into distinct genotypic clusters (GTCs). It has been suggested that these genetic shifts might be associated with the observed epidemiological transition from HAdV‐F40 to HAdV‐F41 dominance reported in several regions, although this association remains a subject of ongoing investigation [23, 24]. Moreover, the HAdV‐F41 has also been related to outbreaks of severe acute hepatitis of “unknown origin” in children, at the same time as the SARS‐CoV‐2 outbreak (Coronavirus disease 2019; COVID‐19) [25, 26]. Given this, complete genomic HAdV‐F41 sequences were currently generated and documented that HAdV‐F41 evolved with three lineages co‐circulating. In this context, lineage 1 included the prototype “Tak” from 1973. Lineage 2 included strains from 2000 to 2022, and was divided into two sub‐lineages 2a and 2b. Lineage 3, possibly first designated in 2009, is characterized by a 45‐nucleotide deletion in the long fiber gene and has undergone significant evolution in the short fiber and E3 region. This lineage is further subdivided into sub‐lineages 3a and 3b [27].
The implementation and subsequent easing of COVID‐19 public health interventions significantly altered the transmission dynamics of various enteric viruses [28, 29]. However, epidemiological data regarding the shifts in HAdV prevalence and genetic evolution during the transition from the pandemic to the post‐pandemic era, particularly in the Middle East, remain limited.
Furthermore, phylogenetic analysis of hexon, long fiber, short fiber, and penton base genes has indicated that all HAdV‐F41 strains are separated into three lineages based on hexon sequences, three lineages based on either long or short fiber genes, and one lineage based on penton base sequences [30]. Based on the clustering of these four capsid genes, eight distinct subtypes (G1–G8) of HAdV‐F41 have been defined, with G3 identified as the currently predominant subtype worldwide [30]. In Iran, previous reports have consistently identified HAdV‐F41 as the dominant type associated with AGE among children, surpassing HAdV‐F40 in prevalence [13, 31, 32, 33]. However, the COVID‐19 pandemic and its associated public health interventions significantly disrupted the transmission patterns of enteric viruses. Understanding how HAdV circulation and genetic diversity shifted during the transition from the pandemic to the post‐pandemic era is of critical epidemiological importance.
Therefore, the present study was designed to monitor the frequency and genetic characteristics of HAdV strains among children < 5 years of age in Tehran, Iran, during two distinct periods: January 2021–January 2022 (a period of ongoing pandemic‐related measures) and October 2023–October 2024 (the post‐pandemic period). By comparing these two separate snapshots, we aimed to evaluate the genotypic diversity and perform a detailed genetic analysis of HAdV‐F41 strains to identify potential evolutionary shifts in the aftermath of the pandemic.
2. Materials and Methods
2.1. Sample Collection
To investigate the frequency and diversity of HAdVs, particularly HAdV‐F41, a total of 200 and 198 stool samples were collected from children < 5 years of age hospitalized for AGE at Children's Hospitals in Tehran, in two‐time intervals, January 2021–January 2022 and October 2023–October 2024, respectively. Collected stool samples are sent to the laboratory of Molecular Virology, in Pasteur Institute of Iran, and stored at −20°C until they are processed for HAdVs detection and genetic analysis. This study was conducted according to the Helsinki guidelines and approved by the ethics committee of the Tehran University of Medical Sciences (IR.TUMS.SPH.REC.1403.062 and IR.TUMS.SPH.REC.1404.140). Written informed consent was obtained from the parents of all children < 5 years of age who were hospitalized with AGE at Tehran Children's Hospitals.
2.2. Viral DNA Extraction
Stool samples were suspended in phosphate‐buffered saline to prepare a 10% (wt/vol) suspension and centrifuged at 1500 g for 20 min. The clarified supernatants were then used for viral DNA extraction using the High Pure Viral Nucleic Acid Kit (Roche Diagnostics GmbH, Germany) according to the manufacturer's instructions.
2.3. The HAdV Detection and Typing by PCR and Sequencing
The extracted viral DNA was first screened by PCR using specific primers Hex1deg(+) and Hex2deg(−) (Table 1) targeting a 308 bp fragment of the hexon gene [34]. PCR reactions were prepared with mixture of the DNA (100–200 ng), 10 μM each of specific primers, and 1x mastermix (Ampliqon TEMPase Hot Start 2× Master Mix, Odense M, Denmark) to a final volume 25 microliters, incubated at 95°C for 15 min, followed by 40 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s, and a final extension at 72°C for 7 min. The amplified products were first analyzed by 1.5% (wt/vol) agarose gel electrophoresis and subjected to bidirectional Sanger sequencing using an ABI 3130 automated sequencer (Applied BioSystems, Foster City, CA) to confirm the HAdV species and types.
TABLE 1.
Primers used for HAdV detection and molecular characterization.
| Purpose | Primer name | Sequence 5′–3′ | Targeted region | References |
|---|---|---|---|---|
| Initial screening and typing of HAdVs | Hex1deg(+) | GCCSCARTGGKCWTACATGCACATC | Partial hexon gene | [34] |
| Hex2deg(−) | CAGCACSCCICGRATGTCAAA | |||
| Lineage and GTC determination of HAdV‐F41 | S29(+) | GCCAGCACRTWCTTTGACAT | Hexon gene; HVR1‐7 | [35] |
| S52(−) | CCCATGTTGCCAGTGCTGTTGTARTACA | |||
| S51(+) | CCCAACAGACCCAAYTAC | |||
| S53(−) | AAGGGGTTGACGTTGTCCAT | |||
| Lineage and GTC determination of HAdV‐F41 | AdFfib(+) | ACTTAATGCTGACACGGGCAC | The long fiber gene | [36] |
| AdFfib(−) | TAATGTTTGTGTTACTCCGCTC |
Note: Degenerate nucleotide codes: N = A/C/G/T; K = G/T; R = A/G; S = C/G; Y = C/T; and W = A/T.
2.4. The HAdV‐F41 Hexon and Fiber Genetic Analysis
A subset of HAdV‐F41‐positive samples was selected for genetic characterization based on sample quality and viral load. All selected samples were subjected to amplification and sequencing attempts for both the hexon and fiber genes. However, successful sequencing varied according to nucleic acid quality, amplification efficiency, and sequence quality. Consequently, high‐quality sequences of the hexon HVRs 1–7 were obtained for 12 samples, whereas fiber gene sequences were successfully generated for 19 samples (both the hexon and fiber genes were successfully sequenced in 11 samples; Supplementary Table 1). To this purpose, the hexon HVRs of HAdV‐41 strains were amplified using the primer pairs S29(+)/S52(−) and S51(+)/S53(−) (Table 1), yielding expected product sizes of 724 and 637 bp, respectively [35]. In addition, the fiber gene was amplified using the primer pair AdFfib(+)/AdFfib(−) (Table 1), with an expected product size ranging from 541 to 586 bp [36]. Conditions were identical to those described in Section 2.3. It should be noted that due to laboratory resource constraints, the penton base gene was not characterized; therefore, while lineage assignment was performed, definitive subtype classification (G1–G8) was limited by the absence of this third major capsid gene. The amplified products were also analyzed by agarose gel electrophoresis and subjected to bidirectional Sanger sequencing using an ABI 3130 automated sequencer (Applied BioSystems, Foster City, CA) to use for phylogenetic analysis.
2.5. Phylogenetic Analysis
The nucleotide sequence of the hexon and fiber genes was edited using CLC Main Workbench (CLC Bio, version 5.5). Sequences were multi‐aligned with reference sequences retrieved from GenBank using the ClustalW algorithm. Phylogenetic trees were constructed using the Maximum Likelihood Method (MLM) based on the Kimura 2‐parameter model with 1000 bootstrap replicates to assess node reliability (MEGA 11) [37]. The sequences obtained in this study were submitted to the NCBI GenBank database and are available under the accession numbers PV745400–PV745430.
The phylogenetic analysis was performed in three hierarchical steps: (1) General typing: a partial hexon gene tree was constructed to identify the species and types of all HAdV isolates (Figure 1). (2) Lineage determination: for HAdV‐F41 isolates, separate trees for hexon (HVR 1–7) and fiber genes were generated to classify strains into established lineages (Figures 2 and 3). (3) GTC assignment: finally, representative strains were analyzed using both genes to identify their GTC patterns, distinguishing between GTC1 and GTC2 (Figure 4).
FIGURE 1.
Global phylogenetic distribution of HAdV types. The phylogenetic tree was constructed through the maximum likelihood method (MLM), using the Kimura 2‐parameter substitution model based on partial hexon gene sequences (301 bp). This tree illustrates the overall diversity of HAdV species and types identified in the study compared to reference global strains. Bootstrap values (1000 replicates) are shown at branch nodes, and values greater than 50% are presented. The scale bar represents 0.05 genetic distance.
FIGURE 2.
Lineage characterization of HAdV‐F41 based on the hexon gene (HVR1‐7). The trees were generated using the maximum likelihood method (MLM) with the Kimura 2‐parameter substitution model. This tree specifically analyzes HAdV‐F41 strains to classify them into distinct hexon‐lineages. Bootstrap support values (based on 1000 replicates) are shown at the branch nodes, with only values exceeding 50% displayed. The scale bar denotes a genetic distance of 0.05. HAdV‐F41 sequences identified in this study from 2021 to 2022 and 2023 to 2024 are marked with green and blue squares, respectively, according to their strain names. The accession numbers of the reference sequences used for phylogenetic tree construction are listed below: ON532824.1, MW567965.1, ON442326.1, ON442325.1, ON532822.1, MG925782.1, ON442323.1, MW686855.1, MW567964.1, ON442327.1, ON532827.1, ON442328.1, ON532825.1, MW686856.1, MW686854.1, MW567966.1, ON532821.1, ON532823.1, ON442324.1, ON442330.1, DQ315364.2, KY316163.1, KY316162.1, KY316160.1, MH465394.1, ON532820.1, HM565136.3, ON532818.1, ON532819.1, ON442312.1, KY316164.1, MK883610.1, ON442320.1, ON442319.1 ON442318.1, ON442315.1, ON442317.1, W686853.1, KX868523.2, MK962808.1, MK962810.1, MG925783.1, ON442314.1, KF303071.1, ON442313.1, MW686857.1, MW567962.1, AB728839, KY316161.1, ON532826.1, MZ603083.1, ON442321.1, KF303070.1, KF303069.1, ON442322.1, ON532817.1, ON442316.1, MK962809.1, MK342137.1, MK342152.1, MK342151.1, MK342136.1, MK342149.1, MK342148.1, MK342140.1, K342142.1, and L19443.1.
FIGURE 3.
Lineage characterization of HAdV‐F41 based on the fiber gene. The trees were generated using the maximum likelihood method (MLM) with the Kimura 2‐parameter substitution model. This analysis targets the fiber gene to determine fiber‐specific lineages of the HAdV‐F41 strains. Bootstrap support values (based on 1000 replicates) are shown at the branch nodes, with only values exceeding 50% displayed. The scale bar denotes a genetic distance of 0.05. HAdV‐F41 sequences identified in this study from 2021 to 2022 and 2023 to 2024 are marked with green and blue squares, respectively, according to their strain names. The accession numbers of the reference sequences used for phylogenetic tree construction are listed below: KY316163.1, ON532820.1, MH465394.1, DQ315364.2, AB728839.1, KX868523.2, OP047705.1, MW686856.1, KF303069.1, ON442312.1, ON442326.1, L19443.1, MW567963.1, and MG925783.1. Sequences obtained from strains identified in our previous study, which have not yet been submitted to GenBank, were also included in the phylogenetic analysis and are listed below: Human mastadenovirus F/IRN/124/2016/Fiber/HAdV‐41; Human mastadenovirus F/IRN/141/2016/Fiber/HAdV‐41; and Human mastadenovirus F/IRN/156/2016/Fiber/HAdV‐41. Human mastadenovirus F/IRN/242/2016/Fiber/HAdV‐41; Human mastadenovirus F/IRN/245/2016/Fiber/HAdV‐41; and Human mastadenovirus F/IRN/246/2016/Fiber/HAdV‐41. Human mastadenovirus F/IRN/262/2016/Fiber/HAdV‐41; Human mastadenovirus F/IRN/293/2016/Fiber/HAdV‐41; and Human mastadenovirus F/IRN/316/2017/Fiber/HAdV‐41. Human mastadenovirus F/IRN/340/2017/Fiber/HAdV‐41; Human mastadenovirus F/IRN/70/2021/Fiber/HAdV‐41; and Human mastadenovirus F/IRN/12391/2021/Fiber/HAdV‐41. Human mastadenovirus F/IRN/1918/2021/Fiber/HAdV‐41; Human mastadenovirus F/IRN/2359/2021/Fiber/HAdV‐41; and Human mastadenovirus F/IRN/9792/2021/Fiber/HAdV‐41. Human mastadenovirus F/IRN/8413/2021/Fiber/HAdV‐41.
FIGURE 4.
Identification of genotypic clusters (GTCs) in HAdV‐41. The trees were generated using the maximum likelihood method (MLM) with the Kimura 2‐parameter substitution model. The GTC patterns of HAdV‐F41 were determined by analyzing the hexon and fiber sequences of representative strains, as illustrated in the (a) hexon and (b) fiber phylogenetic trees. Strain names were also assigned in accordance with the nomenclature used in the previous figures. The scale bar denotes a genetic distance of 0.05 and 0.01 for hexon and fiber, respectively. The accession numbers of the reference sequences used for phylogenetic tree construction (hexon) are listed below: MK342150.1, MK342151.1, MK342152.1, MK342153.1, AB103341.1, AB103342.1, AB103343.1, AB103344.1, AB103345.1, AB103346.1, AB103347.1, AB103348.1, and L19443.1. Sequences obtained from strains identified in our previous study, which have not yet been submitted to GenBank, were also included in the phylogenetic analysis (hexon) and are listed below: Human mastadenovirus F/IRN/340/2017/Hexon/HAdV‐41; Human mastadenovirus F/IRN/316/2017/Hexon/HAdV‐41; Human mastadenovirus F/IRN/245/2016/Hexon/HAdV‐41; and Human mastadenovirus F/IRN/141/2016/Hexon/HAdV‐41. The accession numbers of the reference sequences used for phylogenetic tree construction (fiber) are listed below: AB246860.1, AB246865.1, AB246870.1, AB246878.1, AB246858.1, AB246853.1, AB246852.1, AB610538.1, AB610540.1, AB610541.1, GU245890.1, GU245893.1, and L19443.1. Sequences obtained from strains identified in our previous study, which have not yet been submitted to GenBank, were also included in the phylogenetic analysis (fiber) and are listed below: Human mastadenovirus F/IRN/124/2016/Fiber/HAdV‐41; Human mastadenovirus F/IRN/141/2016/Fiber/HAdV‐41; Human mastadenovirus F/IRN/156/2016/Fiber/HAdV‐41; Human mastadenovirus F/IRN/242/2016/Fiber/HAdV‐41; Human mastadenovirus F/IRN/245/2016/Fiber/HAdV‐41; Human mastadenovirus F/IRN/246/2016/Fiber/HAdV‐41; Human mastadenovirus F/IRN/262/2016/Fiber/HAdV‐41; Human mastadenovirus F/IRN/293/2016/Fiber/HAdV‐41; Human mastadenovirus F/IRN/316/2017/Fiber/HAdV‐41; and Human mastadenovirus F/IRN/340/2017/Fiber/HAdV‐41.
3. Results
3.1. Positive Rate and Distribution of Circulating HAdVs in Two Time Intervals 2021–2022 and 2023–2024
The positive rate of HAdVs in hospitalized children < 5 years of age with AGE conducted during 2021–2022 and 2023–2024 was estimated to be 14% (28/200) and 20.2% (40/198), respectively. The partial sequencing of the hexon was applied to construct a phylogenetic tree and characterize HAdV strains. In this context, phylogenetic analysis revealed that the HAdV strains identified in Iran clustered within the HAdV‐F, HAdV‐B, HAdV‐C, and HAdV‐D lineages, with strong statistical support indicated by high bootstrap values (Figure 1). Between 2021 and 2022, the most prevalent HAdV was HAdV‐F41 (n = 10, 35.8%), followed by HAdV‐C2 (n = 9, 32.1%), HAdV‐C5 (n = 6, 21.4%), HAdV‐C89 (n = 2, 7.1%), and HAdVF‐40 (n = 1, 3.6%). Moreover, from 2023 to 2024, the predominant HAdV strains was HAdV‐F41 (n = 25, 62.5%), followed by HAdV‐B3 (n = 5, 12.5%), HAdV‐C1 (n = 3, 7.5%), HAdV‐C2 (n = 3, 7.5%), HAdV‐F40 (n = 1, 2.5%), HAdV‐C5 (n = 1, 2.5%), HAdV‐C6 (n = 1, 2.5%), and HAdV‐D (n = 1, 2.5%) (Table 2).
TABLE 2.
Distribution of HAdV strains in hospitalized children < 5 years of age during the two study periods.
| HAdV strains | Number, (%) | |
|---|---|---|
| 2021–2022 | 2023–2024 | |
| HAdV‐F41 | 10 (35.8) | 25 (62.5) |
| HAdV‐F40 | 1 (3.6) | 1 (2.5) |
| HAdV‐B3 | — | 5 (12.5) |
| HAdV‐C1 | — | 3 (7.5) |
| HAdV‐C2 | 9 (32.1) | 3 (7.5) |
| HAdV‐C5 | 6 (21.4) | 1 (2.5) |
| HAdV‐C6 | — | 1 (2.5) |
| HAdV‐C89 | 2 (7.1) | — |
| HAdV‐D | — | 1 (2.5) |
| Total | 28 (100) | 40 (100) |
3.2. Determination of Lineages/Subtypes/GTC Pattern of HAdV‐F41 by Genetic Analysis of Hexon/Fiber
To characterize the HAdV‐F41 strains, we utilized three complementary classification systems: lineages (based on individual gene evolution), subtypes G1–G8 (based on the combination of four capsid genes), and GTCs (based on specific restriction or sequence patterns).
Phylogenetic analysis of the hexon gene indicated that Iranian HAdV‐F41 strains belong to the lineage 1 cluster (98% bootstrap; Figure 2). Analysis of the fiber gene showed clustering within lineage 2; however, this assignment had a bootstrap support value of 66% (Figure 3), which is below the threshold for robust statistical inference and should be interpreted with caution. By integrating these findings, and despite the absence of penton base and short fiber sequences, the combined hexon (L1) and fiber (L2) patterns suggest that the circulating strains likely correspond to lineage 2b and subtype 3 (G3), the latter being the current dominant subtype globally (Table 3). To further refine this, the GTC pattern of the Iranian HAdV‐F41 strains was determined by comparing their hexon and fiber sequences with reference strains representing known GTC1 and GTC2 patterns. The phylogenetic analysis of the hexon HVRs revealed that all Iranian strains in this study belonged to GTC1. These strains clustered with reference strains D1, D25, D26, D27, and D28, as well as with hexon sequences of HAdV‐F41 strains previously identified in Iran during 2016–2017 (Figure 4a). In contrast, phylogenetic analysis based on the fiber gene demonstrated that these same strains were associated with GTC2. The Iranian isolates clustered with fiber sequences of HAdV‐F41 strains previously detected in Iran during 2016–2017 (Figure 4b). This observed discrepancy between hexon‐based (GTC1) and fiber‐based (GTC2) clustering is a known characteristic of certain HAdV‐F41 lineages and further supports their classification into the currently dominant global lineages.
TABLE 3.
Classification of HAdV‐41 based on lineages and subtypes present in global and Iranian strains.
| Full sequence of all HAdV‐F41 strains in the word | Hexon | Long fiber | Short fiber | Penton | Subtype | ||
|---|---|---|---|---|---|---|---|
| 3 Lineages | Lineage 1 | Lineage 1 | Lineage 1 | Lineage1 | Lineage 1 | 1 | |
| Lineage 1 | Lineage 1 | Lineage 2 | Lineage 1 | 2 | |||
| Lineage 2 | Sub‐lineage 2a | Lineage 2 | Lineage 2 | Lineage 2 | Lineage 1 | 7 | |
| Sub‐lineage 2b | Lineage 1 | Lineage 2 | Lineage 2 | Lineage 1 | 3 | ||
| ‐‐‐ | Lineage 2 | Lineage 1 | Lineage 2 | Lineage 1 | 6 | ||
| Lineage 3 | Sub‐lineage 3a | Lineage 3 | Lineage 3 | Lineage 3 | Lineage 3 | 8 | |
| Sub‐lineage 3b | Lineage 1 | Lineage 3 | Lineage 3 | Lineage 1 | 5/4 | ||
| Sequences of detected HAdV‐F41 strains in Iran | Lineage/sub‐lineage | Hexon | Long fiber | Short fiber | Penton | Subtype | |
|---|---|---|---|---|---|---|---|
| Human mastadenovirus F/IRN/2021‐2022/HAdV‐41 strains | Sub‐lineage 2b | Lineage 1 | Lineage 2 | ‐‐‐ | ‐‐‐ | 3 | |
| Human mastadenovirus F/IRN/2023‐2024/HAdV‐41 strains | Sub‐lineage 2b | Lineage 1 | Lineage 2 | ‐‐‐ | ‐‐‐ | 3 | |
4. Discussion
HAdVs are major contributors to pediatric viral gastroenteritis, particularly in the post‐rotavirus vaccine era [11, 23, 24, 38, 39]. In this study, HAdV positivity was 14% (2021–2022) and 20.2% (2023–2024). While these records are higher than pre‐pandemic reports in Iran (2%–9%) [13, 31, 32, 33, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49], the 20‐month gap in our surveillance prevents the characterization of this increase as a continuous linear rebound. Instead, these findings provide two distinct epidemiological snapshots, possibly reflecting shifts in population immunity following the easing of COVID‐19 public health measures. It is important to acknowledge certain limitations in the temporal analysis of our data. A surveillance gap of nearly 20 months exists between the two study periods (February 2022–September 2023). Consequently, the observed increase in HAdV positivity, from 14% in the first period to 20.2% in the second, should be interpreted as a comparison between two distinct epidemiological snapshots rather than a confirmed linear post‐pandemic rebound. The absence of data during this intervening period limits our ability to describe the precise temporal dynamics of HAdV circulation during the full transition to the post‐pandemic era.
Our findings align with global trends where HAdV‐F41 remains the predominant enteric type, followed by various HAdV‐C, HAdV‐B, and HAdV‐D types [3, 9, 11, 50, 51, 52, 53, 54]. The detection of non‐enteric species in stool, constituting 35% of our isolates, underscores their significant, though secondary, role in pediatric diarrhea. Supporting these findings, recent studies from various countries [51, 53, 55, 56] have reported consistent patterns in the distribution and genotypes of both enteric and non‐enteric HAdV infections among the child population. Given the ubiquitous nature and extensive diversity of HAdV strains, comprising over 100 types known to infect humans and elicit a broad spectrum of clinical manifestations, the frequent detection of non‐enteric types is to be expected.
The predominance of HAdV‐F41 over HAdV‐F40, evidenced by the detection of only a single HAdV‐F40 case, is consistent with findings from several previous studies. Moreover, the suspected association of HAdV‐F41 with outbreaks of severe acute hepatitis of unknown etiology (SAHUA) in children between 2021 and 2022 [57], underscores the importance of genetic analysis to elucidate the genetic and lineage patterns of circulating HAdV‐F41 strains. Based on the partial sequencing of hexon HVRs and the long fiber gene, the Iranian HAdV‐F41 strains were identified as hexon‐GTC1 and fiber‐GTC2. This observation is consistent with our previous findings in the region [13] and aligns with reported patterns from various geographic settings [58, 59, 60], suggesting the stable circulation of these genotypic signatures. In terms of lineage classification, our isolates were assigned to hexon‐lineage 1 and fiber‐lineage 2. It is worth noting that while the fiber‐based lineage assignment showed a bootstrap support of 66%, the consistency of this finding with the hexon‐based L1 assignment and previous domestic data reinforces the reliability of our classification. The association of these specific hexon (L1) and fiber (L2) patterns provides a molecular signature that suggests these strains belong to sub‐lineage 2b (lineage 2, comprising sub‐lineages 2a and 2b). In the current classification framework, sub‐lineage 2b is characterized by this specific discordance between hexon and fiber phylogenies [27, 30]. This sub‐lineage, often associated with subtype G3, has been the dominant variant globally for over two decades and was recently linked to outbreaks of severe acute hepatitis of unknown etiology (SAHUA) [25, 57, 61]. However, these classifications must be interpreted with caution. While our dual‐gene analysis strongly suggests affinity with lineage 2b and subtype G3, these assignments cannot be considered definitive due to the absence of penton base and short fiber sequences. HAdV evolution is frequently driven by intertypic recombination; therefore, a full‐capsid or whole‐genome sequencing (WGS) approach would be required to confirm the genomic integrity and exact subtype of these strains.
Despite the insights provided, this study has several methodological limitations that should be acknowledged. First, our genetic characterization was limited to partial sequences of the hexon (HVRs) and fiber genes. While these targets are highly informative for lineage and GTC assignment, the absence of penton base gene sequencing represents a constraint in achieving a full‐capsid characterization. Since HAdV evolution is frequently driven by intertypic recombination involving all three major capsid proteins, the lack of penton base data means that potential recombination events in that region could not be identified, which may slightly limit the resolution of our subtype assignment. Furthermore, while the dual‐gene approach used here is consistent with many global surveillance studies, it does not provide the same level of granular detail as WGS. These limitations imply that while our classification of Iranian strains into lineage 2b and subtype G3 is robust based on available markers, future studies employing WGS and complete capsid analysis are needed to fully elucidate the complex evolutionary landscape and recombination history of HAdV‐F41 in the region.
Overall, our findings provide updated insights into the molecular epidemiology of HAdVs in Iran, highlighting the predominance of HAdV‐F41 strains with genetic signatures suggestive of sub‐lineage 2b and subtype G3. Although the partial genomic data and the surveillance gap necessitate a cautious interpretation of these trends, the observed persistence of these lineages underscores their evolutionary fitness in the post‐pandemic landscape. Continued molecular surveillance, augmented by WGS, is imperative to monitor emerging variants and to better define the public health implications of HAdV‐F41 circulation among pediatric populations.
Author Contributions
Ramin Ghadimpour: investigation. Atefeh Kachooei: investigation. Somayeh Jalilvand: funding acquisition, supervision. Ali Maleki: investigation, visualization. Somayeh‐Sadat Hosseini‐Fakhr: investigation. Mahtab Mir‐Hosseinian: formal analysis, writing – original draft. Farzane Behnezhad: formal analysis. Arash Arashkia: methodology, writing – original draft, writing – review and editing. Zabihollah Shoja: conceptualization, methodology, formal analysis, writing – original draft, writing – review and editing, supervision.
Disclosure
The corresponding author (Zabihollah Shoja) affirms that this manuscript is an honest, accurate, and transparent account of the study being reported; that no important aspects of the study have been omitted; and that any discrepancies from the study as planned (and, if relevant, registered) have been explained.
Conflicts of Interest
The authors declare no conflicts of interest.
Supporting information
Supporting File
Acknowledgments
The present study has been funded and supported by the Tehran University of Medical Sciences (grant no. 73693 and grant no. 90612). It has also been in partial fulfillment of a M.Sc. thesis in medical virology supported by the Tehran University of Medical Sciences, Tehran, Iran.
Ghadimpour R., Kachooei A., Jalilvand S., et al., “Molecular Epidemiology of Human Adenovirus Strains in Children With Acute Gastroenteritis in Tehran, Iran (2021–2022 and 2023–2024): Genetic Characterization of Adenovirus F41,” Health Science Reports 9 (2026): e72795. 10.1002/hsr2.72795.
Ramin Ghadimpour and Atefeh Kachooei contributed equally to this work.
Contributor Information
Somayeh Jalilvand, Email: sjalilvand@tums.ac.ir.
Zabihollah Shoja, Email: z_shoja@pasteur.ac.ir, Email: zshoja@alumnus.tums.ac.ir, Email: zabihollahshoja@gmail.com.
Data Availability Statement
The hexon and fiber nucleotide sequences of HAdV‐F41 strains were deposited in the GenBank database under accession numbers PV745400–PV745430.
References
- 1. Rowe W. P., Huebner R. J., Gilmore L. K., Parrott R. H., and Ward T. G., “Isolation of a Cytopathogenic Agent From Human Adenoids Undergoing Spontaneous Degeneration in Tissue Culture,” Experimental Biology and Medicine 84, no. 3 (1953): 570–573. [DOI] [PubMed] [Google Scholar]
- 2. Berk A. J., “Adenoviridae.” Fields Virology (Lippincott Williams & Wilkins, 2013), 1704–1731. [Google Scholar]
- 3. Matsushima Y., Shimizu H., Kano A., et al., “Genome Sequence of a Novel Virus of the Species Human Adenovirus D Associated With Acute Gastroenteritis,” Genome Announcements 1, no. 1 (2013): e00068‐12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Ismail A. M., Lee J. S., Lee J. Y., et al., “Adenoviromics: Mining the Human Adenovirus Species D Genome,” Frontiers in Microbiology 9, no. 11 (2018): 14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Seto D., Chodosh J., Brister J. R., and Jones M. S., “Using the Whole‐Genome Sequence to Characterize and Name Human Adenoviruses,” Journal of Virology 85, no. 11 (2011): 5701–5702. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Lion T., “Adenovirus Infections in Immunocompetent and Immunocompromised Patients,” Clinical Microbiology Reviews 27, no. 3 (2014): 441–462. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Robinson C. M., Seto D., Jones M. S., Dyer D. W., and Chodosh J., “Molecular Evolution of Human Species D Adenoviruses,” Infection, Genetics and Evolution 11, no. 6 (2011): 1208–1217. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. J. P. Lynch, III and Kajon A. E., “Adenovirus: Epidemiology, Global Spread of Novel Serotypes, and Advances in Treatment and Prevention.” Seminars in Respiratory and Critical Care Medicine (Thieme Medical Publishers, 2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Li L., Phan T. G., Nguyen T. A., et al., “Molecular Epidemiology of Adenovirus Infection Among Pediatric Population With Diarrhea in Asia,” Microbiology and Immunology 49, no. 2 (2005): 121–128. [DOI] [PubMed] [Google Scholar]
- 10. Portes S. A. R., Volotão E. M., Rocha M. S., et al., “A Non‐Enteric Adenovirus A12 Gastroenteritis Outbreak in Rio de Janeiro, Brazil,” Memórias do Instituto Oswaldo Cruz 111, no. 6 (2016): 403–406. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Dey S. K., Shimizu H., Phan T. G., et al., “Molecular Epidemiology of Adenovirus Infection Among Infants and Children With Acute Gastroenteritis in Dhaka City, Bangladesh,” Infection, Genetics and Evolution 9, no. 4 (2009): 518–522. [DOI] [PubMed] [Google Scholar]
- 12. Jones M. S., Harrach B., Ganac R. D., et al., “New Adenovirus Species Found in a Patient Presenting With Gastroenteritis,” Journal of Virology 81, no. 11 (2007): 5978–5984. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Arashkia A., Bahrami F., Farsi M., et al., “Molecular Analysis of Human Adenoviruses in Hospitalized Children < 5 Years Old With Acute Gastroenteritis in Tehran, Iran,” Journal of Medical Virology 91 (2019): 1930–1936. [DOI] [PubMed] [Google Scholar]
- 14. Banyai K., Martella V., Meleg E., et al., “Searching for HAdV‐52, the Putative Gastroenteritis‐Associated Human Adenovirus Serotype in Southern Hungary,” New Microbiologica 32, no. 2 (2009): 185–188. [PubMed] [Google Scholar]
- 15. Shieh W.‐J., “Human Adenovirus Infections in Pediatric Population‐An Update on Clinico–Pathologic Correlation,” Biomedical Journal 45, no. 1 (2022): 38–49. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Akihara S., Phan T. G., Nguyen T. A., Hansman G., Okitsu S., and Ushijima H., “Existence of Multiple Outbreaks of Viral Gastroenteritis Among Infants in a Day Care Center in Japan,” Archives of Virology 150, no. 10 (2005): 2061–2075. [DOI] [PubMed] [Google Scholar]
- 17. Shimizu H., Phan T. G., Nishimura S., Okitsu S., Maneekarn N., and Ushijima H., “An Outbreak of Adenovirus Serotype 41 Infection in Infants and Children With Acute Gastroenteritis in Maizuru City, Japan,” Infection, Genetics and Evolution 7, no. 2 (2007): 279–284. [DOI] [PubMed] [Google Scholar]
- 18. Van R., Wun C. C., O'Ryan M. L., Matson D. O., Jackson L., and Pickering L. K., “Outbreaks of Human Enteric Adenovirus Types 40 and 41 in Houston Day Care Centers,” Journal of Pediatrics 120, no. 4 Pt 1 (1992): 516–521. [DOI] [PubMed] [Google Scholar]
- 19. Lee B., Damon C. F., and Platts‐Mills J. A., “Pediatric Acute Gastroenteritis Associated With Adenovirus 40/41 in Low‐Income and Middle‐Income Countries,” Current Opinion in Infectious Diseases 33, no. 5 (2020): 398–403. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Dhingra A., Hage E., Ganzenmueller T., et al., “Molecular Evolution of Human Adenovirus (HAdV) Species C,” Scientific Reports 9, no. 1 (2019): 1039. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Ismail A. M., Cui T., Dammaraju K., et al., “Genomic Analysis of a Large Set of Currently—And Historically—Important Human Adenovirus Pathogens,” Emerging Microbes & Infections 7, no. 1 (2018): 1–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Niu P., Sun Z., Zhang Y., et al., “Genomic Epidemiological Characteristics of Enteric Adenovirus F40 and F41 in Yantai, China, From 2022 to 2023,” Viruses 17, no. 12 (2025): 1595. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Verma H., Chitambar S. D., and Varanasi G., “Identification and Characterization of Enteric Adenoviruses in Infants and Children Hospitalized for Acute Gastroenteritis,” Journal of Medical Virology 81, no. 1 (2009): 60–64. [DOI] [PubMed] [Google Scholar]
- 24. Dey R. S., Ghosh S., Chawla‐Sarkar M., et al., “Circulation of a Novel Pattern of Infections by Enteric Adenovirus Serotype 41 Among Children Below 5 Years of Age in Kolkata, India,” Journal of Clinical Microbiology 49, no. 2 (2011): 500–505. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Gutierrez Sanchez L. H., Shiau H., Baker J. M., et al., “A Case Series of Children With Acute Hepatitis and Human Adenovirus Infection,” New England Journal of Medicine 387, no. 7 (2022): 620–630. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Martin N. A., Gonzalez G., Reynolds L. J., et al., “Adeno‐Associated Virus 2 and Human Adenovirus F41 in Wastewater During Outbreak of Severe Acute Hepatitis in Children, Ireland,” Emerging Infectious Diseases 29, no. 4 (2023): 751–760. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Götting J., Cordes A. K., Steinbrück L., and Heim A., “Molecular Phylogeny of Human Adenovirus Type 41 Lineages,” Virus Evolution 8, no. 2 (2022): veac098. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Lazarakou A., Mughini‐Gras L., and Pijnacker R., “Global Impact of COVID‐19 Pandemic on Gastrointestinal Infections: A Scoping Review,” Foodborne Pathogens and Disease 22, no. 10 (2025): 669–683. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Zhou J. and Sun Y., “Effect of COVID‐19 Protective Measures on the Epidemiology Characteristics of Rotavirus, Adenovirus, and Coinfections Among Pediatric Patients With Acute Gastroenteritis in Hangzhou, China,” Microbiology Spectrum 12, no. 3 (2024): e0400723. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Bai R., Chen Y., Ou J., et al., “Clinical Characteristics and Phylogenetic Analysis of Human Enteric Adenovirus Type 41 (HAdV‐F41) From Children With Gastroenteritis During SARS‐CoV‐2 Pandemic,” Infection, Genetics and Evolution 123 (2024): 105619. [DOI] [PubMed] [Google Scholar]
- 31. Saderi H., Roustai M. H., Sabahi F., Sadeghizadeh M., Owlia P., and De Jong J. C., “Incidence of Enteric Adenovirus Gastroenteritis in Iranian Children,” Journal of Clinical Virology 24, no. 1–2 (2002): 1–5. [DOI] [PubMed] [Google Scholar]
- 32. Samarbaf‐Zadeh A., Pirmoradi R., Shamsizadeh A., and Makvandi M., “Prevalence of Adenoviruses 40 and 41 in Children Less Than Five Years Suffering From Acute Gastroenteritis Hospitalized in Ahvaz Abuzar Hospital,” Jundishapur Journal of Microbiology 3, no. 2 (2010): 48–52. [Google Scholar]
- 33. Rezaei M., Sohrabi A., Edalat R., et al., “Molecular Epidemiology of Acute Gastroenteritis Caused by Subgenus F (40, 41) Enteric Adenoviruses in Inpatient Children,” Laboratory Medicine 43, no. 1 (2012): 10–15. [Google Scholar]
- 34. Allard A., Girones R., Juto P., and Wadell G., “Polymerase Chain Reaction for Detection of Adenoviruses in Stool Samples,” Journal of Clinical Microbiology 28, no. 12 (1990): 2659–2667. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Li L., Shimizu H., Doan L. T. P., et al., “Characterizations of Adenovirus Type 41 Isolates From Children With Acute Gastroenteritis in Japan, Vietnam, and Korea,” Journal of Clinical Microbiology 42, no. 9 (2004): 4032–4039. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Xu W., McDonough M. C., and Erdman D. D., “Species‐Specific Identification of Human Adenoviruses by a Multiplex PCR Assay,” Journal of Clinical Microbiology 38, no. 11 (2000): 4114–4120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Tamura K., Stecher G., and Kumar S., “MEGA11: Molecular Evolutionary Genetics Analysis Version 11,” Molecular Biology and Evolution 38, no. 7 (2021): 3022–3027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Lennon G., Cashman O., Lane K., Cryan B., and O'Shea H., “Prevalence and Characterization of Enteric Adenoviruses in the South of Ireland,” Journal of Medical Virology 79, no. 10 (2007): 1518–1526. [DOI] [PubMed] [Google Scholar]
- 39. Blanco R., Alcalá A. C., Fernández R., et al., “Molecular Characterization of Human Adenovirus Causing Infantile Acute Gastroenteritis in Venezuela Before and After Rotavirus Vaccine Implementation,” Diagnostic Microbiology and Infectious Disease 107, no. 3 (2023): 116056. [DOI] [PubMed] [Google Scholar]
- 40. Shams S., Tafaroji J., Aghaali M., et al., “Prevalence of Enteric Adenovirus and Co‐Infection With Rotavirus in Children Under 15 Years of Age With Gastroenteritis in Qom, Iran,” Gastroenterology and Hepatology From Bed to Bench 15, no. 3 (2022): 256. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Kadhim Jwaziri A., Karbalaie Niya M. H., Khales P., et al., “Molecular Prevalence and Genotype Distribution of Human Adenovirus in Iranian Children With Gastroenteritis,” Fetal and Pediatric Pathology 42, no. 6 (2023): 901–913. [DOI] [PubMed] [Google Scholar]
- 42. Modarres S., Jam‐Afzon F., and Modarres S., “Enteric Adenovirus Infection in Infants and Young Children With Acute Gastroenteritis in Tehran,” Acta Medica Iranica 44, no. 5 (2006): 5. [Google Scholar]
- 43. Nakhaei Sistani R., Sadeghizadeh M., Saderi H., Kharazani‐Tafreshi N., Behmanesh M., and Shirzad H., “Detection of Types 40 and 41 Adenoviruses in Stool Samples of Diarrheal Children by Solid Phase PCR,” Iranian Journal of Biotechnology 5, no. 1 (2007): 42–47. [Google Scholar]
- 44. Hamkar R., Yahyapour Y., Noroozi M., et al., “Prevalence of Rotavirus, Adenovirus, and Astrovirus Infections Among Patients With Acute Gastroenteritis in, Northern Iran,” Iranian Journal of Public Health 39, no. 2 (2010): 45. [PMC free article] [PubMed] [Google Scholar]
- 45. Sanaei Dashti A., Ghahremani P., Hashempoor T., and Karimi A., “Molecular Epidemiology of Enteric Adenovirus Gastroenteritis in Under‐Five‐Year‐Old Children in Iran,” Gastroenterology Research and Practice 2016 (2016): 1–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Ziaei Kajbaf T., Shamsizadeh A., Kalvandi G., and Macvandi M., “Relative Frequency of Rotavirus and Adenovirus Among Children Aged 1–60 Months Hospitalized With Acute Diarrhoea in South‐Western, Iran,” Jundishapur Journal of Microbiology 6, no. 1 (2012): 47–50. [Google Scholar]
- 47. Hamedi A., Sadeghian A., and Syedi J., Incidence of Adenovirus Diarrhea in Children Under 6 Years Referred to the Pediatric Emergency and Clinic of Ghaem Hospital, Mashhad, Iran. 2010. [PubMed]
- 48. Motamedifar M., Amini E., and Talezadeh Shirazi P., “Frequency of Rotavirus and Adenovirus Gastroenteritis Among Children in Shiraz, Iran,” Iranian Red Crescent Medical Journal 15, no. 8 (2013): 729–733. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Najafi A., Najafi S., Vahdat K., Kargar M., and Javdani N., “Importance of Viral Pathogens in Children With Acute Gastroenteritis in the South of Iran,” Annals of Saudi Medicine 33, no. 2 (2013): 124–129. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50. Bouazizi A., Ben Hadj Fredj M., Bennour H., et al., “Molecular Analysis of Adenovirus Strains Responsible for Gastroenteritis in Children, Under Five, in Tunisia,” Heliyon 10, no. 1 (2024): e22969. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. De Francesco M. A., Lorenzin G., Meini A., Schumacher R. F., and Caruso A., “Nonenteric Adenoviruses Associated With Gastroenteritis in Hospitalized Children,” Microbiology Spectrum 9, no. 1 (2021): e00300‐21, 10.1128/spectrum.00300-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52. Afrad M. H., Avzun T., Haque J., et al., “Detection of Enteric‐And Non‐Enteric Adenoviruses in Gastroenteritis Patients, Bangladesh, 2012–2015,” Journal of Medical Virology 90, no. 4 (2018): 677–684. [DOI] [PubMed] [Google Scholar]
- 53. Kumthip K., Khamrin P., Ushijima H., and Maneekarn N., “Enteric and Non‐Enteric Adenoviruses Associated With Acute Gastroenteritis in Pediatric Patients in Thailand, 2011 to 2017,” PLoS One 14, no. 8 (2019): e0220263. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54. La Rosa G., Della Libera S., Petricca S., et al., “Genetic Diversity of Human Adenovirus in Children With Acute Gastroenteritis, Albania, 2013–2015,” BioMed Research International 2015, no. 1 (2015): 1–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55. Joshi M. S., Sukirti V., Chavan N. A., et al., “Enteric and Non‐Enteric Adenoviruses in Children With Acute Gastroenteritis in Western India,” Infection, Genetics and Evolution 112 (2023): 105454. [DOI] [PubMed] [Google Scholar]
- 56. Yodmeeklin A., Kumthip K., Ukarapol N., Ushijima H., Maneekarn N., and Khamrin P., “Diverse Genotypes of Human Enteric and Non‐Enteric Adenoviruses Circulating in Children Hospitalized With Acute Gastroenteritis in Thailand, From 2018 to 2021,” Microbiology Spectrum 11, no. 5 (2023): e01173‐23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57. Marsh K., Tayler R., Pollock L., et al., “Investigation Into Cases of Hepatitis of Unknown Aetiology Among Young Children, Scotland, 1 January 2022 to 12 April 2022,” Eurosurveillance 27, no. 15 (2022): 2200318. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58. Fukuda S., Kuwayama M., Takao S., Shimazu Y., and Miyazaki K., “Molecular Epidemiology of Subgenus F Adenoviruses Associated With Pediatric Gastroenteritis During Eight Years in Hiroshima Prefecture as a Limited Area,” Archives of Virology 151, no. 12 (2006): 2511–2517. [DOI] [PubMed] [Google Scholar]
- 59. Banerjee A., De P., Manna B., and Chawla‐Sarkar M., “Molecular Characterization of Enteric Adenovirus Genotypes 40 and 41 Identified in Children With Acute Gastroenteritis in Kolkata, India During 2013–2014,” Journal of Medical Virology 89, no. 4 (2017): 606–614. [DOI] [PubMed] [Google Scholar]
- 60. Nascimento L. G., Sarmento S. K., Röpke Junior R., and Fumian T. M., “Evaluation of qPCR for the Selective Detection of Enteric Adenovirus Followed by Sequence‐Based Genetic Characterization of F Strains Circulating in Brazil,” Applied Microbiology 4, no. 3 (2024): 1016–1029. [Google Scholar]
- 61. Kelgeri C., Couper M., Gupte G. L., et al., “Clinical Spectrum of Children With Acute Hepatitis of Unknown Cause,” New England Journal of Medicine 387, no. 7 (2022): 611–619. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supporting File
Data Availability Statement
The hexon and fiber nucleotide sequences of HAdV‐F41 strains were deposited in the GenBank database under accession numbers PV745400–PV745430.