Skip to main content
Environmental Health Perspectives logoLink to Environmental Health Perspectives
. 2026 Apr 16;134(3):274–288. doi: 10.1021/EHP.6c00042

Mobilization of the Environmental Toxicant Chlorpyrifos during Weight Loss and Its Impact on Liver and Adipose Tissue Metabolism in Mice

Yifan Xiang †, Gaojian Tang †, Xiaohu Hu †,‡, Xiaoxiao Yu †,§, Yanrong Feng †, Zhongzuo Huang †, Yicheng Luo †, Zongyou Jiang †, Yue Lv †,‡, Xiaoying Sun †, Yan Zhang †, Long Cheng †, Yu Xin †, Yuxin Qian †, Boyu Li †, Bo Wang †,*
PMCID: PMC13347641  PMID: 42428254

Abstract

BACKGROUND: Fat-soluble toxicants, such as chlorpyrifos (CPF) can accumulate in adipose tissue and the liver. During weight loss, these compounds may be released into the circulation, but the metabolic consequences of this mobilization remain poorly understood. OBJECTIVES: This study aimed to investigate the mobilization of CPF during weight loss and its effects on liver health and adipose tissue metabolism in mice. METHODS: C57BL/6J mice were fed a high-fat diet (HFD) or a low-fat diet (LFD) and exposed to 2 mg/kg BW/day CPF by oral gavage. Weight loss was induced by β3-adrenergic stimulation (CL316243) or treadmill exercise for 4 or 10 weeks. CPF was quantified in serum and tissues using HPLC. Tissue histology, expression of genes related to CPF metabolism, liver injury markers, and metabolic protein levels were assessed. RESULTS: CPF-exposed LFD mice showed more severe liver fibrosis and adipose inflammation than did their HFD counterparts. While obese mice had lower adipose CPF concentrations, they showed higher hepatic accumulation. CPF-exposed weight loss mice had higher levels of CPF in adipose tissue, liver, and brain and higher expression of CPF metabolism-related genes, including Paraoxinase-1 and cytochrome P450 genes, and greater glucose intolerance compared to their counterparts without CPF administration. Molecular analyses revealed suppressed AMPK signaling and P62 accumulation, indicating mitophagy disruption in CPF-exposed mice after weight loss. These effects occurred even at human-relevant low doses (0.45 mg/kg of BW/day) and persisted across sexes. DISCUSSION: Weight loss mobilizes CPF and its metabolites from fat stores, leading to tissue accumulation and damage. Even low-dose exposure contributes to hepatic and metabolic disruption in mice, highlighting the potential risk of toxicant mobilization during fat reduction.

1. Introduction

Since the Industrial Revolution, humans have produced a vast quantity of chemicals. While these synthetic chemicals have significantly improved our quality of life, they have also severely polluted our environment. Humans are inevitably exposed to persistent organic pollutants (POPs), which are widely distributed and resistant to biodegradation. These environmental chemicals accumulate in humans through the food chain, becoming part of our bodies and causing acute or chronic tissue damage in fat tissue, muscle, liver, and more. Many chemicals termed endocrine-disrupting chemicals (EDCs) disturb the body’s endocrine system and are strongly associated with insulin resistance, glucose disorders, obesity, , and other metabolic dysfunctions. ,−

The concentration of environmental chemicals in the body varies with the metabolic state. , Adipose tissue is the primary site where lipophilic chemicals such as organophosphate and organochlorine pesticides accumulate. The lipids in adipocytes serve as solvents for these lipophilic chemicals. It was suggested that weight gain is associated with lower levels of environmental pollutants in the plasma due to the dilution effect of increased fat mass. Conversely, during weight loss, the chemicals trapped in fat tissue are released into other tissues. , Clinically, weight loss is associated with increases in serum PCBs, organochlorine pesticides (OCPs), and polybrominated diphenyl ethers. In pregnant women, early gestational weight loss correlates with the highest circulating POP levels.

Nowadays, weight fluctuations in human beings are common. About half of the US adults reported intentional weight loss in 2016. Repeated cycles of weight loss and regain are frequent. While many studies have revealed a dynamic change in serum chemical levels during body weight change, the health impact of this change remains unclear. Chlorpyrifos (CPF), one of the most widely used organophosphate insecticides worldwide, is applied in field crops and fruit production, leading to persistent presence in soil, water, and food chains. Due to its lipophilic nature, CPF bioaccumulates in adipose tissue of organisms, posing long-term ecological and human health risks. Human exposure occurs primarily through dietary intake, and its resistance to biodegradation further prolongs its environmental persistence. CPF has been linked to endocrine disruption, neurotoxicity, and metabolic disorders, underscoring its role as a pervasive environmental toxicant. In animal models, we previously reported that low-dose CPF exposure impaired brown adipose tissue (BAT) mitochondria function, suppressed diet-induced thermogenesis (DIT), and caused metabolic dysfunctions including obesity, insulin resistance, and nonalcoholic fatty liver diseases (NAFLD). Given these findings, CPF serves as an ideal model to investigate how weight fluctuations influence the CPF distribution and its impact on tissue health. This study aims to address two key questions: 1. Does increased fat deposition protect nonlipophilic tissues by diluting exogenous chemicals like CPF? 2. Does fat loss during weight loss lead to the release of fat-stored CPF, exacerbating tissue damage and disturbing energy homeostasis?

2. Methods

2.1. Animal

All mice used in this study were 7 week old C57BL/6J males or females (SPF Biotechnology Co., Ltd., Beijing, China). Each treatment group consisted of 6 mice (n = 6), except for the experiment in Figure (n = 10), totaling 148 mice. Mice were housed in pathogen-free cages under a 12 h light–dark cycle (7 a.m. to 7 p.m. light), with temperature maintained at 22 °C and humidity at 40–60%. Food and water were provided ad libitum. Mice were fed either a low-fat diet (LFD, 10 kcal % fat, D12450J, Research diet, New Brunswick, USA) or a high-fat diet (HFD, 60 kcal% fat, D12492, Research diet, New Brunswick, USA). CPF (C109843, Aladdin, Shanghai, China) was administered via gavage or dietary supplementation at 0.45 or 2 mg/kg of body weight (BW). The doses of CPF were not detrimental to mouse health with no observed abnormalities in physiological activity. CPF was dissolved in anhydrous ethanol (E111977, Aladdin, Shanghai, China) to prepare a 40 mg/mL stock solution (stored at 4 °C). Before being gavaged, the working solution was diluted to 0.1 mg/mL with ultrapure water. The non-CPF exposed mice were gavaged with equal volumes of ultrapure water. Mouse body weights were recorded weekly. All procedures were approved by the Animal Care and Use Committee of the China Agricultural University (Approval No. AW13504202-1-1).

1.

1

Liver and adipose tissue health in response to CPF exposure (2 mg/kg BW) under LFD and HFD feeding. C57BL/6J male mice were subjected to either an HFD (60%) or LFD, each supplemented with 20 mg/kg diet CPF (equal to 2 mg/kg BW CPF), for a period of 14 weeks. (A) Representative images of Oil red O-stained liver sections (scale bar = 100 μm). (B) Liver triacylglycerol (TG) content. The underlying data are available in Table S1. (C) Representative images of H&E-stained liver sections (scale bar = 100 μm). (D) Representative images of picrosirius red-stained liver sections (scale bar = 200 μm). (E) Representative images of H&E-stained inguinal white adipose tissue (iWAT) sections (scale bar = 200 μm). Data presented are mean ± SEM, n = 10. Variances were analyzed by one-way ANOVA, and pairwise comparisons were performed using Fisher’s LSD procedure. * p < 0.05. CPF: chlorpyrifos. HFD: high-fat diet. LFD: Low-fat diet. BW: body weight. iWAT: inguinal white adipose tissue. H&E: hematoxylin–eosin.

2.2. Weight Loss Program

CPF exposure was ceased in all mice during the weight loss program. For treadmill exercise, mice ran on a 5° inclined treadmill (SA101, Sansbio, Nanjing, China) for 10 m/min. Each session consisted of 15 min of running followed by 15 min of rest, repeated four times daily (2–4 p.m.). Food and water were withheld during the exercise. The treadmill (6 lanes separated by plastic boards) accommodated all mice in a group simultaneously and was cleaned daily with antiseptic wipes postexercise. For chemically induced weight loss, mice received daily intraperitoneal injections of 1 mg/kg CL316243 (C5976, Sigma, St. Louis, USA) dissolved in 0.9% sterile saline (ST341, Beyotime, Shanghai, China). The CL316243 injection solution (0.2 mg/mL) was stored at 4 °C before use. After the weight loss program, all mice recovered overnight before sacrificing or the glucose tolerance test.

2.3. Tissue Collection and Processing

Mice were fasted for 6 h and then anesthetized with CO2 and euthanized by cervical dislocation. Serum, interscapular brown adipose tissue (BAT), inguinal white adipose tissue (iWAT), gonadal white adipose tissue (gWAT), brain, and liver samples were collected. Tissues for histology (BAT, iWAT, gWAT, and liver) were fixed in 4% paraformaldehyde (PFA, 80096618, Sinopharm Chemical Reagent, Shanghai, China) at 4 °C for 24 h, paraffin (39601095, Leica, Illinois, USA) embedded, and then sectioned at 5 μm thickness using a Leica microtome (RM2125 RTS, Leica, Illinois, USA). For each sample, 5 sections at 50 μm intervals were used for staining and imaging. The remaining tissue samples were snap-frozen in liquid nitrogen and then stored in a −80 °C freezer before analysis.

2.4. Hematoxylin–Eosin (H&E) Staining

Tissue sections of BAT, iWAT, gWAT, and liver were deparaffinized in xylene (X112051, Aladdin, Shanghai, China) for 30 min and rehydrated through a gradient ethanol series (100%, 95%, 85%, and 75%; 5 min each). Sections were rinsed in ultrapure water and stained with hematoxylin (H104304, Aladdin, Shanghai, China) for 0.5 min. Then, they were rinsed in tap water for 5 min and stained with 0.5% Eosin Y solution (0109, Biotopped, Beijing, China) for 1 min. After quick dehydration by gradient ethanol (75%, 85%, 95%, and 100%), the sections were rinsed in xylene for 5 min and mounted with a resinous medium (220606, Lisheng Shiyanqicai, Jinhua, China). Stained slides were examined under a microscope (EVOS XL Core, Invitrogen, Bothell, USA).

2.5. Oil Red O Staining

Liver tissues were fixed in 4% PFA solution at 4 °C for 24 h and then infiltrated with 30% sucrose (P0149D, Beyotime, Shanghai, China) for 24 h, followed by embedding in optimal cutting temperature compound (OCT, 4583, Sakura, Torrance, USA) and frozen in isopentane precooled in liquid nitrogen. Liver samples were sectioned at 10 μ thickness using a cryomicrotome (Cryotome FE, Thermo Fisher, Waltham, USA). Cryosections were rinsed with phosphate-buffered saline (PBS), stained with oil red O (0684-100G, Amresco, Solon, USA) for 10 min, washed three times with 60% isopropanol (1292350, Aladdin, Shanghai, China), and mounted with aqueous mounting medium (C0187, Beyotime, Shanghai, China). Stained sections were imaged under a microscope (EVOS XL Core, Invitrogen, Bothell, USA).

2.6. Picrosirius Red Staining

Liver sections were deparaffinized and hydrated to water (Same protocol as for H&E staining) and then stained with Picrosirius red (202110628, G-Clone, Beijing, China) for 1 h. The sections were subsequently washed twice in a 0.5% acetic acid solution (A433233, Aladdin, Shanghai, China) for 10 s each. Finally, the sections were dehydrated, mounted in a resinous medium (220606, Lisheng Shiyanqicai, Jinhua, China), and imaged under a microscope (EVOS XL Core, Invitrogen, Bothell, USA).

2.7. Masson Staining

Liver sections were deparaffinized and hydrated to water (Same protocol as for H&E staining). Sections were stained with Weigert’s iron hematoxylin (HT1079, Sigma, St. Louis, USA) for 10 min, rinsed in distilled water, and then stained with Biebrich scarlet-acid fuchsin solution (HT151, Sigma, St. Louis, USA) for 12 min. After differentiation in phosphomolybdic-phosphotungstic acid (SY009477 and SY010111, Accela, Shanghai, China) for 5 min, sections were stained with aniline blue (198161, Sigma, St. Louis, USA) for 5 min, followed by brief differentiation in 1% acetic acid for 2 min. Slides were dehydrated through gradient ethanol, cleared in xylene, and mounted with resinous medium (Same as H&E staining). Stained sections were imaged under a microscope (EVOS XL Core, Invitrogen, Bothell, USA).

2.8. Triacylglycerol (TG) Analysis

For liver TG content analysis, about 2 g of frozen liver tissue was first ground to a powder in liquid nitrogen. Then, 50 mg of liver tissue powder was added to 1 mL of a chloroform:methanol mixture (2:1; chloroform 10006818, Sinopharm Chemical Reagent, Shanghai, China; methanol 1230, Tgreag, Beijing, China) and mixed thoroughly overnight. The next day, samples were centrifuged at 1000g for 10 min at 4 °C using a high-speed centrifuge (3-18R, Hengnuo, Changsha, China). Then, 0.2 mL of a 0.9% sodium chloride solution was added to each sample. After mixing, samples were centrifuged at 3000g for 10 min at 4 °C. The lower organic phase was collected and dried with a nitrogen blower (HGC, Ruiz, Beijing, China). The remaining TG was dissolved in 0.2 mL of 100% isopropyl alcohol (1292350, Aladdin, Shanghai, China) for detection. TG concentration was analyzed using a TG colorimetric kit (A110–1–1, Nanjing Jiancheng Institute of Bioengineering, Nanjing, China). The absorbance values at 500 nm were determined using a microplate absorbance spectrophotometer (iMark, Bio-Rad, Hercules, USA). TG content was calculated from a standard curve drawn based on absorbance values of standard samples at gradient concentrations.

2.9. Aspartate Aminotransferase (AST) and Alanine Aminotransferase (ALT) Analysis

Serum AST/ALT was analyzed using an AST/ALT Assay Kit (AST, C010-2-1; ALT, C009-1-1; Nanjing Jiancheng Institute of Bioengineering, Nanjing, China). The absorbance value at 510/505 nm was determined using a microplate absorbance spectrophotometer (iMark, Bio-Rad, Hercules, USA). The AST/ALT content was calculated from a standard curve based on the absorbance values of standard samples at gradient concentrations.

2.10. Glucose Tolerance Test (GTT)

d-(+)-Glucose (G6512, Sigma, St. Louis, USA) was dissolved in 0.9% sterile saline (ST341, Beyotime, Shanghai, China) to prepare a 200 mg/mL glucose injection solution immediately before injection. Following an overnight recovery after the 10 week weight loss program, mice were fasted for 6 h and then injected intraperitoneally with 2 g/kg BW glucose. Blood drops were collected from the tail vein of mice for blood glucose concentration analysis using a portable glucometer (580, Yuwell, Danyang, China) at 0, 20, 40, 60, 90, and 120 min after injection. At GTT, all mice recovered for 3 days before sacrificing.

2.11. RNA Isolation and Quantitative Real-Time PCR (qRT-PCR)

Total RNA was extracted from BAT, iWAT, gWAT, liver, and brain using a TRIzol reagent (R0016, Beyotime, Shanghai, China). RNA concentration and quality were analyzed by using UV spectrophotometry (NanoDrop, Thermo Fisher, Waltham, USA). For reverse transcription, 1 μg of total RNA was converted into cDNA using an iScriptTM cDNA synthesis kit (1708890EDU, Bio-Rad, Hercules, USA). qRT-PCR was performed using an SYBR green RT-PCR kit (1725150, Bio-Rad, Hercules, USA) on a CFX RT-PCR detection system (MyiQ2, Bio-Rad, Hercules, CA, USA). Thermal cycling conditions were as follows: 95 °C for 5 min (initial denaturation), 45 cycles of 95 °C for 15 s, 60 °C for 30 s, and 72 °C for 20 s; followed by a melting curve analysis (65 to 95 °C in 0.5 °C increments, 5 s per step). Primer annealing temperatures and amplification efficiencies were validated in beforehand. Relative gene expression was calculated using the 2-ΔΔCt method, normalized to 18s rRNA. Primer sequences are listed in Table .

1. Primers Used for Quantitative RT-PCR (qPCR).

Gene names Gene bank accession no. Primer sequence (5′-3′)
18S NR_003278.3 F: TTGTACACACCGCCCGTCGC
    R: CTTCTCAGCGCTCCGCCAGG
Pon1 NM_011134.3 F: CCAGAACATTTTATCCGAAGACCCC
    R: GTGCCAATCAGCAGTTTCCCT
Ahr NM_001314027.1 F: ATCACCTATGCCAGCCGCAA
    R: CCATTCAGCGCCATCAAAGAA
Cyp1a1 NM_001136059.2 F: TCCTTACAGCCCAAGCAGCC
    R: GGTTCTTCCCCACAGTCAGCA
Cyp1a2 NM_009993.3 F: CGACCAGACCTCTACAGCTTCAC
    R: GGCACCAATGACGTTAGCCAC
Cyp3a11 NM_007818.3 F: GGGAAGCATTGAGGAGGATCACA
    R: GGAGCACCCAGGTTTCCAGT
Cyp2c55 NM_028089.3 F: CCCCAAGGGCACAGAGTTAGT
    R: CTCCCACGCACATTCGCTTT
Cyp2e1 NM_021282.3 F: TCAACCTCGTCCCTTCCAACC
    R: CAACACACACGCGCTTTCCT
IL-1β NM_008361.4 F: ATGCCACCTTTTGACAGTGATG
    R: AAGGTCCACGGGAAAGACAC
IL-6 NM_001314054.1 F: CTCTGGGAAATCGTGGAAATGAG
    R: TCTGAAGGACTCTGGCTTTGT
IL-10 NM_010548.2 F: GCCCAGAAATCAAGGAGCA
    R: GTCCAGCAGACTCAATACACAC
Tgf-β1 NM_011577.2 F: GATACGCCTGAGTGGCTGTC
    R: TTTGGGGCTGATCCCGTTG
Col1a1 NM_007742.4 F: TACCGGGCCGATGATGCTAA
    R: GTCGATCCAGTACTCTCCGCT
Col1a2 NM_007743.3 F: GAGATGGTGCTCGTGGCATT
    R: AGGCCCTTTGGTTCCCTTCT
Timp1 NM_001044384.1 F: AGACACACCAGAGCAGATACC
    R: TGGTCTCGTTGATTTCTGGGG
Mmp2 NM_008610.3 F: GCCCCCATGAAGCCTTGTTT
    R: CGCTGGTGCAGCTCTCATAC

2.12. Western Blotting

Proteins were extracted from iWAT using RIPA buffer (P0013B, Beyotime, Shanghai, China) containing a protease inhibitor cocktail: 0.5 mM PMSF (ST507, Beyotime, Shanghai, China), 100 mM sodium fluoride (HY-B1766, MCE, New Jersey, USA), and 1 mM sodium orthovanadate (S1873, Beyotime, Shanghai, China). Protein concentration was determined by using a BCA kit (P0011, Beyotime, Shanghai, China). Samples (1 μg/μL) were prepared in 4× SDS sample buffer (P0731, Beyotime, Shanghai, China) and boiled at 95 °C for 5 min. Proteins (15 μg/well) were separated on 10% or 12% SDS-PAGE gels (P0056A, Beyotime, Shanghai, China) and transferred to PVDF membranes (IEVH85R, Sigma, St. Louis, MμC, USA) at 100 V for 90 min. Membranes were blocked with 5% BSA (ST023, Beyotime, Shanghai, China) in TBST (ST671, Beyotime, Shanghai, China) for 1 h and then incubated with primary antibody in TBST (with 5% BSA) at 4 °C overnight, followed by incubating with secondary antibody at room temperature for 1 h. Bands were visualized with an ECL kit (P0018FS, Beyotime, Shanghai, China), imaged by a Tanon Imaging System (1600, Tanon, Shanghai, China) and analyzed by using Fiji 2.16.0. Primary antibodies against ACC1 (A19627, 1:1000 dilution), Phospho-ACC1 (AP0298, 1:1000 dilution), HSL (A15686, 1:1000 dilution), Phospho-HSL (Ap0853, 1:1000 dilution), and Phospho-ULK1 (AP0760, 1:1000 dilution) were purchased from ABclonal Inc. (Wuhan, China). Primary antibodies against ULK1 (AF8307, 1:1000 dilution), AMPKα (AF6195, 1:1000 dilution), P62 (AF5312, 1:1000 dilution), Phospho-AMPKα (AF5908, 1:1000 dilution), Phospho-PKA (AF1942, 1:500 dilution), and β-Tubulin (AF1216, 1:1000 dilution) were purchased from Beyotime Biotech Inc. (Shanghai, China). Primary antibodies against β-Actin (bs-0061R, 1:10000 dilution) and GAPDH (bs-10900R, 1:10000 dilution) were purchased from Bioss Inc. (Beijing, China). The secondary antibody was HRP-labeled goat antirabbit lgG (A0208, Beyotime, Shanghai, China, 1:1000 dilution).

2.13. HPLC Analysis

CPF and its metabolites, CPF-oxon, and TCPy in serum, BAT, iWAT, gWAT, liver, and brain samples were analyzed by using high-performance liquid chromatography (HPLC). Approximately 0.25 g of tissue or 200 μL of serum was mixed with 1 mL of acetonitrile (A104440, Aladdin, Shanghai, China) and centrifuged at 7000g for 10 min at 4 °C in a high-speed centrifuge (3-18R, Hengnuo, Changsha, China). The supernatant was mixed with 2.5 mL of a 2.5% sodium sulfate solution (9853, Yongda Chemical, Tianjin, China) and 2.5 mL of dichloromethane (D116146, Aladdin, Shanghai, China) for 15 min. The lower organic phase was collected and purified through an aluminum oxide column (0088430, Thermo Fisher, Waltham, USA) with dichloromethane elution. The collected organic phase was dried with a nitrogen blower (HGC, Ruiz, Beijing, China) and reconstituted in 0.1 mL of acetonitrile. Subsequently, samples were separated through a Shimadzu HPLC system (LC-20A, Shimadzu, Kyoto, Japan) with a reverse phase column (Luna 3 μm C18(2) 100 Å, LC Column 150 mm × 3 mm) (150838, Sigma, St. Louis, USA). The mobile phase consisted of water (pH 3.2, adjusted with acetic acid) and acetonitrile. Gradient elution was employed as follows: 1–75% acetonitrile at 1.0 mL/min from 0 to 6 min; 75–85% acetonitrile at 1.7 mL/min from 6 to 11 min; isocratic elution at 85% acetonitrile and 1.7 mL/min from 11 to 13 min; and 85–1% acetonitrile at 1.0 mL/min from 13 to 15 min. The column temperature was maintained at 25 °C. UV absorption at 290 nm was detected. Retention times were 8.3 min for TCPy, 9.2 min for CPF-oxon, and 12.1 min for CPF. Concentrations were calculated based on absorbance curves of standard samples (CPF, C109843, CPF-oxon, C693740, TCPy, T136458; all from Aladdin, Shanghai, China) at gradient concentrations.

2.14. Statistical Analysis

All data were found to be normally distributed and analyzed by using Prism GraphPad 8.0. Variances between more than two groups were analyzed by one-way ANOVA, and pairwise comparisons were performed using Fisher’s LSD procedure. For data with only two groups, a nonpaired two-tailed Student’s t test was performed. Significance was accepted at P < 0.05. All data are expressed as means ± standard errors of the mean (SEM).

3. Results

3.1. Liver and Adipose Tissue Health in Response to CPF Exposure (2 mg/kg BW) under LFD and HFD Feeding

To explore the impact of CPF on energy metabolism, mice were randomly divided into four groups (LFD, LFD + CPF, and HFD, HFD + CPF) and fed either HFD or LFD, in which the CPF groups (LFD + CPF and HFD + CPF) were supplemented with CPF at 2 mg/kg BW daily over 14 weeks. HFD led to lipid accumulation in the liver, which was more pronounced after CPF treatment (Figure A–C). Interestingly, we observed substantial immune cell infiltration (Figure C) and fibrosis (Figure D) in the livers of LFD-fed mice treated with CPF. Furthermore, immune cell infiltration was also noticed in the iWAT of LFD-fed mice treated with CPF, but not in those fed with HFD (Figure E).

3.2. CPF Concentrations, Tissue Morphology, and Gene Expression in Obese and Nonobese Male Mice in Response to CPF Exposure (2 mg/kg BW)

To determine whether more fat mass protected the liver from toxin exposure, we fed C57BL/6J mice with HFD (60 kcal% fat) or LFD (10 kcal% fat) to obtain a group of obese mice (40.9 ± 0.8 g) and a group of nonobese mice (32.6 ± 0.6 g) and then gavaged them with 2 mg/kg CPF daily for 4 weeks (Figure A). As anticipated, compared to the LFD group, mice in the HFD group had significantly higher iWAT, gWAT, and BAT weight, but there was no difference in liver weight (Figure S1A). HFD-fed mice accumulated more lipids in fat tissues (Figure S1B). In line with this, obese mice had lower unit levels of CPF and its metabolites CPF-oxon and TCPy in both iWAT and gWAT, but higher unit levels of CPF and CPF-oxon in the liver (Figure B). No difference in the serum CPF-oxon or TCPy content was observed (Figure C). Although the liver weight of obese mice was close to that of the nonobese mice, the liver fat content of obese mice was significantly higher (Figure D,E), and CPF content in the liver was higher accordingly (Figure B). From another point of view, the total amount of CPF and its metabolites CPF-oxon were higher in iWAT, gWAT, and the liver of HFD-fed mice (Figure F). However, compared with the nonobese mice, obese mice showed lower levels of liver fibrosis (Figure G). In addition, obese mice had higher expressions of Pon1, Cyp1a1, and Cyp2e1 in iWAT (Figure H) and higher expressions of Pon1 and Cyp2e1 in gWAT (Figure I), while lower expressions of Cyp1a2, Cyp3a11, and Cyp2c5e in the liver (Figure J). No difference was detected in the BAT genes (Figure K). We further analyzed inflammation and fibrosis related genes in the livers of LFD and HFD fed mice, but no difference was found (Figure L).

2.

2

CPF concentrations, tissue morphology, and gene expression in obese and nonobese mice in response to CPF exposure (2 mg/kg BW). C57BL/6J male mice were fed either an HFD (60%) or LFD to obtain a group of obese mice and a group of nonobese mice. They were then gavaged with 2 mg/kg BW CPF daily for 4 weeks. (A) Body weight of HFD- and LFD-fed mice. The underlying data are available in Table S2. (B) CPF concentration of tissues. The underlying data are available in Table S3. (C) CPF concentration of serum. The underlying data are available in Table S4. (D) Representative images of Oil Red O-stained liver sections (scale bar = 200 μm). (E) TG content in the liver. The underlying data are available in Table S5. (F) The total content of CPF in tissues. The underlying data are available in Table S6. (G) Representative images of picrosirius red-stained liver sections (scale bar = 200 μm). (H) Expression of CPF-responsive genes in iWAT. (I) Expression of CPF-responsive genes in gWAT. (J) Expression of CPF-responsive genes in the liver. (K) Expression of CPF-responsive genes in BAT. (L) Expression of inflammation-related genes IL-1β, IL-6, and IL-10 and fibrosis-related genes Tgf-β1, Col1a1, Col1a2, Timp1, Mmp2 in the liver. The underlying data of H, I, J, K and L are available in Table S7. Data presented are mean ± SEM, n = 6. Significance was calculated using a nonpaired two-tailed Student’s t test. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. CPF: chlorpyrifos. HFD: high-fat diet. LFD: Low-fat diet. BW: body weight. iWAT: inguinal white adipose tissue. gWAT, gonadal white adipose tissue. BAT: brown adipose tissue. CPF-oxon: chlorpyrifos oxon. TCPy: 3,5,6-trichloro-2-pyridinol. H&E: hematoxylin–eosin. TG: triacylglycerol.

3.3. CPF Mobilization, Tissue Health, and the Expression of CPF-Responsive Genes of CPF-Exposed (2 or 0.45 mg/kg BW) Male and Female Mice upon Acute Weight Loss

To investigate whether a reduction in fat mass during weight loss would cause tissue damage due to CPF release, C57BL/6J mice were fed with HFD (60 kcal% fat) and orally administered (by gavage) 2 mg/kg BW of CPF daily for 1 month. Subsequently, these mice were randomly divided into 3 groups with two groups undergoing weight loss interventions via either treadmill exercise or CL316243 injections for 1 week and the last group remaining untreated as the control (Figure A). Another 3 groups of mice were also fed with HFD and underwent weight loss, but no CPF was administrated (gavaged with ultrapure water) (Figure S2A). Both treadmill exercise and CL316243 injections effectively reduced the body weight (Figure B). Weight loss mice had lower iWAT and gWAT weight (Figure C) and lower liver triglyceride (TG) content (Figure D). As expected, weight loss mice had higher levels of CPF content in iWAT, gWAT, liver, and brain (Figure E) and obvious liver inflammation and fibrosis were detected in weight loss mice (Figure F). In addition, weight loss mice exhibited higher serum aspartate aminotransferase (AST) levels, indicating liver damage (Figure G). There was no difference in serum alanine aminotransferase (ALT) levels (Figure H). Furthermore, we analyzed the CPF-responsive genes expressed in various tissues. Weight loss mice had higher expression of Pon1, Cyp1a1, Cyp1a2, Cyp3a11, and Cyp2c55 in iWAT (Figure A), higher expression of Cyp2c55 in BAT (Figure B), higher expression of Pon1, Ahr, Cyp1a2, Cyp3a11, Cyp2c55, and Cyp2e1 in gWAT (Figure C), and higher expression of Pon1, Ahr, Cyp1a2, Cyp3a11, Cyp2c55, and Cyp2e1 in the liver (Figure D). No differences in mRNA expression of CPF-responsive genes in the brain were observed (Figure E). Moreover, higher expression of inflammation-related genes IL-1β, IL-6, and IL-10 and fibrosis-related genes Tgf-β1, Col1a1, Col1a2, Timp1, and Mmp2 were detected in the liver of weight-loss mice, particularly the CL316243 treated mice (Figure F). Histological evidence of tissue damage was observed in CPF-pretreated mice subjected to weight loss. In the absence of CPF, 1 week weight loss programs also resulted in significantly lower body weight and tissue weight (Figure S2A–C). However, no visible inflammation or fibrosis was detected in the liver (Figure S2D), and there were no differences in serum AST and ALT levels (Figure S2E,F). The expression of CPF-responsive genes remained extremely low and unaffected by weight loss programs (Figure S2G). Notably, although we previously reported that CPF led to mitochondria damage and impaired BAT function, CL316243 treated mice showed obvious beige adipocytes in iWAT no matter if the mice were or were not pretreated with CPF (Figure S3).

3.

3

CPF concentrations and liver health of CPF-exposed (2 mg/kg BW) male mice upon acute weight loss. Tissue CPF concentration and tissue health of mice after weight loss. (A) C57BL/6J mice were fed an HFD (60%) and gavaged with 2 mg/kg BW CPF daily for 1 month. These mice were then subjected to weight loss programs through treadmill exercise or CL316243 injections, over a period of 1 week. (B) Body weight of mice. The underlying data are available in Table S8. (C) Tissue weight of mice after weight loss. The underlying data are available in Table S9. (D) Liver triacylglycerol (TG) content. The underlying data are available in Table S10. (E) CPF concentration in tissues. The underlying data are available in Table S11. (F) Representative images of H&E-stained liver sections (scale bar = 200 μm). (G) Serum AST level. (H) Serum ALT level. The underlying data of G and H are available in Table S12. Data presented are mean ± SEM, n = 6, * p < 0.05. Variances were analyzed by one-way ANOVA, and pairwise comparisons were performed using Fisher’s LSD procedure. ** p < 0.01, *** p < 0.001. CPF: chlorpyrifos. HFD: high-fat diet. BW: body weight. iWAT: inguinal white adipose tissue. gWAT, gonadal white adipose tissue. BAT: brown adipose tissue. H&E: hematoxylin–eosin. AST: Aspartate aminotransferase. ALT: Alanine aminotransferase.

4.

4

Expression of genes in adipose tissues, liver, and brain of CPF-exposed (2 mg/kg BW) male mice upon acute weight loss. C57BL/6J mice were fed with an HFD (60%) and gavaged with 2 mg/kg BW CPF daily for 1 month. The mice were then subjected to weight loss programs through treadmill exercise or CL316243 injections, over a period of 1 week. Expression of CPF-responsive genes in (A) iWAT, (B) BAT, (C) eWAT, liver (D), and (E) brain were analyzed. (F) Expression of inflammation-related genes IL-1β, IL-6, and IL-10 and fibrosis-related genes Tgf-β1, Col1a1, Col1a2, Timp1, Mmp2 in the liver. The underlying data of A, B, C, D, E and F are available in Table S13. n = 6. Variances were analyzed by one-way ANOVA, and pairwise comparisons were performed using Fisher’s LSD procedure. * p < 0.05, *** p < 0.001. CPF: chlorpyrifos; iWAT: inguinal white adipose tissue; gWAT, gonadal white adipose tissue; BAT: brown adipose tissue.

We further mimicked human-relevant exposure to CPF by adding 5 mg/kg CPF to the diet, which equated to an exposure of 0.45 mg/kg BW and close to human-relevant exposure (Figure S4A). Notably, we have previously shown that the acetylcholinesterase activity of mice was not inhibited in this dose. Consistent with our previous study, mice exposed to CPF had an elevated body weight gain (Figure S4B). After 1 month HFD and CPF feeding, the CPF-exposed mice underwent treadmill exercise, which resulted in lower body weight and tissue weight (Figure S4C,D), and more crown-like structures in iWAT (Figure S4E) and liver fibrosis (Figure S4F) were observed in exercised mice. Similarly, upon CPF exposure, exercise mice had higher expression of CPF-responsive genes including Cyp1a1 and Cyp1a2 in iWAT (Figure S4G), Cyp3a11 in gWAT (Figure S4H), and Cyp3a11 and Cyp2c55 in the liver (Figure S4I) when compared to the control mice.

To test whether there is a gender difference in CPF mobilization, we repeated the CPF exposure and weight loss experiments in female mice (Figure A). Female mice gained less weight compared to male mice (Figure B), and weight loss was less pronounced (Figure B,C). Nevertheless, upon CPF exposure, excised female mice showed more liver fibrosis (Figure D,E) and a higher expression of CPF-responsive genes in iWAT and liver (Figure F–H).

5.

5

Body weight, tissue weight, tissue morphology, and the expression of CPF-responsive genes in CPF-exposed (2 mg/kg BW) female mice upon acute weight loss. (A) C57BL/6J female mice were fed an HFD (60%) and gavaged with 2 mg/kg BW CPF for 1 month. These mice were then subjected to weight loss programs through treadmill exercise or CL316243 injections, over a period of 1 week. (B) Body weight. The underlying data are available in Table S27. (D) Representative images of H&E-stained liver sections (E) Representative images of Sirius red-stained liver sections. (F) Expression of CPF-responsive genes in iWAT. (G) Expression of CPF-responsive genes in gWAT. (H) Expression of CPF-responsive genes in the liver. The underlying data of F, G, and H are available in Table S28. Scale bar = 200 μm. Data presented are mean ± SEM, n = 6. Significance was calculated using a nonpaired two-tailed Student’s t test. * p < 0.05. CPF: chlorpyrifos. HFD: high-fat diet. BW: body weight. iWAT: inguinal white adipose tissue. gWAT, gonadal white adipose tissue. BAT: brown adipose tissue. H&E: hematoxylin–eosin.

3.4. CPF Mobilization, Glucose Metabolism and Energy Homeostasis of CPF-Exposed (2 Mg/Kg Bw) Male Mice upon Prolonged Weight Loss

To further investigate whether elevated CPF concentration resulting from weight loss influenced energy metabolism, C57BL/6J mice were fed with HFD (60 kcal % fat) and orally administered (by gavage) 2 mg/kg BW of CPF daily or equal volumes of ultrapure water for 1 month and then subjected to weight loss programs, with experimental groupings and treatments consistent with the previous trial but for a period of 10 weeks (Figure A). In mice not exposed to CPF, CL316243 treated or exercise mice exhibited 35% and 37% lower body weights, respectively (Figure B), compared to their control group, while in mice exposed to CPF, CL316243 treatment or exercise led reductions of 25% and 23% in body weight (Figure C). In CPF-exposed groups, a higher serum CPF concentration was still detected in CL316243 treated mice after a prolonged weight loss (Figure D) but no differences in CPF-oxon (Figure E) or TCPy (Figure F) concentrations were observed. Similarly, glucose tolerance was significantly improved in CL316243-treated and exercised mice not exposed to CPF (Figure G). However, in CPF treated mice, while glucose tolerance remained better in these intervention groups, the improvements were substantially less pronounced (Figure H). Analysis of iWATin CPF treated mice revealed that, while glucose tolerance remained better in these intervention groups, the improvements were substantially less pronounced (Figure H). Analysis of iWAT energy metabolism pathways revealed that, without CPF, CL316243 and exercise groups displayed significantly higher basal and phosphorylated AMP-activated protein kinase (AMPK) levels (Figure A–C). In CPF-treated mice, basal and phosphorylated AMPK levels in iWAT were elevated, but no further increases in AMPK activation were observed with CL316243 treatment (Figure A–C). In the absence of CPF, both CL316243 and treadmill-exertion-treated groups had higher expression of the lipolytic protein hormone-sensitive lipase (HSL) (Figure D,E). CPF-treated mice had a higher basal HSL protein content in iWAT, but weight loss interventions did not alter the HSL expression (Figure D,E). Notably, CL316243 treated mice exhibited improved HSL activation in the presence or absence of CPF (Figure D,F). CPF-exposed mice subjected to weight loss interventions also demonstrated elevated levels of KA (ACC1) protein expression but higher levels of its inactive form (p-ACC1) (Figure G-I). While protein kinase A (PKA) activation was greater in intervention groups without CPF, this effect was absent in CPF-treated mice (Figure J,K) Total and phosphorylated ULK1 were higher in the CL316243-treated and exercise mice, but CPF exposure abolished these differences (Figure L–N). Notably, when mice were pretreated with CPF, lower body weights in the weight-loss-treated group resulted in the appearance of greater accumulation of the autophagy adaptor protein P62 (Figure L,O).

6.

6

Body weight change, tissue concentrations of CPF and its metabolites, and glucose metabolism of CPF-exposed (2 mg/kg BW) male mice upon prolonged weight loss. (A) C57BL/6J male mice were fed an HFD (60%), gavaged with 2 mg/kg BW CPF (or saline) daily for 1 month, and then subjected to weight loss programs through treadmill exercise or CL316243 injections, for a period of 10 weeks. (B) Body weight of mice without CPF. (C) Body weight of mice treated with CPF. The underlying data of B and C are available in Table S14. (D) CPF concentrations in iWAT and serum. (E) CPF-oxon in iWAT and serum. (F) TCPy in iWAT and serum. The underlying data of D, E, F, and G are available in Table S15. (G) Glucose tolerance test (GTT) of mice post weight loss without CPF. (H) Glucose tolerance test (GTT) of mice post weight loss with CPF. The underlying data of G and H are available in Table S16. Data presented are mean ± SEM, n = 6. Variances were analyzed by one-way ANOVA, and pairwise comparisons were performed using Fisher’s LSD procedure. * p < 0.05. CPF: chlorpyrifos. HFD: high-fat diet. BW: body weight. iWAT: inguinal white adipose tissue. CPF-oxon: chlorpyrifos oxon. TCPy: 3,5,6-trichloro-2-pyridinol. AUC: area under curve.

7.

7

Lipolysis and mitophagy signaling in iWAT of CPF-exposed (2 mg/kg BW) male mice upon prolonged weight loss. C57BL/6J male mice were fed a HFD (60%), gavaged with 2 mg/kg BW CPF (or saline) daily for 1 month, and then subjected to weight loss programs through treadmill exercise or CL316243 injections, for a period of 10 weeks. (A) Western blot bands of AMPKα and p-AMPKα in iWAT. (B, C) Quantification of AMPKα (B) and p-AMPKα (C) proteins in iWAT. (D) Western blot bands of HSL and p- HSL in iWAT. (E, F) Quantification of HSL (E) and p- HSL (F) proteins in iWAT. (G) Western blot bands of ACC1 and p-ACC1 in iWAT. (H, I) Quantification of ACC1 (H) and p-ACC1 (I) proteins in iWAT. (J) Western blot bands of p-PKA in iWAT. (K) Quantification of p-PKA protein in iWAT. (L) Western blot bands of ULK1, p-ULK1 and P62 in iWAT. (M–O) Quantification of ULK1 (M), p-ULK1 (N), and P62 (O) proteins in iWAT. The underlying data of B, C, E, F, H, I, K, M, N, and O are available in Table S17. Data presented are mean ± SEM, n = 6. Variances were analyzed by one-way ANOVA, and pairwise comparisons were performed using Fisher’s LSD procedure. * p < 0.05, ** p < 0.01, *** p < 0.001. iWAT, inguinal white adipose tissue.CPF: chlorpyrifos.iWAT: inguinal white adipose tissue.AMPKα: AMP-activated protein kinase α; p-AMPKα: phosphorylated AMP-activated protein kinase α; HSL: lipolytic protein hormone-sensitive lipase. p-HSL: phosphorylated lipolytic protein hormone-sensitive lipase. ACC1: acetyl-CoA carboxylase 1. p-ACC1: phosphorylated acetyl-CoA carboxylase 1. p-PKA: phosphorylated protein kinase A. ULK1: unc-51-like autophagy-activated kinase 1. p-ULK1: phosphorylated unc-51-like autophagy-activated kinase 1. P62: sequestosome 1.

4. Discussion

Adipose tissue primarily serves as an energy storage site and a regulatory center for energy metabolism; yet, its role in the deposition and mobilization of exogenous chemicals is not fully understood. Due to the lipophilic properties of many chemicals, white adipose tissues become the major site that traps these exogenous toxins. In the body, CPF is metabolized through enzymatic pathways, primarily in the liver. CYP enzymes catalyze the oxidative metabolism of xenobiotics , and convert CPF into CPF-oxon, which is further hydrolyzed by PON1 into TCPy and excreted in urine. AHR is a ligand-activated transcription factor that acts as a sensor of xenobiotics; although it does not directly catalyze CPF metabolism, it upregulates Cyps and promotes CPF metabolism. Among its metabolites, only CPF is highly persistent in the body and we previously reported that CPF was the most active compound among its metabolites which was associated with disturbances in adipose tissue energy metabolism and the exacerbation of obesity development. According to a reported pharmacokinetic and pharmacodynamic analysis of CPF, only approximately 20% of the administered CPF in rats was excreted as urinary TCPy over a 10 day period. In our study, mice exposed to CPF for 4 weeks retained detectable levels (0.5 μg/g in iWAT; 0.1 μg/g in serum) even after 10 weeks of weight loss, highlighting the persistence of such toxins. According to the International Codex Alimentarius Commission (CAC), the Maximum Residue Limits (MRLs) for CPF in food are 0.1–1 mg/kg for cereals, 0.01–1 mg/kg for vegetables, and 0.01–0.5 mg/kg for fruits. In addition, the acute reference dose of CPF has been established at 0.1 mg/kg BW by the European Union. In the current study, the lowest CPF exposure dose (0.45 mg/kg of BW) approximates levels relevant to human environmental exposure. These findings underscore the potential for bioaccumulation even at “safe” regulatory thresholds, raising questions about the adequacy of current standards to protect against chronic low-dose effects.

Notably, chronic low-dose CPF exposure may pose disproportionate risks during weight fluctuations. While obese mice showed lower CPF concentrations per gram of WAT (due to lipid dilution), their total CPF burden was higher, driving an elevated expression of CPF-responsive genes. Intriguingly, despite the higher CPF level in the liver of obese mice due to more hepatic fat, their livers showed lower levels of fibrosis and had lower expression of CPF-responsive genes, suggesting that increased lipid content confers a protective effect against toxins in the liver. However, in previous mouse studies, CPF impairs mitochondrial function, inhibits energy expenditure, and promotes lipid accumulation, forming a mutually reinforcing cycle of toxin deposition and fat accumulation. This poses a significant threat to health during periods of fattening.

Activation of brown/beige adipocytes promotes lipolysis and enhances energy expenditure, , and this process can be triggered by β3-adrenergic receptors upon norepinephrine activations. Exercise is one of the most popular and effective ways to lose weight. In our study, we successfully induced weight loss in mice using CL316243 or treadmill exercise. According to previous studies, both β3-adrenergic agonist and exercise improve glucose tolerance and alleviate hepatic steatosis induced by HFD. However, with CPF deposited in fat tissues, the CPF concentration was significantly higher in adipose tissues and the liver after weight loss, leading to hepatic inflammation and fibrosis in both male and female mice.

Higher CPF concentrations after weight loss counteracted the improvement in glucose tolerance induced by β3-adrenergic activation or treadmill exercise. Without CPF, β3-adrenergic activation or treadmill exercise activated PKA/AMPK signaling and enhanced lipolysis but failed to do so when CPF was accumulated in fat. Additionally, with CPF, expression of the lipogenic protein ACC1 was significantly lower in the CPF group in either the CL316243-treated or treadmill-excitation-treated groups, which could explain the attenuation of weight loss. Lastly, β3-adrenergic activation or treadmill exercise activated ULK1, a key mediator of mitophagy in adipocytes, which was previously reported to be inhibited by UCP1. Thus, with an increase in CPF concentration, weight loss processes failed to activate mitophagy, a critical process that cleared the damaged mitochondria and maintains mitochondrial quality and led to the accumulation of the autophagy adaptor protein p62 in adipocytes. Although it has been known for years that the concentration of environmental pollutants in the body changes during weight gain and loss, ,− this is the first time we show that the mobilization of environmental pollutants during weight change affects tissue health and energy metabolism.

Beyond CPF, numerous fat-soluble endocrine disruptors have existed in the human body for years. For example, dichlorodiphenyltrichloroethane (DDT) and its metabolite dichlorodiphenyldichloroethylene (DDE) have half-lives of 2–15 years; polychlorinated biphenyls (PCBs) have half-lives ranging from 4.6 to 41 years in human, per- and polyfluoroalkyl substances (PFAS) like PFOA, PFOS and PFHxS exhibit half-lives of 2–8 years; and dioxins (e.g., TCDD) have half-lives of 7–12 years in humans and over 100 years in soil. , These persistent chemicals, often termed “forever chemicals”, are associated with obesity, diabetes, thyroid disorders, reproductive toxicity, nervous toxicity, and cancer. Beyond restricting their use and exposure to these chemicals, it is crucial to address their mobilization during weight changes and the associated health risks.

5. Conclusion and Perspectives

In summary, an enlarged fat mass offers some protection by diluting lipophilic chemicals but also increases the overall chemical burden on the body, posing a significant risk. During weight loss, a reduction in fat mass can lead to higher concentrations of exogenous chemical toxins, resulting in tissue damage and metabolic dysfunction (Figure ).

8.

8

Schematic illustration of the fluctuating levels of CPF in fat and nonfat tissues during weight changes and their impact on tissue health and energy metabolism. CPF: chlorpyrifos.

These findings underscore a critical gap in environmental toxin regulation, as current safety standards did not assess long-term, nonlethal effects, particularly during metabolic fluctuations like obesity or weight loss. The broader implications extend beyond CPF to other persistent organic pollutants (e.g., DDT, PFAS, and dioxins), which accumulate over years and may similarly disrupt metabolism when released during fat loss. Addressing this issue requires reevaluating regulatory frameworks to account for adipose toxin dynamics, increasing clinical awareness of pollutant risks in metabolic disease management, and exploring strategies (e.g., specific compounds or dietary interventions) to mitigate toxin mobilization during weight loss. Ultimately, our study highlights an underappreciated trade-off: while weight loss improves metabolic health, the accompanying release of stored pollutants may partially offset these benefits, necessitating a better approach to reducing chemical toxicity while reducing body weight.

Supplementary Material

hp6c00042_si_001.xlsx (88.6KB, xlsx)
hp6c00042_si_002.pdf (1.3MB, pdf)

Acknowledgments

This study was supported by grants from the National Natural Science Foundation of China (32272892), the Key Research and Development Program-Key Projects (2021YFD1200900 and 2023YFD1301302), and the Chinese Universities Scientific Fund (2024TC035).

The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/EHP.6c00042.

  • Tables of TG content, changes in body weight, unit contents, levels of entities in serum, TG content, total levels of toxins, RNA expression, tissue weights, changes in blood glucose, and protein expression, tissue weight (XLSX)

  • Figures of tissue weights and morphology, tissue analysis, morphology of adipose tissue, and body weight, tissue weight, tissue morphology, and the expression of CPF-responsive genes (PDF)

∇.

Y.X. and G.T. contributed equally to this work. B.W. designed the experiments. G.T., X.H., and X.Y. performed the animal feeding and treatment. Y.X., G.T., X.H., X.Y., Y.F., Z.H., Y.L., Y.L., Z.J., X.S., Y.Z., L.C., Y.X., Y.Q., and B.L. performed sample collection and analysis. Y.X., G.T., and X.H. performed data analysis. Y.X. and B.W. wrote the manuscript with discussion and improvement from all the authors. B.W. supervised the project development and funded the study.

The authors declare no competing financial interest.

References

  1. Haverinen E., Fernandez M. F., Mustieles V., Tolonen H.. Metabolic syndrome and endocrine disrupting chemicals: an overview of exposure and health effects. Int. J. Environ. Res. Public Health. 2021;18(24):13047. doi: 10.3390/ijerph182413047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Wang B., Tsakiridis E. E., Zhang S., Llanos A., Desjardins E. M., Yabut J. M.. The pesticide chlorpyrifos promotes obesity by inhibiting diet-induced thermogenesis in brown adipose tissue. Nat. Commun. 2021;12(1):5163. doi: 10.1038/s41467-021-25384-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Xiao X., Kim Y., Kim D., Yoon K. S., Clark J. M., Park Y.. Permethrin alters glucose metabolism in conjunction with high fat diet by potentiating insulin resistance and decreases voluntary activities in female C57BL/6J. mice. Food Chem. Toxicol. 2017;108(Pt A):161–170. doi: 10.1016/j.fct.2017.07.053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Karami-Mohajeri S., Ahmadipour A., Rahimi H. R., Abdollahi M.. Adverse effects of organophosphorus pesticides on the liver: a brief summary of four decades of research. Arh Hig Rada Toksikol. 2017;68(4):261–275. doi: 10.1515/aiht-2017-68-2989. [DOI] [PubMed] [Google Scholar]
  5. Casals-Casas C., Desvergne B.. Endocrine disruptors: from endocrine to metabolic disruption. Annu. Rev. Physiol. 2011;73:135–162. doi: 10.1146/annurev-physiol-012110-142200. [DOI] [PubMed] [Google Scholar]
  6. Lee D.-H., Lee I.-K., Jin S.-H., Steffes M., Jacobs D. R.. Association between serum concentrations of persistent organic pollutants and insulin resistance among nondiabetic adults: results from the National Health and Nutrition Examination Survey 1999–2002. Diabetes Care. 2007;30(3):622–628. doi: 10.2337/dc06-2190. [DOI] [PubMed] [Google Scholar]
  7. Wang J., Zhu Y., Cai X., Yu J., Yang X., Cheng J.. Abnormal glucose regulation in pyrethroid pesticide factory workers. Chemosphere. 2011;82(7):1080–1082. doi: 10.1016/j.chemosphere.2010.10.065. [DOI] [PubMed] [Google Scholar]
  8. Yoo M., Lim Y.-H., Kim T., Lee D., Hong Y.-C.. Association between urinary 3-phenoxybenzoic acid and body mass index in Korean adults: 1 st Korean National Environmental Health Survey. ANN OCCUP ENVIRON ME. 2016;28(1):1–8. doi: 10.1186/s40557-015-0079-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Warner M., Rauch S., Coker E. S., Harley K., Kogut K., Sjodin A.. Obesity in relation to serum persistent organic pollutant concentrations in CHAMACOS women. Environ. Epidemiol. 2018;2(4):e032. doi: 10.1097/EE9.0000000000000032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. De Roos A. J., Ulrich C. M., Sjodin A., McTiernan A.. Adiposity, body composition, and weight change in relation to organochlorine pollutant plasma concentrations. J. Expo Sci. Environ. Epidemiol. 2012;22(6):617–624. doi: 10.1038/jes.2012.43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Lee D. H., Jacobs D. R., Lind L., Lind P. M.. Lipophilic Environmental Chemical Mixtures Released During Weight-Loss: The Need to Consider Dynamics. Bioessays. 2020;42(6):e1900237. doi: 10.1002/bies.201900237. [DOI] [PubMed] [Google Scholar]
  12. Jackson E., Shoemaker R., Larian N., Cassis L.. Adipose Tissue as a Site of Toxin Accumulation. Compr. Physiol. 2017;7(4):1085–1135. doi: 10.1002/cphy.c160038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Tanvir E. M., Afroz R., Chowdhury M., Gan S. H., Karim N., Islam M. N.. A model of chlorpyrifos distribution and its biochemical effects on the liver and kidneys of rats. Hum Exp Toxicol. 2016;35(9):991–1004. doi: 10.1177/0960327115614384. [DOI] [PubMed] [Google Scholar]
  14. Inomata O. N., Montone R., Lara W., Weber R., Toledo H.. Tissue distribution of organochlorine residues–PCBs and pesticides–in Antarctic penguins. Antarct. Sci. 1996;8(3):253–255. doi: 10.1017/S0954102096000351. [DOI] [Google Scholar]
  15. Dirinck E., Dirtu A. C., Jorens P. G., Malarvannan G., Covaci A., Van Gaal L. F.. Pivotal Role for the Visceral Fat Compartment in the Release of Persistent Organic Pollutants During Weight Loss. J. Clin Endocrinol Metab. 2015;100(12):4463–4471. doi: 10.1210/jc.2015-2571. [DOI] [PubMed] [Google Scholar]
  16. Brown R. H., Ng D. K., Steele K., Schweitzer M., Groopman J. D.. Mobilization of Environmental Toxicants Following Bariatric Surgery. Obesity. 2019;27(11):1865–1873. doi: 10.1002/oby.22618. [DOI] [PubMed] [Google Scholar]
  17. Levesque M., Ouedraogo M. O., Fakhraei R., Harvey A. L. D., Bratton E., Walker M. C.. Relationships of First Trimester Body Mass Index and Weight Change with Persistent Organic Pollutants Concentrations in Canadian Pregnant Women. Research Square. 2023 doi: 10.21203/rs.3.rs-1032665/v1. [DOI] [Google Scholar]
  18. Herrick K.. QuickStats: Age-Adjusted Percentage of Adults Aged ≥20 Years Who Tried to Lose Weight During the Past 12 Months,* by SexNational Health and Nutrition Examination Survey, 2007–2008 to 2015–2016. MMWR Morb. Moratl. Wkly. Rep. 2018;67:1166. doi: 10.15585/mmwr.mm6741a10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Syngal S., Coakley E. H., Willett W. C., Byers T., Williamson D. F., Colditz G. A.. Long-term weight patterns and risk for cholecystectomy in women. Ann. Int. Med. 1999;130(6):471–477. doi: 10.7326/0003-4819-130-6-199903160-00003. [DOI] [PubMed] [Google Scholar]
  20. Ubaid ur Rahman H., Asghar W., Nazir W., Sandhu M. A., Ahmed A., Khalid N.. A comprehensive review on chlorpyrifos toxicity with special reference to endocrine disruption: Evidence of mechanisms, exposures and mitigation strategies. Sci. Total Environ. 2021;755(Pt 2):142649. doi: 10.1016/j.scitotenv.2020.142649. [DOI] [PubMed] [Google Scholar]
  21. Solomon K. R., Williams W. M., Mackay D., Purdy J., Giddings J. M., Giesy J. P.. Properties and uses of chlorpyrifos in the United States. Reviews of environmental contamination and toxicology. 2014;231:13–34. doi: 10.1007/978-3-319-03865-0_2. [DOI] [PubMed] [Google Scholar]
  22. Chishti Z., Hussain S., Arshad K. R., Khalid A., Arshad M.. Microbial degradation of chlorpyrifos in liquid media and soil. J. Environ. Manage. 2013;114:372–380. doi: 10.1016/j.jenvman.2012.10.032. [DOI] [PubMed] [Google Scholar]
  23. Chandra S., Mahindrakar A. N., Shinde L.P.. Determination of cypermethrin and chlorpyrifos in vegetables by GC-ECD. Int. J. Chemtech Res. 2010;2(2):908–911. [Google Scholar]
  24. Bakke J. E., Feil V. J., Price C. E.. Rat urinary metabolites from O,O-diethyl-O-(3,5,6-trichloro-2-pyridyl) phosphorothioate. J. Environ. Sci. Health B. 1976;11(3):225–230. doi: 10.1080/03601237609372038. [DOI] [PubMed] [Google Scholar]
  25. Uchendu C., Ambali S. F., Ayo J. O.. The organophosphate, chlorpyrifos, oxidative stress and the role of some antioxidants: a review. Afr. J. Agric. Res. 2012;7(18):2720–2728. doi: 10.5897/AJAR11.2510. [DOI] [Google Scholar]
  26. Racke K. D., Laskowski D. A., Schultz M. R.. Resistance of chlorpyrifos to enhanced biodegradation in soil. J. Am. Chem. Soc. 1990;38(6):1430–1436. doi: 10.1021/jf00096a029. [DOI] [Google Scholar]
  27. Abu-Qare A. W., Abou-Donia M. B.. Development of a high-performance liquid chromatographic method for the quantification of chlorpyrifos, pyridostigmine bromide, N,N-diethyl-m-toluamide and their metabolites in rat plasma and urine. J. CHROMATOGR B. 2001;754(2):533–538. doi: 10.1016/S0378-4347(01)00028-7. [DOI] [PubMed] [Google Scholar]
  28. Jackson E., Shoemaker R., Larian N., Cassis L.. Adipose tissue as a site of toxin accumulation. Comprehensive Physiology. 2017;7(4):1085. doi: 10.1002/cphy.c160038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Tang J., Cao Y., Rose R. L., Brimfield A. A., Dai D., Goldstein J. A.. Metabolism of chlorpyrifos by human cytochrome P450 isoforms and human, mouse, and rat liver microsomes. Drug Metab. Dispos. 2001;29(9):1201–1204. [PubMed] [Google Scholar]
  30. Hakkola J., Pelkonen O., Pasanen M., Raunio H.. Xenobiotic-metabolizing cytochrome P450 enzymes in the human feto-placental unit: role in intrauterine toxicity. Crit. Rev. Toxicol. 1998;28(1):35–72. doi: 10.1080/10408449891344173. [DOI] [PubMed] [Google Scholar]
  31. Costa L. G., Giordano G., Cole T. B., Marsillach J., Furlong C. E.. Paraoxonase 1 (PON1) as a genetic determinant of susceptibility to organophosphate toxicity. Toxicology. 2013;307:115–122. doi: 10.1016/j.tox.2012.07.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Barouki R., Aggerbeck M., Aggerbeck L., Coumoul X.. The aryl hydrocarbon receptor system. Drug. Metabol. Drug. Interact. 2012;27(1):3–8. doi: 10.1515/dmdi-2011-0035. [DOI] [PubMed] [Google Scholar]
  33. Ellison C. A., Smith J. N., Lein P. J., Olson J. R.. Pharmacokinetics and pharmacodynamics of chlorpyrifos in adult male Long-Evans rats following repeated subcutaneous exposure to chlorpyrifos. TOXICOLOGY. 2011;287(1–3):137–144. doi: 10.1016/j.tox.2011.06.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Review report for the active substance chlorpyrifos; European Union, 2005. [Google Scholar]
  35. Cero C., Lea H. J., Zhu K. Y., Shamsi F., Tseng Y. H., Cypess A. M.. beta3-Adrenergic receptors regulate human brown/beige adipocyte lipolysis and thermogenesis. JCI Insight. 2021;6(11):e139160. doi: 10.1172/jci.insight.139160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Sidossis L., Kajimura S.. Brown and beige fat in humans: thermogenic adipocytes that control energy and glucose homeostasis. J. Clin. Invest. 2015;125(2):478–486. doi: 10.1172/JCI78362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Morrison S. F., Madden C. J., Tupone D.. Central neural regulation of brown adipose tissue thermogenesis and energy expenditure. Cell Metab. 2014;19(5):741–756. doi: 10.1016/j.cmet.2014.02.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. McGlashon J. M., Gorecki M. C., Kozlowski A. E., Thirnbeck C. K., Markan K. R., Leslie K. L.. Central serotonergic neurons activate and recruit thermogenic brown and beige fat and regulate glucose and lipid homeostasis. Cell Metab. 2015;21(5):692–705. doi: 10.1016/j.cmet.2015.04.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Martin C. B., Herrick K. A., Sarafrazi N., Ogden C. L.. Attempts to lose weight among adults in the United States, 2013–2016. NCHS Data Brief. 2018;313:1–8. [PubMed] [Google Scholar]
  40. Wang Z., Li S., Wang R., Guo L., Xu D., Zhang T.. The protective effects of the beta3 adrenergic receptor agonist BRL37344 against liver steatosis and inflammation in a rat model of high-fat diet-induced nonalcoholic fatty liver disease (NAFLD) Mol. Med. 2020;26(1):54. doi: 10.1186/s10020-020-00164-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Cho J., Lee I., Kim D., Koh Y., Kong J., Lee S.. Effect of aerobic exercise training on non-alcoholic fatty liver disease induced by a high fat diet in C57BL/6 mice. J. Exerc Nutrition Biochem. 2014;18(4):339–346. doi: 10.5717/jenb.2014.18.4.339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Mottillo E. P., Desjardins E. M., Crane J. D., Smith B. K., Green A. E., Ducommun S.. Lack of adipocyte AMPK exacerbates insulin resistance and hepatic steatosis through brown and beige adipose tissue function. Cell Metab. 2016;24(1):118–129. doi: 10.1016/j.cmet.2016.06.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Egan D. F., Shackelford D. B., Mihaylova M. M., Gelino S., Kohnz R. A., Mair W.. Phosphorylation of ULK1 (hATG1) by AMP-activated protein kinase connects energy sensing to mitophagy. SCIENCE. 2011;331(6016):456–461. doi: 10.1126/science.1196371. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Azzouz, A. ; Hausler, R. ; El-Akhrass, M. . Chapter 17 - Pesticides and removal approaches. In Sorbents Materials for Controlling Environmental Pollution; Núñez-Delgado, A. Ed.; Elsevier, 2021; pp 435–462. [Google Scholar]
  45. Seegal R. F., Fitzgerald E. F., Hills E. A., Wolff M. S., Haase R. F., Todd A. C.. Estimating the half-lives of PCB congeners in former capacitor workers measured over a 28-year interval. J. Expo. Sci. Environ. Epidemiol. 2011;21(3):234–246. doi: 10.1038/jes.2010.3. [DOI] [PubMed] [Google Scholar]
  46. Rosato I., Bonato T., Fletcher T., Batzella E., Canova C.. Estimation of per-and polyfluoroalkyl substances (PFAS) half-lives in human studies: a systematic review and meta-analysis. Environ. Res. 2024;242:117743. doi: 10.1016/j.envres.2023.117743. [DOI] [PubMed] [Google Scholar]
  47. Pirkle J. L., Wolfe W. H., Patterson D. G., Needham L. L., Michalek J. E., Miner J. C.. Estimates of the half-life of 2,3,7,8-tetrachlorodibenzo-p-dioxin in Vietnam Veterans of Operation Ranch Hand. J. Toxicol Environ. Health. 1989;27(2):165–171. doi: 10.1080/15287398909531288. [DOI] [PubMed] [Google Scholar]
  48. Milbrath M. O., Wenger Y., Chang C. W., Emond C., Garabrant D., Gillespie B. W.. Apparent half-lives of dioxins, furans, and polychlorinated biphenyls as a function of age, body fat, smoking status, and breast-feeding. Environ. Health Perspect. 2009;117(3):417–425. doi: 10.1289/ehp.11781. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. George A. J., Birnbaum L. S.. Dioxins vs. PFAS: Science and Policy Challenges. Environ. Health Perspect. 2024;132(8):085003. doi: 10.1289/EHP14449. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

hp6c00042_si_001.xlsx (88.6KB, xlsx)
hp6c00042_si_002.pdf (1.3MB, pdf)

Articles from Environmental Health Perspectives are provided here courtesy of American Chemical Society

RESOURCES