ABSTRACT
Background
Extracellular vesicles (EVs) are membrane vesicles secreted by cells that carry several bioactive molecules, which are currently used in biomedical research as a source of exosomes and to investigate their effect in response to cancer studies.
Methods
EVs isolated from the supernatant of Macaca fascicularis Mesenchymal Stem Cells (MSCs), using the commercial ExoQUICK kit, and markers validation evaluated using quantitative reverse transcription Polymerase Chain Reaction (qRT‐PCR). EVs were further applied on breast cancer cells (MCF‐7) and colorectal cancer cells (WiDr).
Results
The application of EVs to MCF‐7 and WiDr cells showed growth inhibition and resulted in the cells' viability decreased compared to untreated cells. The apoptosis (BAX and BCL2) and proliferation markers (PCNA and P53) on both cells demonstrated increasing than untreated cells, expecting that the EVs prevent the cells' growth uncontrolled.
Conclusion
The EVs have the potential to inhibit the growth of cancer and colon cancer in vitro, determining their potential for developing as an anticancer agent.
Keywords: apoptosis, exosome, extracellular vesicle, MCF‐7, WiDr
1. Introduction
Research in the field of stem cells became a high interest because regenerative medicine has the potential to cure or replace damaged tissues and organs due to degeneration, congenital defects, tissue injuries, autoimmune disorders, and neurogenic degenerative diseases. Technology utilizing stem cells continues to be explored for its potential and application as a strategic treatment method for degenerative diseases. Mesenchymal stem cells (MSCs) sourced from adipose tissue are considered appropriate therapeutic candidates for various human and animal diseases. The living cells of our body can secrete biological products; for example, extracellular vesicles (EVs). This is based on its natural potential to maintain homeostasis and has become a concern for use as a therapeutic alternative due to its sufficient availability and ease of harvesting and also can release the exosome, which has 40–100 nm in size that were discovered in the early 1980s. Exosomes are released into the extracellular environment in a multicellular body fusion with plasma membranes [1] and are secreted by most cells that have been examined so far, including mast cells, dendritic cells, B lymphocytes and tumor cells, and epithelial cells. In addition, exosomes are also found in other biological fluids, such as plasma, urine, saliva, and breast milk. The contents of these exosomes can be used as biomarkers of prognosis and/or determinants of the stage of cancer development. These contents can also regulate tumor growth, metastasis, angiogenesis, and mediate drug resistance in tumor cells [2].
The development of an EV based approach offers a promising strategy to reduce the use of animals in research, related to in vitro models for tissue repair and cancer treatment. EVs can be obtained from the conditioned medium of mesenchymal stem cells (MSC) culture, providing a non‐invasive source of bioactive molecules [3]. This method has the potential to reduce the need for invasive procedures such as biopsy and necropsy on animals. In this context, the use of EVs aligns with the principles of the 3R principle (Replacement, Reduction, and Refinement) in animal research. EVs are more biocompatible and biodegradable than synthetic nanoparticles and have low toxicity and immunogenicity, making them candidates for therapeutic applications. This study aims to evaluate the effect of EVs derived from Macaca fascicularis mesenchymal stem cells on breast cancer (MCF‐7) and colorectal cancer (WiDr) cell lines. The result is expected to contribute to the development of the use of EVs for tissue repair and cancer treatment.
2. Materials and Methods
2.1. Mesenchymal Stem Cells Isolation and Culture
Samples were obtained from three adult male M. fascicularis aged 6–8 years, with body weight ranging from 5 to 7 kg. All procedures involving animals were performed at Research Animal Facility Lodaya of the Primate Research Center at IPB University, an AAALAC‐accredited facility. The ethics approval for this study was approved by IPB Primate Research Centre's Animal Care and Use Committee (ACUC) #PRC‐22‐A006. The collection of the adipose tissue was performed by biopsy on the scapularis (upper back) and which was collected from subcutaneous fat tissue. Mononuclear cells from adipose tissue were isolated through enzymatic techniques [4]. The isolated cells were cultured at 37oC and 5% CO2, using specific medium for mesenchymal stem cells (MesenCult MSC Basal Medium supplemented with MesenCult MSC Stimulatory Supplement, STEMCELL technologies, Canada). The cell population was characterized based on MSC markers expression, namely CD 73, CD90, CD105. Confirmation of MSC was carried out by differentiation into its lineage using differentiation medium for osteocyte (MesenCult Osteogenic differentiation Kit, STEMCELL Technologies, Canada) staining with Alizarin Red (Sciencell, USA), chondrocyte (MesenCult Chondrogenic differentiation Kit, STEMCELL technologies, Canada) staining with Alcian Blue (Sciencell, USA) and adipocyte (MesenCult Adipogenic differentiation Kit, STEMCELL Technologies, Canada) staining with Oil Red O (Sciencell, USA).
2.2. Extracellular Vesicles (EVs) Isolation
The EVs were isolated from the conditioned medium of mesenchymal stem cell (MSC) cultured in serum‐free conditions. The collected conditioned medium was processed using an isolation kit (SBI, Palo Alto CA) by adding 0.5 volume of reagent. The solution was homogenized using a vortex and pipette, then incubated at 2°C–8°C for 24 h followed by centrifugation at 10 000 × g for 1 h at 2°C–8°C. The supernatant was carefully discarded, and the EVs pellet was present in the pellet at the bottom of the tube, generally invisible. The pellet was resuspended using PBS and ready for further analysis.
2.3. Viability Assay
The effect of EVs on cell viability was evaluated using the Methyl Tetrazolium assay (MTT assay) in Vero cells (ATCC CCL‐81), MCF‐7 (ATCC HTB‐22) cells, and WiDr (ATCC CCL‐218). Cells were seeded at a density of 5 × 103 cells/100μL using 96‐well tissue culture plates in growth medium (DMEM (STEMCELL Technologies, Canada) supplemented with 10% FBS (Corning, Woodland CA) and 100 U/mL penicillin and 100 μg/mL streptomycin (Corning, Woodland CA)) and incubated for 18–20 h at 37°C and 5% CO2. Cells were treated with EVs at various concentrations (20, 10, 5, 2.5, 1.25, and 0.625 μg/mL) and were added 100 μL/well; cells without treatment were included as cell controls, and then incubated again for 48 h. Subsequently, the 3‐(4,5‐Dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide (MTT) (Sigma‐Aldrich, St Louis MO) solution was added to each well and incubated for 4 h at 37°C and 5% CO2. The supernatant was discarded, and the formazan crystals were dissolved with 96% ethanol. Optical density (OD) was measured using a microplate reader at a wavelength of 565 nm.
2.4. Quantitative Reverse Transcription Polymerase Chain Reaction (qRT‐PCR)
MCF‐7 and WiDr cells were cultured to approximately 70% confluence in growth medium (DMEM supplemented with 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin) and treated with EV for 48 h. Cell viability was counted, and cells were collected and prepared for mRNA extraction. Molecular markers validation was performed using quantitative reverse transcription polymerase chain reaction (qRT‐PCR) to evaluate the expression of exosome markers (CD9 and CD81), apoptosis markers (BCl2 and BAX), and proliferation markers (PCNA and P53). Total mRNA was extracted from cells using the RNeasy kit (Qiagen, Germany), and reverse transcribed using SuperScript III Reverse Transcriptase (Invitrogen, USA), according to the manufacturer's instructions. The primer sequences used in this study are presented in Table 1. qRT‐PCR reactions were performed using SsoFast EvaGreen Supermix (Bio‐Rad, USA) on the CFX Opus 96 Real‐Time PCR System (Bio‐Rad, USA). PCR conditions were performed as follows: initial denaturation at 95°C for 2 min, followed by 40 cycles of denaturation at 95°C for 10 s and annealing/extension at the primer‐specific annealing temperature for 10 s. Gene expression was normalized to GAPDH, and relative expression was determined using the 2−ΔΔCt method.
TABLE 1.
Primer sequences used for qRT‐PCR analysis of exosome, apoptosis, and proliferation markers.
| Marker | Sequence (5′‐3′) | References | Annealing (°C) | |
|---|---|---|---|---|
| Forward | Reverse | |||
| CD9 | TCTTGGTGATATTCGCCATT | TTCGAGTACGTCCTTCTTGG | [5] | 48 |
| CD81 | CTGTATCTGGAGCTGGGAGA | GAACTGCTTCACATCCTTGG | [5] | 53 |
| P53 | AATCATCCATTGCTTGGGACG | TAGAGACGGCTCTTCTGCC | [6] | 55 |
| PCNA | CTGTAGCGGCGTTGTTGC | TCGTTGATGAGGTCCTTG | [7] | 52 |
| BCL‐2 | CCCGAGAGGTCTTTTTCCGAG | CCAGCCCATGATGGTTCTGAT | [8] | 56 |
| BAX | GCTCTAAAATCCATCCAG | CCTCTCCATCATCAACTT | [9] | 48 |
| GAPDH | CGGATTTGGTCGTATTGG | TCAAAGGTTGGAGGAGTGG | [6] | 55 |
2.5. Statistical Analysis
Data were collected as quantitative output and furthermore analyzed descriptively. Data was presented as means ± SEM. We performed ANOVA followed by multiple pairwise comparisons by using the Tukey Honestly Significant Difference test. Statistical p values < 0.05 were considered significant.
3. Results
Tissue digestion and cell dissociation have been done mechanically and enzymatically according to a method previously described. In this study, we successfully maintained mesenchymal stem cells derived from M. fascicularis adipose tissue collected via surgical biopsy. The cell populations showed spindle‐like morphology and expressed the MSCs markers CD73, CD90, and CD105 (Figure 1). Furthermore, trilineage differentiation into adipogenic, chondrogenic, and osteogenic lineages was confirmed by specific staining. We were able to identify the presence of exosomes in its conditioned medium as shown by the expression of exosome markers CD9 and CD81 (Figure 2).
FIGURE 1.
Spindle‐like morphology of MSCs derived from adipose tissue M. fascicularis (A). Markers expression of MSCs (B). Differentiation of MSCs lineage became adipocyte, chondrocyte, and osteocyte (C).
FIGURE 2.
EVs have been successfully isolated, contain exosomes which express their markers CD9 and CD81.
EVs were added to the Vero cells, MCF‐7 cells, and WiDr. In this study, the percentage (10%–30%) of cell's growth inhibition showed that all concentrations were not toxic to the Vero cells but showed inhibiting the growth of MCF‐7 and WiDr cells. Based on the MTT result, we continued to test the EVs in MCF‐7 and WiDr cells at 5, 2.5, and 1.25 μg/mL (Figure 3).
FIGURE 3.
EVs were applied to Vero cells, MCF‐7 cells, and WiDr cells to determine the percentage of cell viability using the Methyl Tetrazolium assay (MTT assay). The group of MCF‐7 cells showed the highest inhibition of cell growth after EVs treatment.
Morphological observation showed distinct responses between the two cancer cell lines. The addition of EV to WiDr cells showed a morphological change with a smaller cell shape and detached from the substrate of the treated cells, while the addition of EV to MCF‐7 cells showed the cell population was still attached to the substrate, and the morphology was observed similar to untreated cells, but less confluent (Figure 4).
FIGURE 4.
EV's treatment on colon and breast cancer cells after 48 h incubation. Above: Morphology of WiDr colon cancer cells. Bottom: Morphology of MCF‐7 breast cancer cells. (A) Untreated cells, (B) EV 1.25 μg/mL, (C) EV 2.5 μg/mL, (D) EV 5 μg/mL, (E) Doxorubicin 0.1 μg/mL.
Figure 5 presents a lower percentage of cell viability in these two cells than untreated cells (0 μg/mL), but higher than the cell's viability percentage of the treated control cell by doxorubicin. This is in line with the different cell morphology and population of untreated cells as a control.
FIGURE 5.
The percentage of cell viability after EVs treatment with different concentrations showed lower than untreated cells (without EVs treatment).
Level expression of apoptosis and proliferation marker on WiDR higher than the cells without treatment cells, concentration of 1.25 μg/mL showed better effect compared to concentration of 2.5 and 5 μg/mL, indicated by decreasing of BCl2 and increasing proliferation marker of BAX (Figure 6A), there was no statistically significant difference (p < 0.05). The apoptosis and proliferation marker expression above control in MCF‐7 cells, concentration of 2.5 μg/mL showed better effect compared to concentration of 1.25 and 5 μg/mL, indicated by decreasing of BCl2 and increasing proliferation marker of BAX (Figure 6B), there was no statistically significant difference (p < 0.05).
FIGURE 6.
Cell treatment by EV demonstrated different responses of the expression on apoptosis and proliferation markers based on the EV's concentration applied, there was no statistically significant difference. Mean ± SEM (p < 0.05), n = 3. (A) WiDr, (B) MCF‐7.
4. Discussion
Adipose stem cell isolation has minimal side effects because tissue collection is relatively non‐invasive, making clinical patient recovery easier. Mesenchymal stem cells derived from adipose tissue in M. fascicularis in this study have been successfully cultured and differentiated to be its lineage. This is in accordance with previous publications that white Adipose Tissue (WAT) was successfully generated and was able to meet the following three criteria: plastic adherence with spindle‐shaped fibroblast‐like morphology, having the expression of CD73, CD90, and CD105 genes, and the ability to differentiate into adipocytes, chondrocytes, and osteocytes [4]. Adipose tissue plays an important role in the process of adipogenesis and energy metabolism which are directly related to the pathogenesis of various degenerative and metabolic diseases, is one of the alternative sources with abundant MSCs and is easy to isolate and has a high distribution in the body [10].
In this study, EVs have been successfully isolated; the mRNA expression level of exosome markers was detected because EVs contain protein, nucleic acid, lipid, and exosome components that send signals to recipient cells that change their biological behavior.
The treatment of exosome on the Vero cells in this study was not demonstrating toxicity, and the percentage viability was higher than untreated cells and remained the morphology epithelial‐like. In contrast, EVs reduced viability in MCF‐7 and WiDR cell cancer, suggesting a selective inhibitory effect on cancer cells. The expression of molecular markers showed to promote proliferation of the cells and undergoing apoptosis and might also play an important role in tissue repair and to be able to play a role in regenerative medicine [11].
The protein composition of exosomes depends on the cellular source of the exosomes. Regardless of origin, several common proteins are also found in exosomes, including chaperone proteins, cytoskeletal proteins, and tetraspanins such as CD9, CD63, and CD81 [1]. Exosomes also contain a large number of small molecules that can be transferred from one cell to another and can easily communicate with target cells through receptor‐ligand interactions and patterns determined through components such as proteins, bioactive lipids, and RNA to induce biological effects [12].
Therefore, many studies have been conducted to demonstrate the role of exosomes in paracrine or endocrine and genetic processes. The information exchange between different cells in several studies has shown the potential contribution of human MSCs in tissue damage repair, including in the recovery period of various types of tissue injuries by mediating tissue repair through paracrine and trans differentiation mechanisms.
Exosomes have a contribution in several ways to the effectiveness of stem cell therapy, including cellular communication. It serves as messengers between cells, delivering signals that can stimulate cellular activities such as proliferation, differentiation, and migration. This communication is crucial for orchestrating the complex processes involved in tissue repair and regeneration [12], also modulate the immune response, creating an environment that is more conducive to tissue repair [13]. The capability to have anti‐cell death effects, protecting cells from programmed cell death, also provides the influence on the extracellular matrix and promotes the removal of cellular debris [14]. Exosomes derived from human umbilical cord MSCs have also been shown to alleviate CCl4‐induced liver fibrosis, improve skin wound healing, and improve acute kidney injury [15].
Cancer cells in this study showed the response of the EV's treatment that were expressed by the cell population decreased than untreated cells. Extracellular vesicle (EV) that includes the exosome are emerging as another mechanism of intercellular communication through the release or shedding of vesicles by secretory cells [16]. It is hypothesized the transport to the recipient cells exerted an influence upon recipient cell function in a juxtacrine and endocrine manner [17] as indicated in this study the EVs derived Ad MScs has a potency to decreased BCl2 and increased the BAX marker that were showed on mRNA level expression.
Exosomes can directly stimulate various types of target cells with membrane molecules or deliver their contents to target cells in response [18], it can be transported from their host cells to their destinations by the circulation and then localized in the target area through binding of membrane molecules to receptors on the surface of target cells for direct long‐distance communication [11]. The importance of exosomes as messengers for cell communication during cancer development, and they are successfully used for drugs and functional RNA in cancer treatment based on their natural delivery ability. In addition, more and more researchers have devoted their efforts to improving the capacity, specificity, and selectivity of exosome‐mediated nano delivery in recent years [13].
Many promising results have been obtained in vitro and in animal models. The use of exosomes to target cancer stem cells is considered one of the most promising approaches for cancer treatment. Exosomes are more biocompatible and biodegradable than synthetic nanoparticles and have low toxicity and immunogenicity. Although other cell‐derived exosomes are also biocompatible, they show heterogeneous morphology, size, and shape thus limiting their application for drug delivery [14].
Almost all cell types can produce exosomes, they are stable in biological fluids, and their small size allows them to more easily pass through lung clearance and cross the blood–brain barrier with high specificity in targeting cancer [15]. In addition, nanometric exosomes can accumulate in tumor tissues that contain abnormal blood vessels compared to normal tissues, so they can accumulate in solid tumors to increase the efficiency of drug delivery. In addition, exosomes can be engineered with tumor‐targeting proteins, peptides, or antibodies for specific drug and therapeutic nucleic acid delivery. These characteristics make exosomes an option as candidates for cancer therapy [14].
EV which containing exosomes have a potency in regenerative medicine, their ability to modulate cellular processes, regulate immune responses, and stimulate tissue repair positions them as valuable therapeutic agents, reducing the colon cancer cell invasion in vitro which indicated by increasing gene expression of CXCR3B [19]. As research in this field progresses, exosome‐based therapies hold the potential to revolutionize the treatment of various diseases and injuries, offering new hope for regenerative medicine [20].
Overall, EVs derived from Macaca fascicularis adipose mesenchymal stem cells demonstrate promising anticancer effects in vitro, potentially through the modulation of apoptosis and proliferation pathways. These findings suggest that EVs may serve as a potential cell‐free therapeutic strategy for cancer treatment while supporting ethical research practices.
5. Conclusions
EVs derived from MSCs in adipose tissue of M. fascicularis have the potential as in vitro model candidates in the development of breast and colon cancer therapies, while exosomes will be applied to non‐cancerous cells determining their potential as in vitro models for regenerative medicine.
Funding
This work was supported by the Indonesian Ministry of Education, Culture, Research and Technology's grant through the Fundamental Research‐National Competitive Research Regular (22042/IT3.D10/PT.01.03/P/B/2024).
Conflicts of Interest
The authors declare no conflicts of interest.
Acknowledgments
We thank the staff from the Animal Research Facility Lodaya, the Microbiology and Immunology Laboratory, and the Biotechnology Laboratory of the Primate Research Center, Bogor Agricultural University, for their contributions. This study was financially supported by the Indonesian Ministry of Education, Culture, Research and Technology through Fundamental Research‐National Competitive Research Regular 22042/IT3.D10/PT.01.03/P/B/2024.
Data Availability Statement
The data that supports the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.
References
- 1. Bunggulawa E. J., Wang W., Yin T., et al., “Recent Advancements in the Use of Exosomes as Drug Delivery Systems,” Journal of Nanobiotechnology 16 (2018): 81. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Bin Z., Li S., Hui S., et al., Research Article Exosomes From Human Umbilical Cord Mesenchymal Stem Cells: Identification, Purification, and Biological Characteristics (Hindawi Publishing Corporation, 2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Amelida R. N., Mariya S., Zaelani B. F. D., Yuliana, Dayana H., and Darusman H. S., “Ultracentrifugation Method for Exosome Isolation of HEK293 Cells as a Candidate Model In‐Vitro Therapy of Breast Cancer,” Biodiversitas 24, no. 9 (2023): 5074–5079. [Google Scholar]
- 4. Taopan H. H. M. S., Dewi F. N. A., Mariya S., et al., “Characterization of Mesenchymal Stem Cells From White Adipose Tissue of Macaca fascicularis ,” Jurnal Kedokteran Hewan 15, no. 4 (2021): 112–117, 10.21157/j.ked.hewan.v15i4.18203. [DOI] [Google Scholar]
- 5. Kumar D., Gupta D., Shankar S., and Srivastava R. K., “Biomolecular Characterization of Exosomes Released From Cancer Stem Cells: Possible Implications for Biomarkers and Treatment of Cancer,” Oncotarget 6 (2015): 3280–3291, 10.18632/oncotarget.2462. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Darusman H. S., Mariya S. S., Sari I. K., et al., “Spontaneous Expression of the Gene of KI67 and P53 in Cynomolgus Monkeys Infected With Papillomavirus,” Veterinary World 15 (2022): 962–967, 10.14202/vetworld.2022.962-967. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Lee Y. B., Lee D. H., Kim Y. C., and Bhang S. H., “Enhancing Skin Regeneration Efficacy of Human Dermal Fibroblasts Using Carboxymethyl Cellulose‐Coated Biodegradable Polymer,” Tissue Engineering and Regenerative Medicine 22, no. 4 (2025): 505–513, 10.1007/s13770-024-00681-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Hu Y., Li H., Li R., Tian Y., and Wu Z., “Protective Effects of Schisandrin B Against D‐GalN‐Induced Cell Apoptosis in Human Hepatocyte (L02) Cells via Modulating Bcl‐2 and Bax,” Bioengineered 12, no. 1 (2021): 7194–7203, 10.1080/21655979.2021.1979863. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Napitupulu F. I., Sulistiyani Sulistyani S., Prangdimurti E., and Wijaya C. H., “Inhibition of Colon Cancer Cells via Apoptosis Pathway by Ethanolic Extract of Andaliman (Zanthoxylum Acanthopodium Dc.) Fruits,” Current Research in Nutrition and Food Science Journal 10, no. 3 (2022): 1046–1057. [Google Scholar]
- 10. Si Z., Wanga X., Suna C., et al., “Adipose‐Derived Stem Cells: Sources, Potency, and Implications for Regenerative Therapies,” Biomedicine & Pharmacotherapy 114 (2019): 108765. [DOI] [PubMed] [Google Scholar]
- 11. Dai J., Yangzhou Su Y., Zhong S., et al., “Exosomes: Key Players in Cancer and Potential Therapeutic Strategy,” Signal Transduction and Targeted Therapy 5 (2020): 145, 10.1038/s41392-020-00261-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Sadeghi S., Tehrani F. R., Tahmaseb S., Shafee A., and Hashemi S. M., “Exosome Engineering in Cell Therapy and Drug Delivery,” Inflammopharmacology 31 (2023): 145–169, 10.1007/s10787-022-01115-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Haider K. H. and Aramini B., “Review Mircrining the Injured Heart With Stem Cell Derived Exosomes: An Emerging Strategy of Cell‐Free Therapy,” Stem Cell Research & Therapy 11 (2020): 23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Li T., Yan Y., Wang B., et al., “Exosomes Derived From Human Umbilical Cord Mesenchymal Stem Cells Alleviate Liver Fibrosis,” Stem Cells and Development 22, no. 6 (2013): 845–854. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Wang J., Zheng Y., and Zhao M., “Exosome‐Based Cancer Therapy: Implication for Targeting Cancer Stem Cells,” Frontiers in Pharmacology 7 (2017): 533, 10.3389/fphar.2016.00533. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Nederveen J. P., Warnier G., Di Carlo A., Nilsson M. I., and Tarnopolsky M. A., “Extracellular Vesicles and Exosomes: Insights From Exercise Science,” Frontiers in Physiology 11 (2021): 604274, 10.3389/fphys.2020.604274. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Nguyen V. V., Witwer K. W., Verhaar M. C., Strunk D., and van Balkom B. W., “Functional Assays to Assessthe Therapeutic Potential of Extracellular Vesicles,” Journal of Extracellular Vesicles 10 (2020): e12033, 10.1002/jev2.12033. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Colombo M., “Analysis of ESCRT Functions in Exosome Biogenesis, Com‐Position and Secretion Highlights the Heterogeneity of Extracellular Vesicles,” Journal of Cell Science 126 (2013): 5553–5565. [DOI] [PubMed] [Google Scholar]
- 19. Al‐Ozeir F. W., Mayasari N., Mariya S., Indriawati I., Dayana H., and Darusman H. S., “Anticancer Activity of Extracellular Vesicles Derived From Adipose Mesenchymal Stem Cells of Macaca fascicularis on WiDr Colon Cancer Cells,” Journal of Medical Primatology 55, no. 3 (2026): e70080, 10.1111/jmp.70080. [DOI] [PubMed] [Google Scholar]
- 20. Odehnalová N., Šandriková V., Hromadka R., et al., “The Potential of Exosomes in Regenerative Medicine and in the Diagnosis and Therapies of Neurodegenerative Diseases and Cancer,” Frontiers in Medicine 12 (2025): 1539714, 10.3389/fmed.2025.1539714. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data that supports the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.