Skip to main content
Molecular Genetics & Genomic Medicine logoLink to Molecular Genetics & Genomic Medicine
. 2026 Jul 9;14(7):e70270. doi: 10.1002/mgg3.70270

Prenatal Diagnosis and Functional Analysis of Two Compound Heterozygous Variants in the KLHL40 Gene Causing Nemaline Myopathy 8

Jianlong Zhuang 1,✉, Meiling Hong 2, Qiumei Huang 2, Yuying Jiang 1,✉, Junyu Wang 1,✉
PMCID: PMC13351305  PMID: 42427124

ABSTRACT

Background

Nemaline myopathy (NEM) is a rare congenital muscular disorder characterized by slow progression or static neuromuscular symptoms, which is mainly caused by variants in genes encoding the myofilament protein of skeletal muscle sarcomere. This study aimed to conduct prenatal diagnosis and functional analysis of variants in the KLHL40 gene causing NEM 8.

Methods

A Chinese family who experienced multiple pregnancies with recurrent prenatal ultrasound anomalies (such as clubfoot and polyhydramnios) and subsequent neonatal death was enrolled in this study. Etiology diagnosis was conducted using karyotype, chromosomal microarray analysis (CMA), and exome sequencing (ES). Quantitative real‐time reverse transcription polymerase chain reaction (qPCR) and western blotting were performed to investigate the transcription and expression levels of the defective gene. Hematoxylin–eosin (HE) stain and modified Gomori staining were used for further pathological examination.

Results

No chromosomal abnormalities were detected by karyotype and CMA in the proband of this family. However, the ES results revealed two compound heterozygous variants in KLHL40 gene NM_152393.4:c.[1516A> C p.(T506P)]; [1327G> A p.(G443S)] in the fetus. The c.1516A> C p.(T506P) variant was interpreted as pathogenic, whereas the p.G443S variant was rarely reported and classified as a variant of uncertain significance. Interestingly, the subsequent western blotting analysis elicited a significantly decreased expression level of KLHL40 protein in fetal skeletal muscle tissues compared with the controls. In addition, the HE and modified Gomori stains demonstrated nemaline bodies in the fetus using skeletal muscle tissue.

Conclusion

Combining prenatal ultrasound and ES testing increases diagnostic yield among NEM‐affected fetuses. Our results extend the mutational spectrum of the pathogenic KLHL40 variant c.1327G> A p.(G443S) linked to NEM8 and aid genotype–phenotype correlation analysis.

Keywords: exome sequencing, KLHL40, molecular diagnosis, nemaline myopathy 8, prenatal diagnosis


This finding may broaden the pathogenic variant of c.1327G> A in the KLHL40 gene causing NEM8 and clarify the genotype and phenotype correlation.

graphic file with name MGG3-14-e70270-g005.jpg

1. Introduction

Nemaline myopathies (NEM) are congenital muscular disorders that affect people worldwide and are characterized by muscle weakness and hypotonia. The condition is considered rare, with an incidence rate of approximately 1:50,000 (North et al. 1997). NEM has clinical heterogeneity with a broad phenotypic spectrum, ranging from severe neonatal presentations to milder childhood‐onset disease. Currently, the condition can be divided into six types: (i) severe nemaline myopathy, (ii) intermediate nemaline myopathy, (iii) typical (mainstream, classical) congenital nemaline myopathy, (iv) mild (childhood or juvenile) onset form, (v) adult‐onset forms, and (vi) other (unusual) forms (Sewry et al. 2019). To date, it is commonly known that NEM may be caused by pathogenic variants in over 12 genes (Sewry et al. 2019), including ACTA1, CFL2, KBTBD13, KLHL40, KLHL41, LMOD3, MYPN, NEB, TNNT1, TNNT3, TPM2, and TPM3.

Nemaline myopathy‐8 (NEM8) is a severe autosomal recessive muscle disorder caused by homozygous or compound heterozygous variants in the KLHL40 gene, which is typically characterized by fetal akinesia or hypokinesia, symptoms apparent at birth, such as contractures, fractures, respiratory failure, and swallowing difficulties (Ravenscroft et al. 2013). Deficiency KLHL40 expression results in significant reduction of leiomodin 3 and nebulin proteins, structural sarcomere irregularities, and a lethal loss of muscle function (Garg et al. 2014). The majority of diagnosed patients die in infancy, and most of the skeletal muscle biopsies conducted show a large number of nemaline bodies in muscle fibers (Ravenscroft et al. 2013). However, only a small number of patients have obvious abnormal myofibril (Ravenscroft et al. 2013).

In recent years, exome sequencing (ES) has been widely used in prenatal diagnosis due to its advantages in detecting pathogenic variants at the single gene level for fetal etiology diagnosis (Jelin and Vora 2018; Petrovski et al. 2019; Quinlan‐Jones et al. 2017; Tang et al. 2020; Yadava and Ashkinadze 2019). A study conducted by Lord et al. (Lord et al. 2019) enrolled a total of 610 fetuses with ultrasound structural abnormalities for ES detection, and after excluding karyotype abnormalities and copy number variants, the ES technology could effectively diagnose 52 subjects, increasing the standard diagnostic rate by 8.5%. Therefore, the potential of ES technology to explore the pathogenesis of fetal ultrasound structural abnormalities is of great value to the scholarly community and a phenomenon worthy of attention.

In the present study, ES was performed for prenatal genetic diagnosis of a fetus with structural ultrasonographic anomalies. Two compound heterozygous variants in the KLHL40 gene were identified, which were deemed the pathogenic drivers underlying NEM8 as well as the fetal ultrasound abnormalities. We further adopted multiple molecular characterization assays to elucidate the genotype–phenotype correlation in this affected fetus.

2. Material and Methods

2.1. Subjects

We herein report a Chinese family featuring three successive pregnancies affected by repeated prenatal ultrasound structural abnormalities, all resulting in neonatal demise (Figure 1A). The parents stated there was no consanguinity between them, and no hereditary diseases were noted in either side of the family. Clinical examination revealed unremarkable phenotypes in both parents. During her first pregnancy, polyhydramnios was diagnosed at 34 weeks of gestation. The woman delivered a preterm female infant with hand malformation, who died shortly after birth. Her second pregnancy was complicated by polyhydramnios detected at 32 weeks gestation; a preterm male infant with foot malformation was delivered and also succumbed soon after delivery. The third pregnancy resulted in an unremarkable full‐term male newborn without any evident congenital anomalies. In the fourth pregnancy, fetal polyhydramnios and clubfeet were identified prenatally, and the infant died shortly postnatally. No definitive genetic etiology was established to explain these three cases of neonatal demise.

FIGURE 1.

FIGURE 1

Prenatal ultrasound anomalies of the fetus and the clinical features after induced labour. (A): Pedigree genetic map of the enrolled family. The arrow indicates the proband. (B): Prenatal ultrasound examination results revealed a left clubfoot in the fetus. (C): A right clubfoot was also observed. (D): At the gestational age of 27+6 weeks, polyhydramnios was also detected by ultrasound. (E, F): Both clubfeet were also confirmed after induced labour at the third trimester pregnancy.

In the fifth pregnancy, structural fetal anomalies were visualized on prenatal ultrasound. The couple therefore consulted our Prenatal Diagnosis Center for genetic counseling. After a thorough review of the complete obstetric history and acquisition of written informed consent from the family, three prenatal genetic testing modalities were performed: karyotype analysis, chromosomal microarray analysis (CMA), and ES. This study was approved by the Ethics Committee of the Institutional Ethics Committee of Quanzhou Women's and Children's Hospital (2022No.69).

2.2. Karyotype Analysis and Chromosomal Microarray Analysis

Approximately, 10 mL of amniotic fluid (fetus) and 2 mL of peripheral blood (family members) were collected for karyotype analysis. Chromosome karyotype analysis was prepared using the automatic chromosome harvesting system Sinochrome Chromprep II (Lechen Biotechnology Co. Ltd., Shanghai, China) (Zhuang et al. 2019).

About 10 mL of amniotic fluid (fetus) and 3–5 mL of peripheral blood (family members) were collected for CMA, ES and the subsequent Sanger sequencing. Genomic DNA was extracted using a QIAamp DNA Blood Kit (QIAGEN, Germany) according to the manufacturer's protocol (www.qiagen.com). CMA was performed using a single‐nucleotide polymorphism‐based Affymetrix Cytoscan 750 K chip (Life Technologies, American) as previously reported (Zhuang et al. 2021).

2.3. Exome Sequencing

Genomic DNA was subjected to ES using the Illumina HiSeq 2500 platform (Illumina, San Diego, CA, USA), after DNA quantification, DNA shearing, library preparation of targeted regions, and sequencing libraries quantification (Zhuang et al. 2022).

Data analysis, including variant calling, annotation, and variant screening, was performed referring to the description of our previous study (Zhuang et al. 2022). After variant calling, annotation, and variant screening, the dbSNP, 1000 Genomes Project, Exome Aggregation Consortium, and Exome Variant Server databases were used for searching the minor allele frequencies (MAF < 0.1%) of all known variants. Following the ACMG guidelines (Richards et al. 2015), variants were classified as pathogenic, likely pathogenic, variants of unknown significance (VOUS), and likely benign or benign. Sanger sequencing was used to verify the variants detected by ES.

2.4. Quantitative Real‐Time PCR (qPCR) Analysis

Total RNA was extracted from the fetal skeletal muscle tissue and three age‐matched controls using the Trizol method. Subsequently, an ultraviolet spectrophotometer and agarose electrophoresis were used for RNA purity and quality detection. A SuperScriptIII First‐Strand Synthesis SuperMix test kit was used for cDNA synthesis and a Power SYBR Green PCR Master Mix kit was used for real‐time PCR (Bio‐Rad, USA). The target gene and internal control primer sequences are as follows: KLHL40‐F 5′‐GACTCGGTCATGTGCTACGA‐3′, KLHL40‐R 5′‐GTGTTGGCCATACACGTAA‐3′; GAPDH‐F 5′‐CCATGACACTTTGGTATCGTGGAA‐3′, GAPDH‐R 5′‐GGCCATCACGCCACAGTTTC‐3′. Then, the relative mRNA expression level of the KLHL40 gene was calculated using the 2−△△CT method.

2.5. Western Blotting Analysis

Total protein was extracted from the fetal skeletal muscle tissue and three age‐matched controls using the RIPA Buffer (89,900, Thermo Pierce) and qualified by BCA assay (P0010, Beyotime). After this procedure, 60 μg of total protein was loaded per lane on 8 ~ 12% SDS‐PAGE gels electrophoresis for about 2 h and transferred to polyvinylidene fluoride membranes (PVDF, Bio‐Rad). After the completion of the membranes transfer, we placed the PVDF in T‐TBS (containing 5% BSA) and sealed it at room temperature for 1 h. A primary antibody of KLHL40 (Thermo Fisher, PA5‐113673) was used to detect the KLHL40 protein with a 1:1000 diluted concentration. GAPDH was used as an internal control (Abcam, ab181602). Developing and fixing was performed according to operation procedure. Finally, Image J 1.8.0 image processing software was used to analyze the optical density of the detected bands.

2.6. Hematoxylin–Eosin (HE) Stain

The skeletal muscle tissue of the fetus with KLHL40 variants and the controls was fixed with 4% of paraformaldehyde and then embedded in paraffin. Conventional histological sections were prepared. After dewaxing and graded ethanol dehydration, HE staining was performed according to the manufacturer's protocol. After dehydration, clearing, and mounting with neutral balsam, the morphology was observed under a light microscope.

2.7. Modified Gomori Stain

The prepared sections were stained with prepared Weigert hematoxylin for 5–10 min, and rinsed with running water for 5–10 min. Over‐stained sections were differentiated in acid alcohol. The subsequent steps were presented as follows: (i) washing with distilled water 2–4 times; (ii) dyeing with Gomori stain solution for 20–40 min; (iii) washing with Gomori differentiation working solution for 30s‐90s. After dehydration, clearing, and mounting, the sections were examined under optical microscopy.

3. Results

3.1. Clinical Information

The most recent pregnancy of this family demonstrated a normal NT and serological screening results in the first and second trimesters. However, at the gestational age of 25 weeks, clubfeet were observed in the fetus using ultrasound examination (Figure 1B–D). In addition, polyhydramnios was identified at the gestational age of 27+6 weeks, which was similar to the clinical phenotypes of the previous pregnancies. After obtaining the written informed consent, the pregnant woman was recommended to undergo amniocentesis for prenatal diagnosis.

3.2. Genetic Analysis Results

After conducting karyotype and chromosomal microarray analyses, no chromosomal abnormalities were detected in the fetus nor the parents. Subsequently, ES technology was performed to investigate the sequence variants in the fetus. The ES detection result identified two compound heterozygous variants in the KLHL40 gene NM_152393.4:c.[1516A> C p.(T506P)];[1327G> A p.(G443S)] in the fetus and the results were further verified by Sanger sequencing (Figure 2). Trio‐ES detection outcomes revealed that the variants were inherited from parents, respectively. However, the proband's brother who had normal clinical conditions did not carry either of the variants (Figure 2) (PP1). The c.1516A> C p.(T506P) variant had a low frequency in normal populations (PM2_Supporting) and was reported as a hotspot variant among the Chinese population (PM3_Very Strong). The computer‐aided analysis predicted that the variant may affect the structure or function of the protein (PP3), which was interpreted as pathogenic according to the ACMG guidelines (PM3_Very Strong, PM2_Supporting, PP1, PP3). The c.1327G> A p.(G443S) variant also had a low frequency in normal populations (PM2_Supporting) and forming a compound heterozygous variants with c.1516A> C p.(T506P) (PM3). Following the ACMG guidelines, the c.1327G> A p.(G443S) variant was classified as VOUS (PM3, PM2_Supporting, PP1). Finally, the family chose to terminate the pregnancy (Figure 1E,F). In addition, no compound heterozygous or homozygous variants in other relevant genes were detected.

FIGURE 2.

FIGURE 2

Exome sequencing (ES) and Sanger sequencing results in the enrolled family. Sanger sequencing results indicated a c.1516A> C p.(T506P) variant compounded with c.1327G> A p.(G443S) variant in the proband, which were transmitted from the parents respectively. None of the variants of the KLHL40 gene were detected in the proband's brother.

3.3. Conservation Analysis and 3D Protein Structure Simulation

We further conducted a conservation analysis of the two variants detected in the KLHL40 gene and the results showed that both of the variants were highly conserved in different species (Figure 3A,B). In addition, we simulated the protein structure of two variants of KLHL40. As shown in Figure 3C,D, the number of hydrogen bonds changed from 2 to 3 after c.1327G> A p.(G443S). In contrast, the number of hydrogen bonds decreased from 3 to 2 after c.1516A> C p.(T506P) (Figure 3E,F).

FIGURE 3.

FIGURE 3

Conservation analysis and 3D structure prediction of the detected KLHL40 variants. (A, B): Conservation analysis of p.(G443S) and p.(T506P) showed a highly conserved state in different species. (C): Before the p.(G443S) variant, Gly443 and Cys434 had two hydrogen bond connections. (D): An additional hydrogen bond connection was observed between Gly443 and Trp442 after the p.(G443S) variant. (E): Before the p.(T506P) variant, Thr506 and Ile513/Val507 had three hydrogen bonds. (F): The hydrogen bond length 3.06 between Thr506 and Val507 disappeared.

3.4. Expression and Translation Levels of the KLHL40 Gene

In order to further analyze the impact of KLHL40 variants on gene expression and translation, the skeletal muscle tissues from the proband and three age‐matched controls were collected for qPCR and western blotting analysis. The results of qPCR showed a slight decrease in the level of KLHL40 mRNA in the mutant fetus compared with the controls, but with no statistically significant difference (Figure 4A). However, the outcomes of the western blotting analysis revealed a significant decrease in the levels of KLHL40 protein in the skeletal muscle tissue of the mutant fetus compared with the controls (Figure 4B,C and Figure S1).

FIGURE 4.

FIGURE 4

Expression and translation detection using qPCR and western blotting analysis. (A): The total mRNA was extracted from the mutant fetus and three age‐matched controls' muscle tissue for qPCR analysis, and the qPCR detection showed a slightly lower level of KLHL40 mRNA in the patient compared with the controls, while with no significant difference. (B): The total protein was extracted from the mutant fetus and three age‐matched controls' muscle tissue for western blotting analysis, a~69KDa band was detected using KLHL40 antibody, and the GAPDH protein was used as a control. (C): A significant decrease in KLHL40 protein was observed in the mutant fetus compared with the controls.

3.5. Pathological Examination Results

Pathological and genetic diagnosis is the gold standard for diagnosing NEM. In order to investigate whether there was a considerable number of muscle fiber changes and nemaline bodies in the proband, samples of fetal skeletal muscle tissue of the proband and the controls were collected for HE staining and modified Gomori staining. The HE staining results demonstrated that the shape and size of the muscle fibers in the control group were regular, but the features were significantly altered in the proband (Figure 5A,B). In addition, a small number of nemaline bodies were also observed, which were stained dark red. Subsequently, the modified Gomori stain results also confirmed the nemaline bodies in the muscle tissue of the proband (Figure 5C,D). Unfortunately, electron microscopy for further nemaline body verification was not available in this study.

FIGURE 5.

FIGURE 5

Pathological examination using HE staining and modified Gomori staining. Mutant fetal skeletal muscle tissue and the age‐matched controls were collected for HE staining (A, B) and modified Gomori staining (C, D). The arrows indicate the nemaline bodies. A, C: Control. B, D: Patient.

4. Discussion

Nemaline myopathy is a group of congenital myopathies first described by Shy et al. (Shy et al. 1963) in 1963. At least 12 genes have been reported to be associated with nemaline myopathy. NEM8 is typically a severe autosomal recessive disorder, commonly caused by the KLHL40 gene variants (Dofash et al. 2023; Ravenscroft et al. 2013). Most patients die during infancy, with an average age of 5 months. The KLHL40 gene is crucial for muscle production and the maintenance of skeletal muscle functions, so defects in this gene lead to sarcomere defects, followed by muscle dysfunction and early neonatal death (Garg et al. 2014). In this study, ES technology was performed for prenatal genetic diagnosis of a fetus with ultrasound structure abnormalities (e.g., clubfeet). Two compound heterozygous variants NM_152393.4:c.[1516A> C p.(T506P)]; [1327G> A p.(G443S)] in the KLHL40 gene were detected, which may be the cause of NEM8 and responsible for the fetal anomalies.

At present, few scholars have researched KLHL40‐related nemaline myopathy. Most of the patients reported in the available literature are from South China, and there is an estimated disease incidence of 2.47/100,000 in the region (Yi et al. 2021). Missense variants in KLHL40 are the most common variants that lead to NEM8, followed by frameshift and nonsense variants. Yeung et al. (Yeung et al. 2020) conducted a study with six patients with NEM8 from five unrelated Chinese families; all of them were carrying homozygous or compound heterozygous c.1516A> C p.(T506P) variants. The fetuses exhibited prenatal ultrasound anomalies including decreased fetal movement, excessive amniotic fluid, clubfeet, increased head circumference, and other anomalies. Similar studies conducted by the same research group have suggested that the c.1516A> C p.(T506P) variant is a hot spot pathogenic variant of KLHL40 in Southern China (Lee et al. 2019; Yeung et al. 2020). Complementarily, a recent study conducted by Yuan et al. (Yuan et al. 2022) enrolled five individuals from four unrelated Chinese families with NEM8, and their ES results revealed the presence of recurrent missense variants c.1516A> C p.(T506P) in the patients. In our study, a c.1516A> C p.(T506P) variant in the KLHL40 gene was also identified, which was classified as a pathogenic variant according to the ACMG guidelines and the reports in the literature.

In addition, an extremely rare c.1327G> A p.(G443S) variant of the KLHL40 gene was also identified in our study and further was classified as a VOUS. We have carefully examined the relevant literature and found only one report referring to the c.1327G> A p.(G443S) variant (Lee et al. 2019). It is noteworthy that its pathogenicity is still unclear. In order to further clarify these relevant details and amplify the knowledge of genotype and phenotype correlations, we performed qPCR and western blotting analysis to investigate the expression and translation levels of KLHL40. The experimental results demonstrated that the KLHL40 protein levels in the fetus were downregulated. However, no statistical difference was observed in the KLHL40 mRNA between positive and controls, which may be due to the limited number of test samples.

The diagnosis of nemaline myopathies was based on pathological and genetic detection. The characteristic pathological change is the deposition of a large number of nemaline bodies in muscle fibers (Liu et al. 2022; Ravenscroft et al. 2013). Our study further used HE staining and modified Gomori staining to clarify the morphology of muscle fibers in the proband and identify the nemaline bodies in muscle fibers. Interestingly, there are not a large number of nemaline bodies identified in the fetal muscle fibers of the present fetus, with only a small amount of nemaline bodies identified. Notably, in a previous study (Lee et al. 2019) that reported the same variant of c.1327G> A p.(G443S) in KLHL40, no definite nemaline bodies were identified. Although only a small amount of nemaline bodies was present in the patient's muscle fibers, our study further adds to the pathogenic evidence of the rare c.1327G> A p.(G443S) variant in the KLHL40 gene.

Therefore, according to the results presented here, we believe that the rare c.1327G> A p.(G443S) variant could be interpreted as a likely pathogenic variant that would explain fetal ultrasound abnormalities and recurrent neonatal death in the present family. However, more work needs to be done to confirm the existence of nemaline bodies in the patient, such as the application of electron microscopy. Notably, this study lacks functional validation via cellular and animal models, and follow‐up investigations will be required to fully elucidate the underlying molecular mechanisms.

In our study, NEM8 was diagnosed in a fetus based on pathological and genetic detection. Combining the use of prenatal ultrasound and ES detection can effectively diagnose fetuses with NEM and reduce the occurrence of birth defects. Our findings may broaden the pathogenic variant of c.1327G> A p.(G443S) in the KLHL40 gene causing NEM8 and clarify the genotype and phenotype correlation. In addition, our study further strengthened the application value of ES in etiological diagnosis of fetuses with congenital myopathy diseases and facilitated genetic counselling for patients with NEM8.

Author Contributions

J.Z. designed and wrote the manuscript; M.H. and Q.H. performed the H.E. and modified Gomori stain; Y.J. recruited the participants and conducted clinical counseling; J.W., Y.J., and J.Z. revised and polished the paper. All authors have approved the final version of the article.

Funding

This work was supported by Huaqiao University Joint of Hospital and University Innovation Project, 2022YX004.

Ethics Statement

This study was approved by the Ethics Committee of the Institutional Ethics Committee of Quanzhou Women's and Children's Hospital (2022No.69). We received informed consent from the study participants, and they agreed to the publication of the results. All procedures performed involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki Declaration and its later amendments or comparable ethical standards.

Consent

We confirm that written informed consent was signed by the patient's parents for publishing their own and their children's genetic data and relevant information, and the written informed consent is available for request.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Fig S1: Uncropped original western blot image for the target proteins.

Full‐length raw western blot image film without cropping or brightness adjustment is provided to verify the authenticity of immunoblotting results.

Acknowledgments

We express our appreciation to the patient and other subjects who participated in our study. We also wish to express our gratitude to Huaqiao University for the funds provided for this work.

Contributor Information

Jianlong Zhuang, Email: 415913261@qq.com.

Yuying Jiang, Email: 1287194067@qq.com.

Junyu Wang, Email: 86813685@qq.com.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

References

  1. Dofash, L. N. H. , Monahan G. V., Servián‐Morilla E., et al. 2023. “A KLHL40 3' UTR Splice‐Altering Variant Causes Milder NEM8, an Under‐Appreciated Disease Mechanism.” Human Molecular Genetics 32: 1127–1136. [DOI] [PubMed] [Google Scholar]
  2. Garg, A. , O'Rourke J., Long C., et al. 2014. “KLHL40 Deficiency Destabilizes Thin Filament Proteins and Promotes Nemaline Myopathy.” Journal of Clinical Investigation 124: 3529–3539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Jelin, A. C. , and Vora N.. 2018. “Whole Exome Sequencing: Applications in Prenatal Genetics.” Obstetrics and Gynecology Clinics of North America 45: 69–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Lee, H. H. , Wong S., Leung F. Y., et al. 2019. “Founder Mutation c.1516A> C in KLHL40 Is a Frequent Cause of Nemaline Myopathy With Hyponatremia in Ethnic Chinese.” Journal of Neuropathology and Experimental Neurology 78: 854–864. [DOI] [PubMed] [Google Scholar]
  5. Liu, D. , Yu J., Wang X., et al. 2022. “Case Report: Prenatal Diagnosis of Nemaline Myopathy.” Frontiers in Pediatrics 10: 937668. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Lord, J. , DJ M. M., Eberhardt R. Y., et al. 2019. “Prenatal Exome Sequencing Analysis in Fetal Structural Anomalies Detected by Ultrasonography (PAGE): A Cohort Study.” Lancet 393: 747–757. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. North, K. N. , Laing N. G., and Wallgren‐Pettersson C.. 1997. “Nemaline Myopathy: Current Concepts. The ENMC International Consortium and Nemaline Myopathy.” Journal of Medical Genetics 34, no. 9: 705–713. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Petrovski, S. , Aggarwal V., Giordano J. L., et al. 2019. “Whole‐Exome Sequencing in the Evaluation of Fetal Structural Anomalies: A Prospective Cohort Study.” Lancet 393: 758–767. [DOI] [PubMed] [Google Scholar]
  9. Quinlan‐Jones, E. , Hillman S. C., Kilby M. D., and Greenfield S. M.. 2017. “Parental Experiences of Prenatal Whole Exome Sequencing (WES) in Cases of Ultrasound Diagnosed Fetal Structural Anomaly.” Prenatal Diagnosis 37: 1225–1231. [DOI] [PubMed] [Google Scholar]
  10. Ravenscroft, G. , Miyatake S., Lehtokari V. L., et al. 2013. “Mutations in KLHL40 Are a Frequent Cause of Severe Autosomal‐Recessive Nemaline Myopathy.” American Journal of Human Genetics 93: 6–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Richards, S. , Aziz N., Bale S., et al. 2015. “Standards and Guidelines for the Interpretation of Sequence Variants: A Joint Consensus Recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology.” Genetics in Medicine 17: 405–424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Sewry, C. A. , Laitila J. M., and Wallgren‐Pettersson C.. 2019. “Nemaline Myopathies: A Current View.” Journal of Muscle Research and Cell Motility 40: 111–126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Shy, G. M. , Engel W. K., Somers J. E., and Wanko T.. 1963. “NEMALINE Myopathy. A New Congenital Myopathy.” Brain 86: 793–810. [DOI] [PubMed] [Google Scholar]
  14. Tang, J. , Zhou C., Shi H., et al. 2020. “Prenatal Diagnosis of Skeletal Dysplasias Using Whole Exome Sequencing in China.” Clinica Chimica Acta 507: 187–193. [DOI] [PubMed] [Google Scholar]
  15. Yadava, S. M. , and Ashkinadze E.. 2019. “Whole Exome Sequencing for Prenatal Diagnosis in Cases With Fetal Anomalies: Criteria to Improve Diagnostic Yield.” Journal of Genetic Counseling 28: 251–255. [DOI] [PubMed] [Google Scholar]
  16. Yeung, K. S. , Yu F. N. Y., Fung C. W., et al. 2020. “The KLHL40 c.1516A> C Is a Chinese‐Specific Founder Mutation Causing Nemaline Myopathy 8: Report of Six Patients With Pre‐ and Postnatal Phenotypes.” Molecular Genetics & Genomic Medicine 8: e1229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Yi, S. , Zhang Y., Qin Z., et al. 2021. “A Novel and Recurrent KLHL40 Pathogenic Variants in a Chinese Family of Multiple Affected Neonates With Nemaline Myopathy 8.” Molecular Genetics & Genomic Medicine 9: e1683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Yuan, H. , Wang Q., Zeng X., et al. 2022. “Clinical and Molecular Analysis of Four Unrelated Chinese Families With Pathogenic KLHL40 Variants Causing Nemaline Myopathy 8.” Orphanet Journal of Rare Diseases 17: 149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Zhuang, J. , Chen C., Chen Y., et al. 2022. “Identification of a Rare Variant of c.1777G> A (p.G593S) in the COL1A1 Gene as the Etiology of Recurrent Osteogenesis Imperfecta by Whole‐Exome Sequencing.” Frontiers in Pediatrics 10: 816090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Zhuang, J. , Chen C., Jiang Y., et al. 2021. “Application of the BACs‐On‐Beads Assay for the Prenatal Diagnosis of Chromosomal Abnormalities in Quanzhou, China.” BMC Pregnancy and Childbirth 21: 94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Zhuang, J. , Wang Y., Zeng S., Lv C., Lin Y., and Jiang Y.. 2019. “A Prenatal Diagnosis and Genetics Study of Five Pedigrees in the Chinese Population With Xp22.31 Microduplication.” Molecular Cytogenetics 12: 50. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Fig S1: Uncropped original western blot image for the target proteins.

Full‐length raw western blot image film without cropping or brightness adjustment is provided to verify the authenticity of immunoblotting results.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.


Articles from Molecular Genetics & Genomic Medicine are provided here courtesy of Blackwell Publishing

RESOURCES