Effect of TEA domain transcription factor 1 (TEAD1) on the differentiation of intramuscular preadipocytes in goats

Abstract

TEA domain transcription factor 1 (TEAD1), also called TEF-1, acts as a transcriptional enhancer to regulate muscle-specific gene expression. However, the role of TEAD1 in regulating intramuscular preadipocyte differentiation in goats is unclear. The aim of this study was to obtain the sequence of TEAD1 gene and elucidate the effect of TEAD1 on goat intramuscular preadipocyte differentiation in vitro and its possible mechanism. The results showed that the goat TEAD1 gene CDS region sequence was 1311 bp. TEAD1 gene was widely expressed in goat tissues, with the highest expression in brachial triceps (p < 0.01). The expression of TEAD1 gene in goat intramuscular adipocytes at 72 h was extremely significantly higher than that at 0 h (p < 0.01). Overexpression of goat TEAD1 inhibited the accumulation of lipid droplets in goat intramuscular adipocyte. The relative expression of differentiation marker genes SREBP1, PPARγ, C/EBPβ were significantly down-regulated (all p < 0.01), but PREF-1 was significantly up-regulated (p < 0.01). Binding analysis showed that there were multiple binding sites between the DNA binding domain of goat TEAD1 and the promoter binding region of SREBP1, PPARγ, C/EBPβ and PREF-1. In conclusion, TEAD1 negatively regulates the differentiation of goat intramuscular preadipocytes.

Introduction

It is well known that lamb is popular because it is rich in nutrients such as protein, vitamin B12, essential amino acids and essential fatty acids, etc.¹ Recent survey shows that people prefer lamb that is rich in intramuscular fat.² According to researchers, increasing the intramuscular fat (IMF) content can lead to more significant positive changes in many vital traits, such as juiciness, taste, and flavor of meat products.^3,4 IMF content in goats is influenced by various factors such as breed, age and nutrition of the diet. At the molecular level, IMF content is controlled by a complex network of transcription factors, representative of which are peroxisome proliferator-activated receptor gamma (PPARγ), sterol-regulatory element binding proteins 1 (SREBP1) and CCAAT/Enhancer binding protein beta (C/EBPβ), preadipocyte factor 1 (PREF-1), etc.⁵ Therefore, finding the key genes controlling intramuscular fat deposition is of great importance to deeply explore lamb quality traits.

The TEA domain family has four homologous TEAD family members including TEAD1, TEAD2, TEAD3, TEAD4 in mammals. Each gene has a unique expression pattern⁶ and plays an important role in growth, development, cell regeneration and tissue dynamic homeostasis.⁷ Among them, TEAD1, located on chromosome 11p15, was also known as TEF-1 that functions as a transcriptional enhancer of its own.⁸ TEAD1 binds to the SV40 enhancer and activates transcriptional nuclear proteins, which is the first TEAD family member to be identified.⁹ It has been shown that there is a close association between TEAD1 and cell proliferation, especially in cancer cells.^10,11 Recently, Zhao et al.¹² found that TEAD1 as a target gene of ss-miR-17-3p in pig fat to regulate fat deposition. In our laboratory, we discovered that the TEAD1 gene was differentially expressed in intramuscular adipocytes of goat before and after differentiation using RNA-seq. Whether TEAD1 gene is involved in regulating intramuscular adipogenesis remains unclear.

Currently, the goat TEAD1 gene only has predicted sequences in the National Center for Biotechnology Information (NCBI) database (https://www.ncbi.nlm.nih.gov/genbank/), and its biological characteristics are unknown, which is not conducive to the in-depth investigation and analysis of its function. In this study, intramuscular preadipocytes from Jianzhou Daer goats was used to explore the sequence, biological characteristics and function of TEAD1 gene.

Materials and methods

Ethics statement

Animal studies were approved by the Institutional Animal Care and Use Committee, Southwest Minzu University, Chengdu, Sichuan, China.

Samples collecting

Eight health one week of age and two health two days of age female Jianzhou Daer goatsfrom the Da Geda breeding base (Janyang City, Sichuan Province). After 24 h of fasting, goat body was cleaned with 75% alcohol. For one week of age goats, abdominal fat, triceps brachii, longissimus dorsi, large intestine, small intestine, biceps femoris, subcutaneous fat, kidney, heart, liver, lung and spleen were sampled, treated with diethy pyrocarbonate water (Sigma, St Louis, USA) and stored at −80 °C. Above, various tissues were used for tissue expression assays. Longissimus dorsi from two days of age goat was used for cell isolation.

Cell culture

The clipped longissimus dorsi were washed in PBS. An equal amount of type II collagenase (Sigma, St Louis, USA) was added to the longissimus dorsi muscle mass and digested in a water bath at 37 °C for 90 minutes. Terminate the digestion by adding an equal volume of DMEM/F12 (Gibco, Carlsbad, CA, USA). The digested cells were filtered through a 200 and 400 mesh cell sieve, centrifuged at 2000 r·min⁻¹ for 5 min. The supernatant was discarded and complete medium was added for resuspension. Inoculation in a 100 mm dish, placed in a constant temperature incubator at 37 °C with 5% CO₂. Because of the principle of differential apposition, the cells in the culture dish are primary intramuscular adipocytes after 2 h of culture and fluid change. Primary intramuscular adipocytes were uniformly added to DMEM/F12 medium containing 10% fetal bovine serum and 0.1% penicillin/streptomycin (All from Gibco, Carlsbad, CA, USA). Cell differentiation were induced by 50 µmol/L oleic acid (Sigma, St Louis, USA).

Cloning and sequence of the goat gene TEAD1

The predicted sequence of goat TEAD1 gene (XM_018059575) was found in NCBI. Primer Premier5.0 software was used to design the primers (Table 1). Then, sent the primers with good specificity to Shanghai Bioengineering Co., Ltd. Polymerase chain reaction (PCR) assay was used to amplify the target gene. The amplified samples were subjected to 2% agarose gel electrophoresis assay, an agarose gel DNA recovery kit (TSINGKE, Beijing, China) obtained gel bands of the target length. Then, the pMD-19T Vector (TaKaRa, Dalian, China) was mixed with the obtained product and ligated at 16 °C for 2 h. Later, transformed into 50 µL of competent E. coli DH5ɑ cells. Finally, positive colonies were picked and bidirectional DNA sequence was performed. Goat TEAD1 bioinformatics analysis, see Table S1.

Table 1.

Primers information.

Gene name	Sequence（5′→3′）	TM/°C	Product length/bp	Purpose
TEAD1	S:GGAAAATCCAACCGCCAA A:GAAAAATCGGGGTGACCTC	57	1508	PCR
TEAD1	S:CACAACCAAACTTCGCCTG A:GTAAGAATGGTTGGCGTGC	57	112	RT-qPCR
TEAD1	S:CCCAAGCTTATGGAAAGGATG AGTGACTCTG A:CCGCTCGAGTTAGTCCTTTAC AAGCCTGTAAAT	57	1311	PCR
UXT	S:GCAAGTGGATTTGGGCTGTAAC A:ATGGAGTCCTTGGTGAGGTTGT	60	173	RT-qPCR
TBP	S:AACAGCCTCCCACCTTATGC A:TGCTGCTCCTCCAAAATAGAC	60	155	RT-qPCR
C/EBPα	S:CCGTGGACAAGAACAGCAAC A:AGGCGGTCATTGTCACTGGT	58	142	RT-qPCR
C/EBPβ	S:CAAGAAGACGGTGGACAAGC A:AACAAGTTCCGCAGGGTG	66	204	RT-qPCR
PPARγ	S:AAGCGTCAGGGTTCCACTATG A:GAACCTGATGGCGTTATGAGAC	60	197	RT-qPCR
SREBP1	S:AAGTGGTGGGCCTCTCTGA A:GCAGGGGTTTCTCGGACT	58	127	RT-qPCR
PREF-1	S:CCGGCTTCATGGATAAGACCT A:GCCTCGCACTTGTTGAGGAA	65	178	RT-qPCR

Note: S. sense primer; A: antisense primer.

Construction of the overexpression plasmids

The restriction site of CDS region (1311 bp) of goat TEAD1 gene was identified by BioXM2.6 software. Suitable enzyme cut sites (Hind III, Xho I, TaKaRa, Dalian, China) were selected according to pcDNA3.1 vector. The recombinant pcDNA3.1-TEAD1 plasmid was obtained by double digestion test, and the reaction system is shown in the Tables 2 and 3. The recombinant pcDNA3.1-TEAD1 plasmid was digested (Table 4) and detected by electrophoresis. All the plasmids were extracted by mini plasmid extraction kit (TIANGEN, Beijing, China) and stored at 4 °C.

Table 2.

Reaction system of PCR.

Basic physical and chemical properties	Volume（µL）
pcDNA3.1/TEAD1(1 μg/μL)	1
Hind III, Xho I	1
Buffer	2
ddH2O	To 20

37 °C, 30 min, metal bath.

Table 3.

Reaction system of PCR.

Basic physical and chemical properties	Volume（µL）
pcDNA3.1(1 μg/μL)	1
TEAD1(1 μg/μL)	3
T4 ligase	1
T4 buffer	1
ddH2O	To 10

16 °C, 12 h, metal bath.

Table 4.

Reaction system of PCR.

Basic physical and chemical properties	Volume（µL）
pcDNA3.1-TEAD1(1 μg/μL)	1
Hind III, Xho I	1
Buffer	2
ddH2O	To 20

37 °C, 30 min, metal bath.

Cell transfection

The third generation intramuscular preadipocytes were inoculated in 12-well cell plates, respectively. Cells were transfected according to lipofectamine™ 3000 reagent kit (Thermo, Waltham, USA) when the growing cells are about 70% confluent. Cell differentiation was induced after 48 h. The experiment was set up with pcDNA 3.1-TEAD1 overexpression group (OE-TEAD1) and pcDNA3.1 negative control group (NC).

RNA extraction and quantitative real-time PCR

In this experiment, RNA of tissues and intramuscular preadipocytes was extracted using Trizol (TaKaRa, Dalian, China). The corresponding cDNA was obtained using RevertAid First Strand cDNA synthesis kit (Thermo, Waltham, USA) according to the instructions. SYBR Green PCR Master Mix (TaKaRa, Dalian, China) for RT-qPCR, with TBP and UXT as internal reference genes.¹³ The relevant primers are shown in Table 1.

Oil red O and Bodipy staining

PBS was used to wash the intramuscular adipocytes in 12-well cell plates. 300 µL of 10% formaldehyde solution (Beyotime, Shanghai, China) was used to fix the cells for 30 min. PBS was washed three times. The cells were stained with 200 µL Oil red O or Bodipy reagent for 25 min. After washing away excess staining reagent with PBS, the lipid droplets were observed under the microscope. 1 mL of isopropyl alcohol to dissolve Oil red O. In 96-well plates, cells were quantified by microplate reader at 490 nm.

Statistical analysis

All experiments in our study were repeated three times. One-way ANOVA in SPSS17 software was selected for expression significance analysis (differences were considered statistically significant when p < 0.05. All data were presented as ‘means ± SD’. The results were graphed using GraphPad Prism5.0 software. Image J software to quantify the fluorescence intensity.

Results

Cloning and sequence analysis of goat TEAD1 gene

The cDNA of longissimus dorsi Jianzhou Daer goats was used as PCR template for amplification (Fig. 1A). This 1508 bp gene fragment including 1311 bp CDS region, which consisting of 380 Adenine, 293 Thymine, 321 Cytosine and 317 Guanine (Fig. 1B). The GenBank accession number of the goat TEAD1 gene: ON979536.

Figure 1.

Cloning of TEAD1 in goat. (A) Amplification of TEAD1 gene in Capra hircus, M: DL2000 DNA Marker; 1: TEAD1 gene. (B) The nucleotide composition of TEAD1 gene in goat.

Bioinformatics analysis

Goat TEAD1 encodes a total of 436 amino acids (Fig. 2A), of which the highest percentage of serine was 7.9%. There were 12 potential serine phosphorylation sites, 6 potential threonine phosphorylation sites and 22 potential tyrosine phosphorylation sites in goat TEAD1 (Fig. 2B). Other basic physicochemical properties of goat TEAD1 were shown in Table 5.

Figure 2.

Basic physicochemical properties of goat TEAD1. (A) Amino acid composition of TEAD1 in goat. (B) Prediction of phosphorylation site of TEAD1 in goat.

Table 5.

Basic physicochemical properties of goat TEAD1.

Basic physical and chemical properties	Forecast result
Formula	C2189H3436N612O636S20
Molecular weight/ku	49144.28
Instability index	46.62
O-glycosylation site	21
N-glycosylation site	None
Aliphatic index	76.06
Grand average of hydropathicity	−0.411
Transmembrane helices in proteins	None
Signal peptide	None

Using ExPASy to predict the secondary structure of goat TEAD1 protein (Fig. 3A). TEAD1 protein consists mainly of a random coil formed by 206 amino acids (47.25%), an α-helix formed by 159 amino acids (36.47%), an extended chain formed by 56 amino acids (12.84%) and a β- (3.44%). This is consistent with the tertiary structure prediction (Fig. 3B). Protein interactions predicted that goat TEAD1 may interact with YAP1, VGLL4, VGLL3, VGLL2 and other proteins (Fig. 3C). Subcellular localization revealed that TEAD1 was mainly distributed in the nucleus (73.90%), followed by mitochondria (17.40%) and cytoplasm (8.70%, Fig. 3D).

Figure 3.

Structural analysis of goat TEAD1 protein. (A) Prediction of TEAD1 protein secondary structure in goat. (B) Goat TEAD1 protein tertiary structure. (C) Interaction analysis in TEAD1 protein of goat. (D) Prediction of subcellular localization of the goat TEAD1 protein.

Goat TEAD1 homology and phylogenetic tree analysis

Goat TEAD1 was in the same branch as cattle and had the most distant affinity with bats. Consistent with the pattern of evolutionary distribution among species (Fig. 4A). The TEAD1 protein had high similarity among species and subtle differences, indicating species specificity (Fig. 4B).

Figure 4.

Comparison of amino acid homology of goat TEAD1 and its phylogenetic trees with Neighbor-joining method. (A) Phylogenetic tree of TEAD1 of various species, ★is the target gene and the referenced sequences are all from the GenBank database. (B) Similarity of TEAD1 protein between different species.

Goat TEAD1 tissue and cellular time series expression analysis

Goat TEAD1 was expressed in all 12 tissues, with the least expression in lung and the highest expression in brachial triceps (p < 0.01, Fig. 5A). The relative expression level of this gene generally showed an increasing trend during the differentiation of goat intramuscular precursor adipocytes. The expression level was higher after 36 h of induction of differentiation than before. The highest expression level was at 72 h, which was extremely significantly higher than that before differentiation (p < 0.01, Fig. 5B).

Figure 5.

Tissue and time-series expression profiles of TEAD1 in goat. (A) Tissue expression profiles of TEAD1 in goat. (B) Relative expression level of TEAD1 during the differentiation of intramuscular preadipocytes in goat. Different lowercase letters indicate extremely significant difference (p < 0.01).

Effect of overexpression of goat TEAD1 on the differentiation of intramuscular adipocytes

Overexpression vector construction and efficiency assay

Two bands matching the length of TEAD1 (1311 bp) and pcDNA3.1 (5427 bp) appeared in the agarose gel electrophoresis map (Fig. 6A). Goat TEAD1 gene sequence proved to be sequenced by the company. After cell experiment, the RT-qPCR assay revealed that TEAD1 was successfully overexpressed with an efficiency of 332-fold (p < 0.01, Fig. 6B).

Figure 6.

Construction of TEAD1 overexpression vector and the expression efficiency in goat subcutaneous adipocytes. (A) Digestion identification of PcDNA3.1-TEAD1, M: DL2000 DNA Marker; 1: pcDNA3.1 and TEAD1. (B) The overexpression efficiency of TEAD1 gene, NC: negative control, OE-TEAD1: PcDNA3.1-TEAD1; **p < 0.01.

Detection of morphological and molecular level results

Overexpression of TEAD1, lipid droplet aggregation was significantly reduced (Fig. 7A–C). The expression of SREBP1, PPARγ and C/EBPβ were lower (all p < 0.01), but PREF-1 was higher (p < 0.01, Fig. 8A). Prediction of the DNA binding domain of TEAD1 revealed multiple binding sites in the promoter binding region of this binding domain to SREBP1, PPARγ, C/EBPβ, and PREF-1 (Fig. 8B–C).

Figure 7.

Morphological analysis of intramuscular preadipocytes after overexpression of TEAD1. (A) Oil red O (up figure, 200×) and Bodipy staining analysis (down figure, 200×). (B) The OD_490 nm value as detected by Oil red O staining. (C) The relative fluorescence intensity as detected by Bodipy staining. NC: negative control, OE-TEAD1: PcDNA3.1-TEAD1; *p < 0.05; **p < 0.01.

Figure 8.

Analysis of the role of goat TEAD1 in regulating the differentiation of intramuscular preadipocytes. (A) Detection of differentiation marker genes. NC: negative control, OE-TEAD1: PcDNA3.1-TEAD1; **p < 0.01. (B) Prediction of TEAD1 DNA binding motif. (C) Prediction of TEAD1 binding sites with genes promoter.

Discussion

This study used TEAD1, a differential gene before and after differentiation of goat intramuscular adipocytes screened in the pre-laboratory, as an entry point. TEAD1 has been shown to have a wide range of biological functions, such as being a nuclear effector of oncogenic signalling pathways (including Hippo, WNT, TGF-β, and EGFR pathways interacting with various cancer genes) in humans and mice,¹⁴ regulating muscle development,¹⁵ and participating in the process of lipogenic differentiation,¹⁶ among others. To clarify the regulatory role of TEAD1 on intramuscular adipocyte differentiation in goats, the sequence of TEAD1 gene was obtained by PCR and bioinformatics analysis was performed in this study.

In this study, we found that goat TEAD1 is a non-secretory protein without signal peptide and transmembrane structure, which is consistent with the results of subcellular localization of the protein. It is mostly shown to function in the nucleus. TEAD1 has 40 amino acid phosphorylation sites including 22 tyrosine phosphorylation sites and 12 serine phosphorylation sites, which contribute to the expression of TEAD1 activity, and this result is consistent with the study of Ardito et al.¹⁷ In addition, the protein interaction results revealed that TEAD1 may interact with YAP1, VGLL4, VGLL3 and other proteins. By using transgenic mice, LIU-CHITTENDEN et al.¹⁸ found that TEAD1 deletion as a dominant negative expression of its DNA binding structural domain was able to suppress hepatomegaly and hepatocellular carcinoma induced by YAP overexpression. Secondly, YAP was found to be involved in metabolic regulation, such as glycolysis and adipogenesis. Liu et al.¹⁹ found that hypo-MSC promoted adipogenesis in HCC cells through YAP and SREBP1, upregulated key adipogenic enzymes. This study also found that YAP could activate AKT/mTOR signalling, which subsequently activates SREBP1 expression and promotes adipogenesis. Proteomic analysis confirmed that C/EBP2 interacts with the YAP/TAZ/TEAD complex to promote YAP/TAZ/TEAD dependent transcription.²⁰ In addition, Zhang et al.²¹ reported a novel function of TEADs that can act as default blockers during adipogenesis by recruiting VGLL4 and CtBP2 to form a transcriptional blocking complex while being expressed independently of YAP activity, i.e., TEAD inhibits lipogenesis by directly targeting lipogenic factors. Figeac et al.²² found that VGLL3 is expressed at low levels in healthy muscle, but increased expression during muscle hypertrophy and muscle regeneration. Interaction proteomics showed that VGLL3 binds TEAD1, TEAD3 and TEAD4 in myogenic cells or myotubes, so it is hypothesized that TEAD1 has a regulatory role in the proliferation and differentiation of myogenic cells. These findings above suggest that TEAD1 may play a critical and complex role in the cellular myogenesis and lipogenesis processes.

Gene expression analysis in different tissues is a method to study molecular regulation, which provides important information for understanding the function of that gene. The tissue expression profile of TEAD1 gene in goats constructed in this study showed that it was expressed in the inter-abdominal fat, triceps brachii and longest dorsal muscle of goats, but the expression levels were higher in triceps brachii and longest dorsal muscle and lower in small intestine and lung, indicating that the expression of TEAD1 was higher in the limbs, which is consistent with Joshi,²³ who found that both TEAD1 and TEAD4 are co-expressed and co-localized in somites. In contrast, Minhao Yu.¹¹ found that higher levels of TEAD1 expression in human colon cancer which promotes proliferation of cancer cells and suggests poor prognosis. This is different from the low expression of large intestine and small intestine in the results of this study, presumably with species-specific tissue expression of this gene. There were significant or highly significant differences in TEAD1 expression among tissues in goats. This is differences may suggest that TEAD1 is functionally related in different tissues or related to the way it is regulated in different tissues. Combined with the results of the species sequence comparison in this experiment, the expression of TEAD1 gene was shown to be species-specific. In order to clarify whether TEAD1 has a regulatory effect on intramuscular precursor adipocyte differentiation in goats. It is necessary to first determine whether this gene is consistently expressed at different stages of intra-muscular adipocyte differentiation. We constructed its cellular temporal expression profile and determined that the gene is consistently expressed during intramuscular fat differentiation in goats. Then combined with the results of pre-transcriptome sequencing in the laboratory, it is hypothesized that TEAD1 may be an important regulator of intra-muscular precursor adipocyte differentiation in goats.

To finally reveal the regulatory role of goat TEAD1 on intramuscular adipocyte differentiation, this study revealed that overexpression of the goat TEAD1 gene was followed by oil red O and Bobipy staining showing reduced lipid droplet accumulation in intramuscular adipocytes and highly significant changes in the expression of key adipocyte differentiation genes, including highly significantly down-regulated SREBP1, C/EBPβ, PPARγ and highly significantly up-regulated PREF-1. The DNA binding domain of TEAD1 and the promoter binding regions of SREBP1, PPARγ, C/EBPβ and PREF-1 were further predicted by JASPAR and NCBI online sites. The multiple binding sites were found for both. It is hypothesized that goat TEAD1 may regulate intramuscular precursor adipocyte differentiation through a pathway that regulates the expression of SREBP1, C/EBPβ, PPARγ and PREF-1. Previous studies have shown that SREBP1 plays an important role in lipogenesis at the transcriptional level. SREBP1 is involved in the control of the synthesis of FA, triacylglycerol and glycerophospholipids. It is also thought to be a major regulator of cholesterol production. SREBP1 has a preferential role in FA and cholesterol metabolism.^24–28 It has been found that SREBP1 lipogenesis transcript levels can influence fatty acid (FA) composition in beef backfat, thus affecting beef nutritional quality.²⁹ C/EBPβ and PREF-1 have been shown to be early regulators. C/EBPβ rapidly induces differentiation after hormonal stimulation, sustained overexpression of PREF-1 prevents adipogenic differentiation. And downregulation of PREF-1 is required for adipogenic differentiation to occur.^30–33 C/EBPβ, a key transcription factor in early adipogenesis, activates the expression of C/EBPα and PPARγ genes during adipocyte differentiation.^34–38 PPARγ plays an important role in adipocyte development in all types of adipose tissue.³⁹ The expression changes of positive regulator SREBP1, C/EBPβ and negative regulator PREF-1 in this experiment were in accordance with existing studies and consistent with cell morphological changes. In summary, the goat TEAD1 gene may inhibit intramuscular precursor adipocyte differentiation by downregulating the expression of SREBP1, PPARγ, C/EBPβ and PREF-1. In this experiment, we identified TEAD1 as a negative regulator of intramuscular precursor adipocyte differentiation in goats and suggested a possible pathway of action. The next step in the laboratory is to identify the signalling pathway of action and elucidate the molecular regulatory mechanism.

Conclusion

In conclusion, TEAD1 inhibits intramuscular preadipocyte differentiation in goats by regulating the express of SREBP1, PPARγ, C/EBPβ and PREF-1. These results provide a theoretical basis and scientific basis for future studies on the regulatory mechanism of TEAD1 in intramuscular fat deposition in goats.

Funding Statement

This study was supported by grants from National Natural Sciences Foundation of China [32072723 and 31902154], Sichuan Science and Technology Support Project [2022JDTD0030] and Fundamental Research Funds for the Central Universities, Southwest Minzu University [2021057].

Author contributions

Kehan Liu, Jianying Zheng, Jie Cheng, Xinzhu Huang and Liyi Zhang look for information. Kehan Liu, Yaqiu Lin and Youli Wang conceived and designed the experiment. Kehan Liu, Jianying Zheng and Jie Cheng completed the experimental content. Kehan Liu, Yaqiu Lin and Youli Wang organize and analyze the experiment data. Kehan Liu and Youli Wang wrote the article. Yong Wang, Yanyan Li and Yan Xiong revised the article. All authors read and approved the final version of the manuscript.

Disclosure statement

No potential conflict of interest was reported by the author(s).