CNTN-1 regulates malignant biological behaviors of lung squamous cell carcinoma (LUSC) via the endoplasmic reticulum stress (ERS)/epithelial-mesenchymal transition (EMT) axis

Abstract

Background

Lung squamous cell carcinoma (LUSC) is characterized by high malignancy, strong invasive and metastatic potential, and poor overall prognosis, and the core molecular mechanisms underlying its malignant progression remain to be further elucidated. This study aimed to investigate the effects of Contactin-1 (CNTN-1) on the malignant biological behaviors of tumor cells and its underlying molecular mechanisms in LUSC.

Methods

A CNTN-1-knockdown NCI-H520 LUSC cell line was established. Transcriptome sequencing was performed to analyze differentially expressed genes (DEGs) and conduct functional enrichment analysis. The effects of CNTN-1 on the malignant biological behaviors of LUSC cells were investigated in vitro using quantitative real-time polymerase chain reaction (qRT-PCR), western blot (WB), Cell Counting Kit-8 (CCK-8), Transwell and other assays. Polydatin was used as an endoplasmic reticulum stress (ERS) inducer, and a nude mouse xenograft model was constructed to validate the regulatory effects of CNTN-1 and ERS on LUSC cells growth both in vivo and in vitro.

Results

A total of 5,961 DEGs were identified by transcriptome sequencing, which were mainly enriched in cellular immune response, cytokine-cytokine receptor interaction, phosphatidylinositol 3-kinase-protein kinase B (PI3K-Akt) and other signaling pathways. In vitro experiments showed that the proliferation, migration and invasion of LUSC cells were inhibited, cell apoptosis was promoted, and cell cycle arrest was induced by CNTN-1 knockdown. Meanwhile, the expression of CHOP, BiP, N-cadherin, Vimentin, XBP-1s was downregulated, the expression of E-cadherin was upregulated, and the activation of PI3K-Akt signaling pathway was suppressed by CNTN-1 knockdown. The inhibitory effects of CNTN-1 knockdown on the epithelial-mesenchymal transition (EMT) process, PI3K-Akt signaling pathway activation and malignant cellular phenotypes were partially reversed by polydatin.

Conclusions

CNTN-1 promotes the malignant biological behaviors of LUSC cells by positively regulating ERS, as well as activating the process of EMT and the PI3K-Akt signaling pathway.

Highlight box.

Key findings

• A total of 5,961 differentially expressed genes (DEGs) are screened out via transcriptome sequencing, which are predominantly enriched in cellular immune response and the phosphatidylinositol 3-kinase-protein kinase B (PI3K-Akt) signaling pathway. Knockdown of contactin-1 (CNTN-1) is demonstrated to suppress the proliferation, migration, invasion and epithelial-mesenchymal transition (EMT) of lung squamous cell carcinoma (LUSC) cells, induce cell cycle arrest and cell apoptosis through blocking the activation of endoplasmic reticulum stress (ERS) and the PI3K-Akt pathway. The aforementioned inhibitory phenotypes are partially reversed by polydatin-triggered ERS activation.

What is known and what is new?

• LUSC is featured with high malignancy, frequent metastatic potential and unfavorable clinical prognosis. ERS and the PI3K-Akt pathway are involved in the modulation of tumor progression and EMT, whereas their upstream regulatory molecular targets remain poorly clarified.

• A novel regulatory cascade consisting of CNTN-1/ERS/EMT/PI3K-Akt is defined in the current research. Specifically, EMT initiation and PI3K-Akt pathway activation are stimulated by CNTN-1-mediated ERS upregulation, which are subsequently facilitated to drive the malignant progression of LUSC.

What is the implication, and what should change now?

• The molecular mechanisms underlying the malignant progression of LUSC are supplemented and refined by this investigation. CNTN-1 is indicated to serve as a novel prognostic biomarker and promising therapeutic candidate. Tumor deterioration can be restrained via targeted intervention against the CNTN-1/ERS axis, and novel insights are provided for targeted drug development and subsequent clinical translational research of LUSC.

Introduction

Lung cancer is one of the most prevalent and lethal malignancies worldwide (1). Usually, lung cancer is categorized into two main pathological pattern: small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC) (2). Among them, lung squamous cell carcinoma (LUSC) belongs to the common subtype of NSCLC and accounts for approximately 30% of all cases (3). Despite significant advances in the treatment of NSCLC in recent years, specific therapies for LUSC are still insufficient, resulting in the five-year survival rate of this group of patients remaining poor (4). Therefore, the identification of promising diagnostic markers, prognostic indicators, or drug targets is crucial for improving the treatment and prognosis of patients with squamous cell carcinoma of the lung (5).

Smoking is identified as the most pivotal and well-defined modifiable risk factor for LUSC. Epidemiological data have demonstrated that more than 80% of patients diagnosed with LUSC are confirmed to have a long-term smoking history. Additionally, smoking dosage and smoking duration are significantly positively correlated with the morbidity risk of LUSC and the malignant degree of tumors. Various carcinogens including polycyclic aromatic hydrocarbons and nitrosamines contained in tobacco smoke are continuously exposed to pulmonary epithelial cells. Genomic and transcriptomic expression profiles of LUSC are remodeled by inducing DNA double-strand breaks, chromosomal aberrations and aberrant epigenetic modifications. Meanwhile, canonical oncogenic signaling pathways such as PI3K/Akt are dysregulated, thereby the initiation and malignant progression of LUSC are driven at the molecular level (6-9). From the perspective of tumor molecular characteristics, distinct molecular phenotypes are exhibited by smoking-related LUSC. Compared with non-smoking patients, significantly elevated levels of tumor mutational burden (TMB) and copy number alteration (CNA) frequency as well as chromosomal instability are detected in tumor tissues from smoking patients. Furthermore, enrichment of mutations in driver genes including TP53, PIK3CA and SOX2 is observed, which is regarded as a vital molecular basis for the stronger invasiveness and poorer prognosis of LUSC (8,10,11).

Existing mechanistic studies have confirmed that endoplasmic reticulum stress (ERS) and epithelial-mesenchymal transition (EMT) are identified as the core linked signaling pathways facilitating the malignant progression of LUSC (12). Large accumulation of misfolded proteins is induced in pulmonary epithelial cells by cigarette smoke extract, and three major unfolded protein response pathways including PERK/eIF2α/ATF4, IRE1α/XBP1 and ATF6 are persistently activated. The expression levels of ERS markers such as BiP and phosphorylated PERK (p-PERK) are upregulated. Such activation characteristics of stress are particularly prominent in smoking-associated LUSC, which are closely correlated with advanced tumor stage and adverse clinical prognosis (13-17). Sustained excessive ERS is further facilitated to trigger EMT transformation in tumor cells. The upstream EMT transcription factors including Snail and Slug are upregulated, while the epithelial marker E-cadherin is downregulated, and mesenchymal markers N-cadherin and vimentin are upregulated. Malignant biological phenotypes including invasion, metastasis and drug resistance are thereby acquired by tumor cells (18-20). It has also been verified in relevant studies that aberrant overexpression of HDAC6 is specifically induced by cigarette smoke exposure, by which the malignant EMT progression is further amplified. These findings reveal that the molecular pathways mediating the regulatory effects of smoking on malignant phenotypes of LUSC are featured with multi-level regulation and multi-gene interaction (21,22). Nevertheless, the key adhesion regulatory molecules that can connect ERS and EMT processes and specifically respond to tobacco stimulation have not been clarified to date. Such research gaps are regarded as major limitations for the improvement of targeted molecular regulatory systems for LUSC.

Contactin-1 (CNTN-1) belongs to the immunoglobulin superfamily, and is defined as a core membrane protein that mediates intercellular adhesion, migration and signal communication, which is composed of neural cell adhesion molecule (N-CAM), L1 protein and Nr-CAM protein families (23). It has been confirmed by accumulating studies that CNTN-1 can act as an oncogenic driver gene. Aberrant overexpression of CNTN-1 is detected in a variety of epithelial-derived malignant tumors including gastric cancer (24), lung cancer (25) and prostate cancer (26). Malignant tumor progression is facilitated by CNTN-1 through the regulation of cell adhesion and dissociation as well as tumor microenvironment remodeling. Results of clinical specimen analyses have demonstrated that high CNTN-1 expression is closely correlated with clinical tumor stage, lymph node metastasis, distant invasion and poor prognosis, and is identified as an independent risk factor for evaluating the progression risk of malignant tumors (24,27,28). Upregulation of CNTN-1 expression has also been verified in metastatic LUSC tissues in previous studies conducted by our research group, which suggests that CNTN-1 may be involved in the invasion and metastasis of LUSC (29). Accordingly, as a pivotal regulatory protein for cell adhesion, CNTN-1 is highly likely to accelerate the malignant progression of LUSC via mediating the activation of ERS and EMT pathways. Nevertheless, the expression regulatory pattern of CNTN-1 in LUSC has not been elaborated in existing studies, and the specific molecular mechanisms by which CNTN-1 mediates the malignant progression of LUSC remain unclarified.

On this basis, the present study focuses on the malignant evolution process of LUSC to explore the biological functions and regulatory mechanisms of CNTN-1. This study is intended to supplement the molecular regulatory network of LUSC and provide novel experimental evidence and theoretical basis for precise targeted therapy of LUSC. We present this article in accordance with the ARRIVE and MDAR reporting checklists (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-0697/rc).

Methods

Cell cultivation

The human LUSC NCI-H520 cell line used in this study was purchased from Wuhan Pricella Biotechnology Co., Ltd. A total of nine experimental groups were established, and all cells were cultured in RPMI 1640 medium (L210KJ, Basalmedia, Shanghai, China) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin solution (C0009, Beyotime, Shanghai, China). Subsequent assays were conducted after 72 hours of cell culture. The detailed establishment and treatment protocols for each experimental group were as follows: short hairpin RNA (shRNA) negative control group (sh-NC group): NCI-H520 cells were cultured without any interference treatment. CNTN-1 shRNA interference group (sh-CNTN-1 group): CNTN-1 interference lentivirus was transfected into the cells of the sh-NC group, and stable CNTN-1-silenced cell lines were obtained after resistance screening with puromycin/hygromycin (ST551, Beyotime, Shanghai, China). sh-NC + placebo group: Cells in the sh-NC group were treated with placebo, which was RPMI 1640 medium (L210KJ, Cellapy, Beijing, China) containing dimethyl sulfoxide (DMSO). sh-NC + cisplatin group: cells in the sh-NC group were treated with cisplatin (HY-17394, MCE, Monmouth Junction, NJ, USA) at a concentration of 3.0 µg/mL. sh-CNTN-1 + polydatin group: cells in the sh-CNTN-1 group were treated with complete RPMI 1640 medium containing polydatin (HY-N0120A, MCE) at a concentration of 5 µmol/L. sh-CNTN-1 + placebo group: cells in the sh-CNTN-1 group were treated with an equal volume of placebo (DMSO-containing medium) as that administered to the sh-NC + placebo group. sh-CNTN-1 + cisplatin group: cells in the sh-CNTN-1 group were treated with cisplatin at a concentration of 3.0 µg/mL. sh-CNTN-1 + polydatin + placebo group: cells in the sh-CNTN-1 group were treated with RPMI 1640 medium containing 5 µmol/L polydatin and placebo (DMSO-containing medium). sh-CNTN-1 + polydatin + cisplatin group: Cells in the sh-CNTN-1 group were treated with medium containing 5 µmol/L polydatin and 3.0 µg/mL cisplatin.

RNA-seq sequencing

Total cellular RNA was extracted, and qualified sequencing samples were prepared and delivered to Novogene for high-throughput mRNA sequencing and bioinformatics analysis. The Fast RNA-seq Lib Prep Kit V2 (Cat. No. RK20306, ABclonal, Wuhan, China) was used for sequencing library construction. Paired-end reads with a length of 150 bp were adopted, and the sequencing data volume was set as 6 G. Raw sequencing data were filtered using fastp software (version 0.23.1) with the parameters: -g -q 5 -u 50 -n 15 -l 150 --overlap_diff_limit 1 --overlap_diff_percent_limit 10. Low-quality sequences were removed to obtain high-quality clean reads. Subsequent analyses were performed based on the original gene read count data. Sample correlation was evaluated by Pearson correlation coefficient, and principal component analysis (PCA) was conducted via the gmodels package to assess sample dispersion degree. Differentially expressed gene (DEG) analysis was performed based on the negative binomial distribution model. Samples with biological replicates were analyzed using DESeq2 software coupled with the DESeq normalization algorithm, while samples without biological replicates were processed by edgeR software with the trimmed mean of M-values (TMM) normalization algorithm. Sequencing depth bias was automatically corrected by the above software. Genes satisfying the criteria of |log₂(fold change)| >1 and adjusted P<0.05 were screened as DEGs. Volcano plots and clustering heatmaps were plotted using the ggplot2 and pheatmap packages, respectively. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses of DEGs between the sh-NC group and sh-CNTN-1 group were carried out via the clusterProfiler package, with P<0.05 defined as the screening threshold.

RNA isolation and quantitative real-time polymerase chain reaction (qRT-PCR) assays

The RNA from the sample set was extracted using the TRIzol method. Reverse transcription was conducted with the Goldenstar^TM RT6 complementary DNA (cDNA) Synthesis Kit Ver.2 (TSK302M, Tsingke, Beijing, China), and the cDNA synthesis was performed using the 2× T5 Fast qPCR Mix [SYBR Green I (TSE002, Tsingke)]. The primer sequences are presented in Table 1 for reference. All qRT-PCR primers were designed based on the GRCh38 reference genome and transcript annotation.

Table 1. Primer sequences used in qRT-PCR.

Primer name	Sequences (5'-3')
CNTN-1-F	CAGCCCTTTCCCGGTTTACAA
CNTN-1-R	TGCTTCTGACCATCCCGTAGT
CHOP-F	TTCACCACTCTTGACCCTGC
CHOP-R	CTCCTTCATGCGCTGCTTTC
BiP-F	GACGGGCAAAGATGTCAGGA
BiP-R	AACACTTTCTGGACGGGCTT
E-cadherin-F	TTACTGCCCCCAGAGGATGA
E-cadherin-R	TGCAACGTCGTTACGAGTCA
N-cadherin-F	CAAGAGGCAGAGACTTGCGA
N-cadherin-R	CACTGGCAAACCTTCACACG
Vimentin-F	GGACCAGCTAACCAACGACA
Vimentin-R	AAGGTCAAGACGTGCCAGAG
GAPDH-F	TCAAGGCTGAGAACGGGAAG
GAPDH-R	TCGCCCCACTTGATTTTGGA

F, forward primer; qRT-PCR, quantitative real-time polymerase chain reaction; R, reverse primer.

Western blot (WB) analysis

Configuration of RIPA lysate (containing PMSF (ST507, Beyotime) and protease inhibitor cocktail (P1045, Beyotime) was used to extract total proteins from cancer cells after. The proteins were separated and then incubated with primary antibody overnight and secondary antibody (AS014, ABclonal) at room temperature for 1 h. The ECL exposure solution (34580, Thermo, Shanghai, China) was mixed at solution A:B =1:1 and then evenly covered on the whole membrane and put into the nucleic acid-protein gel imager (Universal Hood II, Bio-Rad, California, USA) for detection. Gray value analysis was performed using ImageJ software. The GAPDH, CNTN-1, CHOP, BiP, E-cadherin, N-cadherin, Vimentin, p-Akt, Akt and spliced X-box binding protein 1 (XBP-1s) primary antibodies were purchased from ABclonal Technology Co., Ltd., under the following catalog numbers: A19056, A17459, A0221, A0241, A20798, A19083, A19607, AP0637, A22770, A28350.

Cell cycle assay

Cells in each group were harvested and then centrifuged at 2,000 rpm for 5 min. Subsequently, the cells were washed twice with pre-chilled phosphate-buffered saline (PBS), with centrifugation at 2,000 rpm for 5 min conducted after each wash, and the supernatant was carefully aspirated and discarded thereafter. One milliliter of ice-precooled 70% ethanol was added to the centrifuge tube, and the cells were gently pipetted to form a homogeneous suspension, followed by fixation at 4 ℃ for 2 h. After fixation, the cells were washed twice with pre-chilled PBS, with centrifugation at 1,000 rpm for 5 min for each wash. The supernatant was aspirated and discarded while approximately 50 µL of PBS was retained in the tube. The bottom of the centrifuge tube was flicked gently to fully disperse the cell pellet and prevent cell aggregation. The cells in each tube were stained in strict accordance with the manufacturer’s instructions of the Cell Cycle Detection Kit (Cat. No. AC12L543, Life-iLab, Shanghai, China). After staining, the red fluorescent signals of the cells were detected at the 488 nm excitation wavelength using a flow cytometer (CytoFLEX, Beckman, California, USA), and the light scatter properties of the cells were examined simultaneously.

Cell apoptosis assay

The treated cells in each group were harvested and pretreated following the experimental procedures described above for the cell cycle assay. Thereafter, the apoptosis detection of cells in each group was performed in accordance with the manufacturer’s instructions of the Annexin V-FITC/PI Apoptosis Detection Kit (40302ES50, Yeasen, Shanghai, China). After the above operations, the cell samples to be detected were preserved on ice in the dark and subjected to detection and analysis using a flow cytometer (CytoFLEX, Beckman, USA) within 1 hour.

Immunohistochemistry (IHC)

Tissue samples were rinsed with PBS and fixed in 4% paraformaldehyde. After gradient ethanol dehydration, xylene transparency, paraffin infiltration and embedding, 2.5 µm-thick paraffin sections were prepared and baked at 55 ℃ to adhere firmly to anti-slides. The sections were dewaxed in xylene, rehydrated with gradient ethanol and washed with double distilled water. Antigen retrieval was performed by high-temperature boiling for 30 min. Endogenous peroxidase activity was blocked with 3% hydrogen peroxide at room temperature for 15 min. After washing with PBS, sections were blocked with goat serum (C0265, Beyotime, Shanghai, China) for 1 h at room temperature. Subsequently, primary antibodies diluted at 1:500 were incubated overnight at 4 ℃ without rinsing after blocking. Following PBS washing, secondary antibodies diluted at 1:200 were applied and incubated for 1.5 h at room temperature. After further washing, sections were visualized with DAB chromogenic reagent (ZLI-9019, Zsbio, Beijing, China) for 1 min away from light, and the reaction was terminated by running water washing. Sections were lightly counterstained with hematoxylin (G1004, Servicebio, Wuhan, China), differentiated briefly and blued in tap water. Finally, tissues were dehydrated with gradient ethanol, cleared in xylene and mounted with neutral balsam (10004160, Sinopharm, Beijing, China). Image acquisition was conducted using an Mshot MF53 inverted microscope, produced by Guangzhou Mshot Photoelectric Technology Co., Ltd.

Transmission electron microscopy (TEM) observations

Cancer cell suspensions were slowly added to 3% glutaraldehyde fixative (LA9003, Phygene, Fujian, China) along the wall of the tubes with a 1 mL pipette (do not blow the cells apart). Then 3% glutaraldehyde was pre-fixed, 1% osmium tetroxide (Leica, GP18456) was re-fixed, and pyruvic acid was dehydrated stepwise. Then it was infiltrated and embedded by dehydrating agent and epoxy resin (GP18010, Beijing Zhongjingkeyi Technology Co., Ltd., Beijing, China) osmotic solution. Finally, ultrathin sections about 50 nm thick were prepared using an ultrathin sectioning machine (EMUC7, Leica, Wetzlar, Germany), stained with uranyl acetate (GS02624, Beijing Zhongjingkeyi Technology Co., Ltd.) for 10-15 min, then stained with lead citrate (GZ02616, Beijing Zhongjingkeyi Technology Co., Ltd.) for 1-2 min, and photographed for observation by transmission electron microscope (JEM-1400 PLUS, JEOL, Tokyo, Japan).

Proliferative capacity and drug sensitivity testing

Logarithmic phase cells were washed twice with PBS, trypsinized, centrifuged and added to conditioned medium for cell suspension, 0.4% Taipan blue staining solution (1:1), the density was adjusted to 1×10⁴/well inoculated into 96-well plate culture for 24 h, cisplatin was added for 72 h and then 10 µL Cell Counting Kit-8 (CCK-8) solution (C0037, Beyotime) was added, incubation for 4 h, the enzyme labeling instrument (NanoDrop One/OneC, Millipore, Beijing, China) measured the absorbance at 450 nm.

Migration capacity testing

Take the LUSC cells of each group with good growth status and add 0.25% pancreatic enzyme for digestion when the cells are confluent with each other and reach about 100% growth density. When the initially adherent cells gradually tended to become rounded and detached, culture medium was added to complete the digestion. In a Transwell (3422, Corning, New York, USA), 100 µL of cell suspension was added to each well, and the cells were incubated in an incubator at 37 ℃ with 5% CO₂ for 24 h. The cells were washed twice with calcium-free PBS, fixed with 4% paraformaldehyde for 20 min, and stained with 0.1% crystal violet (G1062, Servicebio, Wuhan, China) for 20 min. The cells were randomly visualized under a 100× microscope. The cells were randomly visualized under a 100× microscope, counted and the average value was taken.

Invasive ability testing

Serum-free medium and Matrigel (5:1) (356234, Corning, New York, USA) were mixed well, and 100 µL was added to the upper chamber of Transwell, and the upper chamber was inoculated with 5×10⁵ cells resuspended in serum-free medium. Conditioned medium containing 20% FBS was added to the lower chamber at 37 ℃ in a 5% CO₂ incubator and incubated for 48 h. The cells were washed twice with calcium-free PBS, fixed with 4% paraformaldehyde, stained with 0.1% crystal violet, and washed three times with PBS, and then observed, counted, and averaged under an inverted microscope (BLD-200, Keyence, Osaka, Japan).

Tumor formation in nude mice

Fifteen SPF-grade BALB/c nude mice weighing 15-20 g were selected and provided by Byrness Weil biotech Ltd. (Beijing, China). The animals were routinely cultured. After one week of adaptive feeding, the animals were randomly divided into three groups, i.e., the sh-NC group (n=5), the sh-CNTN-1 group (n=5), and the sh-CNTN-1+ polydatin group (n=5), and the group was inoculated with tumor cells subcutaneously in the left axilla of the nude mice for 200 ml (about 2×10⁶ cells/each). After the nude mice were inoculated with tumors, the state of nude mice was observed, and the nude mice entered the next experiment after 7 days of inoculation. The third group was injected with polydatin (0.5 mg/kg) intraperitoneally daily for 4 weeks, and the remaining two groups were fed with equal volume of saline. Tumor volume growth curves and tumor weights were recorded. All animal experiments were performed under a project license (No. IACUC-SAHCQMU-2025-0277) granted by the Institutional Animal Care and Use Committee of The Second Affiliated Hospital of Chongqing Medical University, in compliance with the principles of animal protection, animal welfare and ethics as well as the relevant national regulations on laboratory animal ethics.

Hematoxylin and eosin (HE) staining

The sample cancer cells were fixed to prepare paraffin sections, and then dewaxed and rehydrated. Then hematoxylin staining solution (G1004, Servicebio) was used for 5 min, and 1% hydrochloric acid alcohol was used for decolorization to remove the excess hematoxylin staining solution in the cytoplasm. Eosin staining solution (G1002, Servicebio) was stained for 2 min, dehydrated with ethanol, transparent with xylene for 5 min, and sealed with neutral resin (10004160, Sinopharm). Images were captured using a Mshot MF53 microscope produced by Guangzhou Mshot Photoelectric Technology Co., Ltd. (Guangzhou, China). The nuclei of the cells were blue, while the cytoplasm was red or pink.

Statistical analysis

Each experiment was performed with at least 3 biological replicates and 3 technical replicates, and representative experimental results are presented. All data were statistically analyzed using GraphPad Prism 9.5.1 statistics. After the Chi-squared test, significant differences between two groups were analyzed by independent samples t-test, and significant differences between multiple groups were analyzed by one-way analysis of variance (ANOVA). P value less than 0.05 was considered statistically significant.

Results

Characteristics of DEGs and pathway regulation in LUSC mediated by CNTN-1 knockdown

Lentivirus-mediated RNA interference (RNAi) technology was adopted in this study to establish LUSC cell lines with stable knockdown of CNTN-1 (NCI-H520/sh-CNTN-1), and negative control cell lines (NCI-H520/sh-NC) were constructed simultaneously. To verify the knockdown efficiency of CNTN-1, the protein and mRNA expression levels of CNTN-1 in the two groups were detected by WB and qRT-PCR, respectively (Figure 1A,1B). The results revealed that the mRNA and protein expression levels of CNTN-1 were markedly downregulated in the sh-CNTN-1 interference group compared with those in the sh-NC control group (P<0.01), which confirmed that stable cell models with effective CNTN-1 knockdown were successfully established with favorable and stable knockdown effects. Transcriptome sequencing analysis was further performed on cells of the sh-NC group and sh-CNTN-1 group based on the above validated CNTN-1-knockdown cell models. Correlation analysis of transcriptome data (Figure 1C) demonstrated that high quantitative correlation of mRNA expression levels was observed among samples within each group, indicating that the transcriptome sequencing data obtained in this study possessed satisfactory reliability and reproducibility. With |log₂(fold change)| >1 set as the screening threshold, a total of 5,961 DEGs were identified, including 1,947 upregulated genes and 4,014 downregulated genes (Figure 1D). Functional enrichment analysis was subsequently conducted to clarify the functional characteristics of these DEGs. The results of GO functional enrichment analysis (Figure 1E) showed that the DEGs regulated by CNTN-1 knockdown were mainly enriched in pivotal biological processes, including cellular immune response, cell-extracellular microenvironment interaction, intercellular communication, extracellular matrix remodeling and endoplasmic reticulum function regulation. The results of KEGG pathway enrichment analysis (Figure 1F) further verified that these DEGs were significantly enriched in core pathways such as phosphatidylinositol 3-kinase-protein kinase B (PI3K-Akt) signaling pathway, cytokine-cytokine receptor interaction, MAPK signaling pathway, ECM-receptor interaction and calcium signaling pathway. All the above pathways exhibited the highest statistical significance with the maximum −log₁₀ (P value) and were highly correlated with the research theme. It was suggested that CNTN-1 might participate in the regulation of biological behaviors of LUSC cells by modulating immune interaction, extracellular matrix remodeling and core signaling axes including PI3K-Akt and MAPK.

Figure 1.

Verification of CNTN-1 knockdown efficiency and characteristics of gene expression and pathway regulation in LUSC cells. (A,B) The knockdown efficiency of CNTN-1 was detected by qRT-PCR and WB assays. (C) Spearman correlation analysis of transcriptome sequencing data. (D) Volcano plot analysis of differentially expressed mRNAs. (E) Results of GO functional enrichment analysis. (F) Results of KEGG pathway enrichment analysis. **, P<0.01; ****, P<0.0001. BP, biological process; CC, cellular component; CNTN-1, Contactin-1; Cor, correlation coefficient; DEG, differentially expressed gene; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; LUSC, lung squamous cell carcinoma; MF, molecular function; mRNA, messenger RNA; qRT-PCR, quantitative real-time polymerase chain reaction; sh-CNTN-1, CNTN-1 shRNA interference; sh-NC, shRNA negative control; shRNA, short hairpin RNA; WB, Western blot.

CNTN-1 silencing inhibits proliferation and invasion of LUSC cells

Based on the above transcriptome enrichment analysis findings, a series of cellular functional experiments and molecular biological assays were further performed to explore the regulatory effects of CNTN-1 on the malignant biological behaviors of LUSC cells. Flow cytometry results (Figure 2A) demonstrated that G1-phase cell cycle arrest was induced in LUSC cells after CNTN-1 knockdown, and the proportion of cells in G2 phase was significantly decreased (P<0.05). It was indicated that the transition of cells from G1 phase to S/G2 phase could be blocked by CNTN-1 knockdown, thereby suppressing the proliferation of LUSC cells.

Figure 2.

Effects of CNTN-1 silencing on biological phenotypes of LUSC cells. (A) Detection and analysis of cell cycle distribution. (B) Detection of cell apoptosis rate via flow cytometry. (C) Immunohistochemical detection of CNTN-1 expression in sh-NC negative control group and sh-CNTN-1 silencing group (magnification: ×200). (D) Morphological observation of endoplasmic reticulum in LUSC cells of the two groups under transmission electron microscope (scale bar =5 µm). *, P<0.05; **, P<0.01; ***, P<0.001. CNTN-1, Contactin-1; FITC, fluorescein isothiocyanate; LD, lipid droplet; LUSC, lung squamous cell carcinoma; Ly, lysosome; M, mitochondria; N, nucleus; ns, no significant difference; Nu, nucleolus; PE, phycoerythrin; PS, pseudopodia; RER, rough endoplasmic reticulum; sh-CNTN-1, CNTN-1 shRNA interference; sh-NC, shRNA negative control; shRNA, short hairpin RNA.

In addition (Figure 2B), the cell apoptosis rate was remarkably increased in the sh-CNTN-1 group in comparison with the sh-NC control group (P<0.01), suggesting that cell apoptosis of LUSC was markedly promoted by CNTN-1 knockdown. Immunohistochemical results (Figure 2C) verified that the protein expression level of CNTN-1 was obviously downregulated in the sh-CNTN-1 group relative to the sh-NC group (P<0.001). Observations under transmission electron microscopy (Figure 2D) revealed that regular cell morphology and slightly dilated rough endoplasmic reticulum were present in the sh-NC group. By contrast, irregular cell morphology and markedly condensed rough endoplasmic reticulum structure were observed in the sh-CNTN-1 group. Such morphological characteristics were consistent with the previous conclusion that ERS pathways were inhibited. Results of Transwell migration and invasion assays (Figure 3A,3B) showed that the migration and invasion capacities of LUSC cells were significantly weakened after CNTN-1 knockdown compared with the control group (P<0.001), which indicated that the malignant invasive phenotypes of LUSC cells could be effectively inhibited by CNTN-1 knockdown.

Figure 3.

Effects of CNTN-1 knockdown on proliferative capacity and related gene and protein expression in LUSC cells. (A) Migration capacity of cells in the two groups detected by Transwell migration assay (crystal violet staining; scale bar =100 µm). (B) Invasion capacity of LUSC cells in two groups detected by Transwell invasion assay (crystal violet staining; scale bar =100 µm). (C) Proliferative ability of LUSC cell lines determined by CCK-8 assay after blank treatment or exposure to 3.0 µg/mL cisplatin for 72 h. (D) Proliferative ability of LUSC cells in sh-NC group and sh-CNTN-1 group detected by CCK-8 assay at 24, 48 and 72 h, respectively. (E) The mRNA expression levels of endoplasmic reticulum stress markers (CHOP, BiP) and epithelial/mesenchymal phenotypic markers (E-cadherin, N-cadherin, Vimentin) in sh-NC negative control group and sh-CNTN-1 silencing group measured by qRT-PCR. (F) Protein bands of XBP-1s detected by WB. (G,H) The protein expression levels of CHOP, BiP, E-cadherin, N-cadherin, Vimentin, p-Akt and total Akt in cells of the two groups were examined via WB, and the corresponding histogram and grayscale quantitative analysis results were presented. *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. CCK-8, cell counting kit-8; CNTN-1, Contactin-1; LUSC, lung squamous cell carcinoma; mRNA, messenger RNA; OD, optical density; p-Akt, phosphorylated Akt; qRT-PCR, quantitative real-time polymerase chain reaction; sh-CNTN-1, CNTN-1 shRNA interference; sh-NC, shRNA negative control; shRNA, short hairpin RNA; WB, Western blot.

To investigate the influence of CNTN-1 on the chemosensitivity of LUSC cells, cell viability was detected after a 72-hour cisplatin intervention. The corresponding results (Figure 3C) showed that cell viability was significantly reduced in the sh-CNTN-1 group under cisplatin treatment (P<0.0001), proving that the chemosensitivity of LUSC cells to cisplatin was distinctly enhanced by CNTN-1 knockdown. CCK-8 proliferation assay (Figure 3D) further confirmed that the proliferative ability of cells in the sh-CNTN-1 group was notably inhibited relative to the sh-NC group (P<0.01), which was consistent with the phenotypic characteristic of G1-phase cell cycle arrest. Results obtained from qRT-PCR and WB assays (Figure 3E-3H) revealed that, compared with the sh-NC group, the mRNA and protein expression levels of ERS markers CHOP (P<0.01) and BiP, as well as mesenchymal markers N-cadherin (P<0.0001) and Vimentin (P<0.001), were significantly downregulated in the sh-CNTN-1 group. The mRNA and protein levels of epithelial marker E-cadherin were prominently upregulated (P<0.001), and the phosphorylation ratio of p-Akt/Akt protein was obviously decreased. Meanwhile, the protein expression of XBP-1s, a core specific marker of ERS pathways, was markedly reduced following CNTN-1 knockdown. All the above findings illustrated that ERS responses were suppressed, the EMT process of tumor cells was reversed, and the phosphorylation-mediated activation of the Akt signaling pathway was blocked by CNTN-1 knockdown.

ERS Mediates the regulation of EMT and PI3K-Akt signaling pathway by CNTN-1 (Figure 4)

Figure 4.

Effects of polydatin intervention on the expression of related genes and proteins in LUSC cells with CNTN-1 knockdown. (A-F) The mRNA expression levels of CNTN-1, CHOP, BiP, E-cadherin, N-cadherin and Vimentin were determined by RT-qPCR. (G-N) WB was used to detect the protein bands of CNTN-1, CHOP, BiP, E-cadherin, N-cadherin, Vimentin, p-Akt and total Akt. (O,P) WB was applied to examine the protein bands of XBP-1s. *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. CNTN-1, Contactin-1; LUSC, lung squamous cell carcinoma; ns, no significant difference; p-Akt, phosphorylated Akt; qRT-PCR, quantitative real-time polymerase chain reaction; sh-CNTN-1, CNTN-1 shRNA interference; sh-NC, shRNA negative control; shRNA, short hairpin RNA; WB, Western blot.

Polydatin was used as a non-canonical inducer of ERS in the present study. Different from canonical ERS inducers such as tunicamycin and thapsigargin, ERS can be triggered by polydatin via disturbing intracellular calcium homeostasis and disrupting endoplasmic reticulum membrane structure, and multiple ERS-independent pathways including PI3K can also be modulated by this agent (30). To eliminate its non-specific interfering effects, three experimental groups including sh-NC group, sh-CNTN-1 group and sh-CNTN-1 + polydatin group were established. Key molecules involved in related pathways were screened at both gene and protein levels to explore the regulatory mechanism of CNTN-1.

Firstly, the influence of polydatin on the efficiency of CNTN-1 knockdown was verified to exclude its interference on established cell knockdown models. As presented in Figure 4A,4G, no significant differences were observed in the mRNA and protein expression levels of CNTN-1 between the sh-CNTN-1 group and the sh-CNTN-1 + polydatin group (P>0.05), which indicated that the knockdown efficiency of CNTN-1 was not affected by polydatin. Subsequently, multiple canonical ERS markers were further detected. The results demonstrated that the mRNA and protein expression levels of CHOP and BiP were markedly upregulated by polydatin in CNTN-1 knockdown cells (P<0.001) (Figure 4B,4C,4H,4I), and the protein level of XBP-1s was also obviously restored (Figure 4O,4P). These findings confirmed that ERS could be effectively activated by polydatin in CNTN-1 knockdown cells, suggesting that ERS could be alleviated by CNTN-1 knockdown, and the established cell model was capable of avoiding the interference caused by non-specific pathways regulated by polydatin. The EMT and PI3K-Akt pathways were further examined. As shown in Figure 4D-4F, 4J-4N, compared with the sh-CNTN-1 group, significantly elevated levels of mesenchymal markers including N-cadherin and Vimentin as well as increased p-Akt/Akt ratio were detected in the combined treatment group (P<0.05), while the mRNA and protein expression of the epithelial marker E-cadherin were distinctly downregulated (P<0.01). Collectively, the activation of ERS induced by polydatin was proven to partially reverse the inhibitory effects exerted by CNTN-1 knockdown on EMT progression and the PI3K-Akt signaling pathway. The above results verified the existence of the molecular regulatory axis, in which downstream EMT and PI3K-Akt pathways were modulated by CNTN-1 through regulating ERS.

ERS activation contributed to malignant biological behaviors of LUSC

Immunohistochemical results (Figure 5A,5B) revealed that the protein expression level of CNTN-1 was significantly increased in the sh-CNTN-1 + polydatin group compared with the sh-CNTN-1 group (P<0.01), indicating that the protein expression of CNTN-1 under knockdown status could be effectively upregulated by polydatin. Ultrastructural observations of cells under transmission electron microscopy (Figure 5C) demonstrated that intact cell morphology and normal rough endoplasmic reticulum structure were observed in the sh-NC group. Reduced quantity and severe structural contraction of rough endoplasmic reticulum were detected in the sh-CNTN-1 group. Nevertheless, no obvious improvement of endoplasmic reticulum damage was achieved after polydatin intervention, which suggested that the pathological endoplasmic reticulum damage induced by CNTN-1 knockdown could not be repaired by polydatin. Results of Transwell migration and invasion assays (Figure 5D,5E) showed that the migration and invasion abilities of LUSC cells were markedly weakened by CNTN-1 downregulation, whereas such inhibitory effects were obviously reversed and the metastatic capacity of cancer cells was significantly enhanced by polydatin treatment (P<0.05).

Figure 5.

Effect of polydatin on the biological behavior of CNTN-1-silenced lung squamous carcinoma cells. (A,B) Immunohistochemical detection of CNTN-1 expression in sh-NC group, sh-CNTN-1 group and sh-CNTN-1 + polydatin group (magnification: 200×). (C) TEM to detect the morphology of tumor cell endoplasmic reticulum in sh-NC group, sh-CNTN-1 group and sh-CNTN-1 + polydatin group (scale bar: left, 5 µm; right 2 µm). (D) Transwell detection of migration ability of lung squamous carcinoma cells in sh-NC group, sh-CNTN-1 group and sh-CNTN-1 + polydatin group (crystal violet staining; scale bar =100 µm). (E) Transwell detection of invasive ability of lung squamous carcinoma cells in sh-NC group, sh-CNTN-1 group and sh-CNTN-1 + polydatin group Result plots (crystal violet staining; scale bar =100 µm). (F) CCK-8 assay for proliferation ability of lung squamous carcinoma cell lines in sh-NC group and sh-CNTN-1 group at 24, 48, and 72 h. (G) CCK-8 assay for proliferation ability of lung squamous carcinoma cell lines after addition of concentration of 3.0 µg/m L cisplatin for 72 h stimulation of tumor cells in each group. *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. CCK-8, cell counting kit-8; CNTN-1, Contactin-1; LUSC, lung squamous cell carcinoma; OD, optical density; sh-CNTN-1, CNTN-1 shRNA interference; sh-NC, shRNA negative control; shRNA, short hairpin RNA; TEM, transmission.

Further verification was performed via CCK-8 proliferation assays (Figure 5F). At the detection time points of 24 and 48 h, significantly higher cell proliferative activity was observed in the sh-CNTN-1 + polydatin group than in the sh-CNTN-1 group, which confirmed that the in vitro proliferation of LUSC cells with CNTN-1 knockdown could be distinctly facilitated by polydatin. In addition, results of combined cisplatin intervention experiments (Figure 5G) indicated that cell viability was remarkably restored in the sh-CNTN-1 + polydatin + cisplatin group relative to the sh-CNTN-1 + cisplatin group (P<0.01). It was illustrated that the cytotoxic effect of cisplatin on LUSC cells could be antagonized by polydatin, and the drug sensitivity of tumor cells to cisplatin was thereby reduced. Taken together, in LUSC cells with CNTN-1 knockdown, the expression of CNTN-1 can be effectively upregulated by polydatin. Malignant biological behaviors including cell proliferation, migration and invasion are promoted, and cisplatin resistance is simultaneously mediated by polydatin.

CNTN-1 regulates the ERS/EMT axis to inhibit LUSC growth in vivo

To further verify the regulatory effects of CNTN-1 on ERS and EMT, and explore its influence on the in vivo growth capacity of LUSC, a subcutaneous xenograft tumor model in nude mice was established in this study. The differences in tumor growth and the expression alterations of related molecular markers among each group were analyzed. Tumor growth results (Figure 6A,6B) showed that the volume of xenograft tumors in all groups was increased gradually with the extension of feeding time. Compared with the sh-NC control group, markedly reduced tumor volume was observed in the sh-CNTN-1 group, which indicated that the in vivo tumorigenic ability of LUSC cells could be significantly suppressed by CNTN-1 knockdown. After polydatin intervention, the tumor volume in the sh-CNTN-1 + polydatin group was obviously larger than that in the sh-CNTN-1 group, suggesting that the inhibitory effect of CNTN-1 knockdown on xenograft tumor growth could be partially reversed by polydatin. Consistent variation trends were obtained in tumor weight detection (Figure 6C). HE staining pathological results (Figure 6D) revealed that intact tumor tissue structure and mild inflammatory infiltration were presented in the sh-NC group. Disordered tissue arrangement, severe structural damage and obviously increased inflammatory cell infiltration were found in the sh-CNTN-1 group. In comparison with the simple knockdown group, partial recovery of tumor tissue structural integrity was achieved in the sh-CNTN-1 + polydatin group, whereas abundant inflammatory cell infiltration still remained.

Figure 6.

Effects of polydatin on the animal tumor transplantation model after CNTN-1 silencing. (A) In vivo and ex vivo photographs of tumors in the sh-NC, sh-CNTN-1 and sh-CNTN-1 + polydatin groups. (B) Growth curves of tumor weight with the extension of the injection time of polydatin. (C) Tumor weight. (D) HE staining to observe the tissue morphology of transplantation tumors in the sh-NC, sh-CNTN-1 and sh-CNTN-1 + polydatin groups (magnification: 100×). **, P<0.01. HE, hematoxylin and eosin; ns, no significant difference; sh-CNTN-1, CNTN-1 shRNA interference; sh-NC, shRNA negative control; shRNA, short hairpin RNA.

Alterations of in vivo EMT-related protein expression were further validated at the molecular level via immunohistochemical detection (Figure 7A,7B). The results demonstrated that compared with the sh-NC group, the expression of epithelial marker E-cadherin was extremely significantly upregulated (P<0.01), while the expression of mesenchymal markers N-cadherin and Vimentin was prominently downregulated (P<0.001) in the sh-CNTN-1 group. It was confirmed that the EMT process of LUSC could be inhibited by CNTN-1 knockdown in vivo, which was consistent with the conclusions of in vitro cellular experiments. Following polydatin treatment, significantly restored expression levels of N-cadherin and Vimentin (P<0.05) as well as synchronous upregulation of CNTN-1 protein expression were detected in the sh-CNTN-1 + polydatin group, proving that the EMT suppression mediated by CNTN-1 knockdown could be reversed by polydatin to facilitate the transformation of tumor cells into mesenchymal phenotypes. To confirm the clinical reliability of the present study, clinical sample verification was performed based on public databases. The results (Figure 7C) showed that the expression level of CNTN-1 was significantly higher in LUSC tumor tissues than that in normal lung tissues (P=0.001). Kaplan-Meier survival analysis (Figure 7D) indicated that LUSC patients with high CNTN-1 expression exhibited distinctly poorer overall survival prognosis than those with low CNTN-1 expression (P=0.047). In addition, correlation analysis results (Figure 7E,7F) illustrated that CNTN-1 expression was positively correlated with mesenchymal EMT markers and negatively correlated with epithelial markers, and a correlative tendency was also observed between CNTN-1 and ERS marker genes including DDIT3/CHOP and HSPA5/BiP. The above findings further confirmed that the EMT progression of LUSC could be regulated by CNTN-1 at the clinical specimen level.

Figure 7.

Immunohistochemical detection of CNTN-1, epithelial and mesenchymal phenotypic markers (E-cadherin, N-cadherin, Vimentin) in xenograft tumor tissues of sh-NC, sh-CNTN-1 and sh-CNTN-1 + polydatin groups and verification of in vitro experimental results. (A) Immunohistochemical staining images (magnification: ×200). (B) Quantitative detection of the expression levels of CNTN-1, epithelial and mesenchymal phenotypic markers (E-cadherin, N-cadherin, Vimentin) in xenograft tumor tissues from the above three groups. (C) Expression levels of CNTN-1 in LUSC tumor tissues and normal lung tissues. (D) Kaplan-Meier survival analysis. (E) Scatter plot of EMT correlation. (F) Scatter plot of ERS correlation. *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. CNTN-1, Contactin-1; EMT, epithelial-mesenchymal transition; ERS, endoplasmic reticulum stress; LUSC, lung squamous cell carcinoma; ns, no significant difference; sh-CNTN-1, CNTN-1 shRNA interference; sh-NC, shRNA negative control; shRNA, short hairpin RNA; TPM, transcripts per million.

Discussion

Enhanced metastatic capacity of tumor cells is regarded as one of the leading causes contributing to poor prognosis in patients with LUSC (31). As a conserved and core mechanism modulating tumor invasion, metastasis and chemoresistance, EMT is played a vital role in the malignant progression of lung cancer (32-34). Aberrant expression of CNTN-1 has been confirmed to be closely associated with the occurrence and progression of various malignant tumors in numerous previous studies (28,35). Against the above research background, the regulatory roles and molecular mechanisms of CNTN-1 in ERS and EMT pathways of LUSC were systematically explored in the present study. Relevant research findings are endowed with important scientific research values and clinical significance for clarifying the mechanisms underlying malignant progression of LUSC and identifying novel targets for targeted intervention.

Transcriptome sequencing results of this study revealed that a total of 5,961 DEGs were screened out after CNTN-1 knockdown, among which the number of downregulated genes was significantly higher than that of upregulated genes. It was indicated that the expression of a wide range of malignant progression-related genes in LUSC could be suppressed by CNTN-1 knockdown. GO functional enrichment analysis verified that these DEGs were mainly enriched in biological processes such as extracellular matrix remodeling and cellular immune response. Core classical oncogenic pathways including PI3K-Akt, MAPK and ECM-receptor interaction were further identified via Kyoto Encyclopedia of KEGG enrichment analysis. The above sequencing findings preliminarily confirmed at the transcriptomic level that CNTN-1 was closely correlated with microenvironment regulation, malignant proliferation and invasion of LUSC cells. In addition, the mRNA and protein levels of ERS markers and EMT-related molecules were decreased by CNTN-1 knockdown. Meanwhile, the proliferative, migratory and invasive capacities of LUSC cells were inhibited, and cellular chemosensitivity was enhanced. It was suggested that protein folding efficiency could be improved by interfering with CNTN-1 expression, thereby restraining ERS and ultimately blocking the EMT process (36). Moreover, the relative expression level of p-Akt/total Akt protein was markedly altered following CNTN-1 knockdown. This outcome was consistent with the findings reported by Ghafoor et al. (37), which further validated that the PI3K-Akt signaling pathway served as a critical hub linking ERS and EMT progression. Furthermore, the tumor-suppressive phenotypes induced by CNTN-1 knockdown observed in the present study were highly consistent with previous experimental results of CNTN-1 inhibition in prostate cancer (38), suggesting that the oncogenic effect of CNTN-1 possessed certain conservation across different tumor types.

It has been validated in previous studies that XBP1, a key activating protein of ERS, exerts prominent oncogenic effects. Aberrant overexpression of XBP1 can upregulate mesenchymal markers such as N-cadherin and Vimentin and suppress the expression of E-cadherin, thus accelerating tumor EMT. By contrast, intercellular adhesive junctions can be remodeled by XBP1 knockdown, and the invasive ability and in vivo tumorigenicity of breast cancer cells are further inhibited (34,39). The present experimental results demonstrated that the protein expression of spliced active XBP-1s was markedly downregulated by CNTN-1 interference. Accordingly, it was concluded that the expression of XBP-1s was positively regulated by CNTN-1. The malignant phenotypic transformation of EMT in LUSC cells was mediated by CNTN-1 via activating core downstream effector molecules of ERS. Relevant studies on lung adenocarcinoma have revealed that ERS induced by tunicamycin can elevate the expression levels of IL-32 and GRP78 in A549 cells and simultaneously facilitate the EMT process. In addition, the activation of EMT can be obviously blocked by IL-32 knockdown or the administration of ERS inhibitors (36,40). In this study, both ERS and EMT were significantly restrained by CNTN-1 knockdown, which shared consistent biological effects with IL-32 silencing. These findings inversely confirmed that CNTN-1 played vital roles in promoting EMT progression and exerting oncogenic functions in LUSC.

To clarify the mediating role of ERS in the regulatory pathway governed by CNTN-1, rescue experiments were performed using polydatin, a non-canonical ERS inducer, in this study. It was found that the activation of ERS mediated by polydatin could initiate the EMT program simultaneously. Compared with the sh-CNTN-1 group, the expression levels of mesenchymal markers N-cadherin and Vimentin were significantly upregulated, while the level of epithelial marker E-cadherin was distinctly downregulated in the sh-CNTN-1 + polydatin group. These results confirmed that ERS served as a crucial intermediate regulatory link in EMT inhibition induced by CNTN-1 knockdown. It has been verified in previous studies that the activation of ERS is commonly accompanied by abnormal upregulation of EMT markers in various malignant tumors (34), which further supports that ERS acts as an upstream positive regulator of EMT. Meanwhile, a marked recovery of the intracellular p-Akt/Akt ratio was observed after polydatin-induced ERS activation, indicating that the phosphorylation activation of the PI3K-Akt signaling pathway could be mediated by ERS. Accumulated evidence has demonstrated that the PI3K-Akt pathway can modulate multiple biological behaviors including tumor proliferation, migration, EMT transformation and chemoresistance (41,42), and aberrant activation of the Akt pathway is regarded as an important inducer of EMT occurrence and drug resistance development (43). Combined with the phenotypic results of the present study, it was confirmed that ERS could drive EMT progression and mediate malignant biological behaviors of LUSC cells via activating the PI3K-Akt pathway. This hypothesis was highly consistent with the restored proliferative and invasive capacities of tumor cells after ERS activation in rescue experiments. Further verification was conducted via in vivo xenograft tumor assays in nude mice. The growth of xenograft tumors was remarkably suppressed, tumor tissue structure was destroyed, inflammatory infiltration was aggravated, and the in vivo EMT process of tumors was inhibited by CNTN-1 knockdown. Such tumor-suppressive effects were partially reversed and malignant tumor phenotypes were restored after polydatin treatment. Highly consistent conclusions were obtained from in vitro and in vivo experiments.

Clinical data from public databases demonstrated that elevated CNTN-1 expression was observed in LUSC tissues and correlated with poor patient prognosis. CNTN-1 expression was positively associated with mesenchymal markers and negatively associated with epithelial markers, validating its potential as a prognostic biomarker. CNTN-1 can serve as an auxiliary indicator for clinical prognostic stratification and individualized risk evaluation. Functional experiments confirmed that CNTN-1 knockdown suppressed malignant progression and enhanced cisplatin sensitivity of tumor cells. Targeted inhibition of CNTN-1 simultaneously blocked ERS/EMT and PI3K-Akt pathways, exerting tumor-suppressive and chemosensitizing effects. Polydatin was verified to activate ERS and induce chemotherapy resistance, providing experimental evidence for the clinical application of polydatin-containing preparations. The identified molecular regulatory axis supports the development of multi-target interventions and precise treatment strategies for LUSC.

Several limitations existed in this study. First, all in vitro experiments were performed only in the NCI-H520 cell line, lacking validation in multiple cell lines and primary tumor cells. Second, nude mouse xenograft models could not recapitulate the immune microenvironment of human tumors. Third, clinical analysis was merely based on public database data without prospective validation of in-house clinical cohorts. Future studies will adopt multiple cell lines and immunocompetent animal models, and enroll clinical samples to further verify the regulatory mechanism and clinical value of CNTN-1 in LUSC.

Conclusions

This study conducted a systematic investigation into the functional role and regulatory mechanisms of CNTN-1 in LUSC. Our results clearly demonstrated that CNTN-1 serves as a core regulator of LUSC malignant progression, which mediates the regulation of malignant phenotypes in LUSC cells through the ERS-EMT axis. This effect was consistently validated in both in vitro experiments using NCI-H520 cells and in vivo nude mouse xenograft models of LUSC. Further mechanistic analysis confirmed that CNTN-1 can selectively drive the EMT process via the PI3K-Akt signaling pathway by sustaining the activated state of ERS in LUSC cells. Additionally, polydatin was found to further amplify the inhibitory effect on EMT by activating the ERS pathway; this effect exerts a synergistic interaction with CNTN-1 knockdown, thereby markedly impairing the malignant biological behaviors of LUSC cells. Collectively, this study not only provides a novel molecular perspective for deciphering the pathogenesis of LUSC but also identifies CNTN-1 as a potential molecular target for LUSC precision therapy. Meanwhile, the synergistic effect between polydatin and CNTN-1-targeted intervention offers experimental evidence and theoretical support for the subsequent development of LUSC combination therapeutic strategies and the improvement of patient prognosis.

Supplementary

The article’s supplementary files as

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All animal experiments were performed under a project license (No. IACUC-SAHCQMU-2025-0277) granted by the Institutional Animal Care and Use Committee of The Second Affiliated Hospital of Chongqing Medical University, in compliance with the principles of animal protection, animal welfare and ethics as well as the relevant national regulations on laboratory animal ethics.

Data Sharing Statement

Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-0697/dss

tcr-15-06-503-dss.pdf ^{(66.3KB, pdf)}

DOI: 10.21037/tcr-2026-0697