ABSTRACT
Complete mitochondrial genomes were sequenced and annotated from three Klossia species (Apicomplexa; Adeleorina) infecting snails in North America and Europe. Mitochondrial genomes of K. helicina (type species—NC_058857.1; 6728 bp), K. razorbacki (NC_058856.1; 6775 bp), and K. vaderbriani (OM891106.1; 6757 bp) were circular‐mapping with the same gene contents and organization with 3 CDS regions (cytochrome c subunits I [COI] and III [COIII], and cytochrome b [CytB]) interspersed with 37 large and small ribosomal DNA fragments. Content and organization of mitochondrial genomes of Klossia species were shared with Legerella nova (monoxenous adeleorinid protist infecting pill millipedes) except for the reversed coding direction of one rDNA fragment; Haemogregarina species (heteroxenous adeleorinid protists with leech definitive hosts) mitochondrial genomes shared similar genome organization but lacked 2 rDNA fragments found in those monoxenous genera. In contrast, mitochondrial genomes of the Klossia species differed markedly in organization from Klossiella equi, a monoxenous adeleorinid protist parasite of vertebrates. Pairwise comparisons of the CDS regions of the Klossia species to other adeleorinid protists confirmed the close relatedness of monoxenous L. nova (Legerellidae) to monoxenous Klossia species (Adeleidae). The diversity of mitochondrial genomes of monoxenous adeleorinid protists infecting invertebrates has only begun to be explored.
1. Introduction
Notable parasites of both human and veterinary importance belonging to the protistan phylum Apicomplexa include the causative agents of malaria (Plasmodium spp.), coccidiosis of food production animals (Eimeria spp.), toxoplasmosis (Toxoplasma gondii), neosporosis causing abortions in cattle (Neospora caninum), and cryptosporidiosis (Cryptosporidium spp.) to name a few (Perkins et al. 2000). These notable apicomplexan parasites have been studied in detail because of their considerable negative impacts on the health of humans or domesticated animals.
In contrast to most of the parasites listed above that use vertebrates (humans and domesticated animals) as definitive hosts, members of the suborder Adeleorina are largely parasites of invertebrates united by the biological process of syzygy. Despite the description of many adeleorinid species over 100 years ago (e.g., Hesse 1911; Schneider 1875a, 1875b, 1885; Smith and Johnson 1902), comparatively little research has been done on them subsequently due to their lack of perceived importance. Before genetic characterizations were possible, morphology and host association were the primary criteria for differentiating parasite species, with members of the phylum Apicomplexa being no exception. Despite the improvements in molecular diagnostics and sequencing technologies, most recent studies on adeleorinid parasites have not exploited the potential of these now standard methodologies. Consequently, there are few sequences available from adeleorinid parasites, especially from within the family Adeleidae. Sequencing has now become an invaluable tool for diagnostic procedures, differentiation, and identification of new species, and has provided a means of inferring the phylogenetic relationships among adeleorinid taxa as well as between the adeleorinid parasites and other members of the Apicomplexa.
Members of the adeleid genus Klossia are monoxenous adeleorinid parasites that infect the kidneys of molluscan hosts (Barta 2000). Infective sporocysts are shed in the excreta of the snail or slug. Prior to the description of Klossia razorbacki from a North American land snail, there had been no descriptions of Klossia species from land snails from any continent other than Europe (Zeldenrust and Barta 2021). Despite the description of the type species Klossia helicina by Schneider (1875a) almost 150 years ago and major advancements in sequencing technologies, limited genetic research has been done on members of this genus to date; prior to this study and the descriptions of K. razorbacki from Arkansas, USA and Klossia vaderbriani in Ontario, Canada (Zeldenrust and Barta 2021; Zeldenrust et al. 2025), only two nuclear 18S ribosomal DNA (18S rDNA) sequences from this genus were available publicly. Both previously available sequences were generated from European samples of the type species K. helicina. More recently, a nuclear 18S rDNA sequence and several partial mt genome fragments of K. helicina were generated from a parasite isolate from Vancouver, British Columbia using Illumina Next Generation Sequencing with an automated assembly (Na et al. 2024). There are now four nuclear 18S rDNA sequences available from K. helicina, one from K. razorbacki and one nuclear 18S rDNA sequence from K. vaderbriani.
In this study, mitochondrial genomes were generated and fully annotated from the type species of the adeleorinid genus Klossia, K. helicina Schneider, 1875 from Europe, and from two recently described members of the genus from North America, K. razorbacki Zeldenrust and Barta 2021 and K. vaderbriani Zeldenrust et al. 2025. These were the first complete mitochondrial (mt) genome sequences from any Klossia species, and the first from any member of the family Adeleidae generated to date. These complete mt genome sequences and nuclear 18S rDNA sequences obtained from the same parasites have been used to refine the phylogenetic relationships among members of the Apicomplexa (see Zeldenrust et al. 2025), with a primary focus on the Adeleorina.
2. Materials and Methods
2.1. Host Collection and Dissection
Overwintering magnolia three‐tooth snails ( Triodopsis hopetonensis Shuttleworth, 1852) were collected on the University of Arkansas campus (Fayetteville, Arkansas USA 36°04′15.8″N 94°10′35.8″W) in December 2018 as previously described in Zeldenrust and Barta (2021). Snails were identified morphologically using published features (Texas Parks and Wildlife 2004; Anton 2010).
White‐lipped snails ( Cepaea hortensis Muller, 1774) and grove snails ( C. nemoralis Linn., 1758) (n = 20) were collected in October 2019 from 3 locations in Poland: 50°00′14.7″ N 22°02′56.5″ E (n = 1), 49°59′37.5″ N 22°00′51.7″ E (n = 13), and 53°06′43.2″ N 21°33′39.0″ E (n = 6).
Hairy snails (Trochulus hispidus Linn., 1758) were collected April 6, 2020 (n = 10), May 27, 2020 (n = 20), March 26, 2021 (n = 4), October 22, 2021 (n = 4), December 16, 2021 (n = 3) from a private residence in Brighton, Ontario, Canada (44°5′23″ N 77°46′35″ W) (see Zeldenrust et al. 2025). In all experiments, snails were anesthetized prior to decapitation and dissection to reveal the kidney as described previously (Zeldenrust and Barta 2021).
Isolated kidney tissue was macerated with fine needles in normal saline (0.85% NaCl, w/v) and temporary wet mounts prepared for immediate microscopic examination (Arkansas samples and Ontario samples). Kidney tissues dissected from Polish snails were stored in DNAzol (Thermo Fisher Scientific, Mississauga ON) at room temperature until further processing 5–11 days after dissection. For the latter kidney samples, tissue suspensions of kidneys from five of these snails were confirmed microscopically to contain stages consistent with sporulated oocysts of a Klossia species.
2.2. DNA Extraction
For all snails (Arkansas n = 18; Poland n = 20; Ontario n = 41), DNA was extracted from the dissected kidney tissue of each snail examined. Tissues were macerated in DNAzol, and DNA was extracted according to the manufacturer's instructions. Mixed host ± parasite DNA was quantified using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific) and stored at −20°C until use as template for PCR reactions.
2.3. PCR and Sequencing
PCR reactions were conducted using protocols as described in Zeldenrust and Barta (2021) and Zeldenrust et al. (2025) using Apicomplexa‐specific mitochondrial primers (Tables 1, 2, 3; 500 nM per reaction). Either 1× Invitrogen Platinum SuperFi Master Mix (contains DNA polymerase, magnesium, salts, and dNTP's; Thermo Fisher Scientific) or Platinum Taq polymerase (Invitrogen, Carlsbad, CA) was used per reaction. Each reaction using Platinum Taq polymerase contained 50 mM MgCl2, 1 mM dNTPs, 1× PCR buffer, and 0.4 U Platinum Taq. Host snail cytochrome c oxidase subunit I (COI) barcoding for species identification of Trochulus hispidus was generated using primers LCO1490 (5′‐GGTCAACAAATCATAAAGATATTGG‐3′) and HCO2198 (5′‐AAACTTCAGGGTGACCAAAAAATCA‐3′) (Folmer et al. 1994).
TABLE 1.
PCR primers used for the generation of the complete Klossia razorbacki (GenBank NC_058856) mitochondrial genome.
| Amplicon | Primer Name | Primer Sequence | Anneal Temperature (°C) | Amplicon Size | References |
|---|---|---|---|---|---|
| Fragment 1 | Api_LSUG_F | 5′‐TTGAGRCAGTTTGTTCCCTATCT‐3′ | 60 a | 1671 | Léveillé et al. 2019 |
| Api_LSUF_R | 5′‐ACCTGTTATCCCCGGCGWA‐3′ | ||||
| Fragment 2 | Api_LSUF_F | 5′‐GTWCGCCGGGGATAACAGGT‐3′ | 62–59 a , b | 5096 | Léveillé et al. 2019 |
| Adel_mt_LSUG_R2 | 5′‐TTCTAACGGTGAACTCTCAT‐3′ | Designed for this study | |||
| Fragment 3 | E.prae.COI_400NF | 5′TTAAGTACATCCTTAATGTCCC‐3′ | 62–58 b | 2071 | Designed for this study |
| Adel_RNA15_R c | 5′‐TWTGWAACACACTTCCCTTCT‐3′ | Léveillé et al. 2020 | |||
| Fragment 3.1 (reamplification) | E.prae.COI_400NF | 5′TTAAGTACATCCTTAATGTCCC‐3′ | 55 | 1926 | Designed for this study |
| MT‐WG_3613F | 5′‐TTTATGATCCCAGGCTGGTT‐3′ | ||||
| Fragment 4 | Em‐WG‐MT_3658F | 5′‐CTGGCGAGAAGGGAAGTGTG‐3′ | 62–58 b | 1875 | Ogedengbe et al. 2013 |
| mtRNA20_UNI_R | 5′‐GTATGGATTTCACGGTCAA‐3′ | Imai and Barta 2019 |
Note: Platinum Taq was used unless otherwise stated. Reamplification reactions are indicated by the fragment number that provided the primary amplicon material used as template followed by a decimal point and additional number.
Reactions were performed using Platinum SuperFi PCR Master mix (Thermo Fisher Scientific Waltham, MA, USA) and anneal temperatures calculated per manufacturers instructions with online calculator for Platinum SuperFi DNA polymerase (www.thermofisher.com).
Specificity was improved using a touch down protocol (based on Korbie and Mattick 2008) with a primer anneal temperature of 62°C for cycle 1, 61°C for cycle 2, 60°C for cycle 3, 59°C for cycle 4 and 58°C for cycles 5–35.
Although published as Adel_RNA15_F by Leveille et al. (2020), this primer has been renamed herein as Adel_RNA15_R to reflect the direction of the targeted rDNA fragment; the sequence of the primer was not altered.
TABLE 2.
PCR primers used for the generation of the complete Klossia helicina (GenBank NC_058857) mitochondrial genome.
| Amplicon | Primer name | Primer sequence | Anneal temperature (°C) | Product size (bp) | References |
|---|---|---|---|---|---|
| Fragment 1 | Api_LSUF_F | 5′‐GTWCGCCGGGGATAACAGGT‐3′ | 60 a | 5153 | Léveillé et al. 2019 |
| Api_LSUG_R | 5′‐AGATAGGGAACAAACTGYCTCAA‐3′ | ||||
| Fragment 1.1 (reamplification) | Api_LSUF_F | 5′‐GTWCGCCGGGGATAACAGGT‐3′ | 64 | 5037 | Léveillé et al. 2019 |
| Eim_mt_RNA19_R | 5′‐GTGAGTTCGCATGTTTACGAGAT‐3′ | Kruth et al. 2020 | |||
| Fragment 1.2 (reamplification) | Api_LSUG_R | 5′‐AGATAGGGAACAAACTGYCTCAA‐3′ | 60 | 1867 | Léveillé et al. 2019 |
| Api_RNA10_R | 5′‐GCGGTTAAYCTTWCCTWTTCCTTAC‐3′ | Zeldenrust et al. 2025 | |||
| Fragment 2 | Api_LSUG_F | 5′‐TTGAGRCAGTTTGTTCCCTATCT‐3′ | 60 a | 1618 | Léveillé et al. 2019 |
| Api_LSUF_R | 5′‐ACCTGTTATCCCCGGCGWA‐3′ | ||||
| Fragment 3 | Api_LSUF_F | 5′‐GTWCGCCGGGGATAACAGGT‐3′ | 62–58 b | 3509 | Léveillé et al. 2019 |
| mtRNA4_72R | 5′‐CATGTTTATAACCTTACGGACT‐3′ | Designed for this study | |||
| Fragment 4 | Api_LSUE_R c | 5′‐AGGTGCTCAGGGTCTTACCG‐3′ | 59 | 1028 | Léveillé et al. 2019 |
| Em‐WG‐MT_3658_F | 5′‐CTGGCGAGAAGGGAAGTGTG‐3′ | Ogedengbe et al. 2013 | |||
| Fragment 5 | Adel_RNA15_R d | 5′‐TWTGWAACACACTTCCCTTCT‐3′ | 59 | 1571 | Léveillé et al. 2020 |
| Api_Uni_COI_F | 5′‐TGGGCHCAYCAYATGATGAC‐3′ |
Note: Platinum Taq was used unless otherwise stated. Reamplification reactions are indicated by the fragment number that provided the primary amplicon material used as template followed by a decimal point and additional number.
Reactions were performed using Platinum SuperFi PCR Master mix (Thermo Fisher Scientific Waltham MA USA) and anneal temperatures calculated per manufacturers instructions with online calculator for Platinum SuperFi DNA polymerase (www.thermofisher.com).
Specificity was improved using a touch down protocol (based on Korbie and Mattick 2008) with a primer anneal temperature of 62°C for cycle 1, 61°C for cycle 2, 60°C for cycle 3, 59°C for cycle 4 and 58°C for cycles 5–35.
Same primer sequence as “Hep_COB‐1797R” of Léveillé et al. (2014).
Although published as Adel_RNA15_F by Leveille et al. (2020), this primer has been renamed herein as Adel_RNA15_R to reflect the direction of the targeted rDNA fragment; the sequence of the primer was not altered.
TABLE 3.
PCR primers used for the generation of the complete Klossia vaderbriani (GenBank OM891106) mitochondrial genome.
| Amplicon | Primer name | Primer sequence | Anneal temperature (°C) | Amplicon size (bp) | References |
|---|---|---|---|---|---|
| Fragment 1 (COIII) | Api_LSUE_F | 5′‐GGTAAGACCCTGAGCACCT‐3′ | 63 | 1552 | Léveillé et al. 2019 |
| Api_RNA10_R | 5′‐GCGGTTAAYCTTWCCTWTTCCTTAC‐3′ | Zeldenrust et al. 2025 | |||
| Fragment 2 | Api_LSUG_F | 5′‐TTGAGRCAGTTTGTTCCCTATCT‐3′ | 64 | 1651 | Léveillé et al. 2019 |
| Api_LSUF_R | 5′‐ACCTGTTATCCCCGGCGWA‐3′ | ||||
| Fragment 3 (COI) | Api_LSUF_F | 5′‐GTWCGCCGGGGATAACAGGT‐3′ | 61 | 1731 | Léveillé et al. 2019 |
| Api_RNA8_R | 5′‐CYGGGTATCCAATCCRGT‐3′ | Designed for this study | |||
| Fragment 4 (CytB) | Api_RNA8_F | 5′‐CACYGGATTGGATACCCRG‐3′ | 63 | 1600 | Léveillé et al. 2019 |
| Api_RNA10_F | 5′‐GTAAGGAAWAGGWAAGRTTAACCGC‐3′ | ||||
| Fragment 5 | Api_Uni_COI_F | 5′‐TGGGCHCAYCAYATGATGAC‐3′ | 64 | 1282 | Léveillé et al. 2020 |
| Api_RNA18_F | 5′‐TYGGTATTGCATGCCTGGT‐3′ | Zeldenrust et al. 2026 | |||
| Fragment 6 | Api_LSUE_R a | 5′‐AGGTGCTCAGGGTCTTACCG‐3′ | 65 | 1342 | Léveillé et al. 2019 |
| Haem_RNA18_R | 5′‐ACCAGGCATGCAATACCGAA‐3′ | ||||
| Fragment 7 | Api_LSUG_R | 5′‐AGATAGGGAACAAACTGYCTCAA‐3′ | 66 | 2093 | Léveillé et al. 2019 |
| Api_SSUE_R | 5′‐CGTGACGAGCGGTGTGT‐3′ | ||||
| Fragment 8 | Kloss_MT_2200R | 5′‐GAATGAAATACGCTAGCATGGAA‐3′ | 62 | 280 | Designed for this study |
| Cocci_RNA5_F | 5′‐CRCAGCTGTWGATGGATGCTT‐3′ |
Note: All reactions used Platinum SuperFi Master Mix. All annealing temperatures were calculated using Thermo Fisher Scientific's SuperFi annealing temperature calculator (www.thermofisher.com/tmcalculator).
Same primer sequence as “Hep_COB‐1797R” of Léveillé et al. (2014).
All K. helicina and K. razorbacki PCR products were separated using a 1.0%–1.4% agarose gel with 1× TAE buffer (50 mL) and 2 μL of ethidium bromide dye (10 mg/mL, w/v); bands were visualized using ultraviolet transillumination essentially as described by Zeldenrust and Barta (2021). PCR products generated using DNA extracted from T. hispidus specimens were mixed with loading dye prior to electrophoretic separation using a submarine 1.0%–1.25% (w/v) agarose gel with 1× TAE buffer (50 mL) and 0.1% (v/v) GelGreen nucleic acid stain (Biotium, Fremont, California, USA); gels were examined using an LED Blue Box Standard Transilluminator (Southern Biological Pty Ltd., Knoxfield, Victoria, Australia) as described by Zeldenrust et al. (2025). All amplicon sizes were estimated by comparison with a GeneRuler 1 kb Plus DNA ladder (Thermo Fisher Scientific). Bands of expected size were excised and extracted as described previously (Zeldenrust and Barta 2021).
After extraction, some reactions in the generation of the K. helicina and K. razorbacki mt genomes required re‐amplification of the primary PCR product to generate enough material for Sanger sequencing. Other than the use of a PCR product as template, these PCR reactions, subsequent PCR product separation and gel extraction were conducted as described above, albeit with one or more internal primer sites being used to generate a hemi‐nested or nested amplicon. These re‐amplification reactions, including primers used, are indicated in Tables 1 and 2 by the fragment number that provided the primary amplicon material used as template followed by a decimal point and an additional number representing the nested product.
Gel‐extracted PCR products were sequenced using an Applied Biosystems 3730 DNA Analyzer (Applied Biosystems Inc., Foster City CA, USA) by the Molecular Biology Unit of the Laboratory Services Division, University of Guelph (Guelph ON, Canada). Longer amplicons of K. helicina and K. razorbacki required internal sequencing primers to complete contig generation (see Tables 4 and 5).
TABLE 4.
Additional sequencing primers used to Sanger sequence the Klossia razorbacki mitochondrial genome.
| Klossia razorbacki amplicon fragment | Primer name | Primer sequence | References |
|---|---|---|---|
| Fragment 2 | Api_LSUF_F | 5′‐GTWCGCCGGGGATAACAGGT‐3′ | Léveillé, Bland, et al. 2019 |
| Adel_mt_LSUG_R2 | 5′‐TTCTAACGGTGAACTCTCAT‐3′ | Designed for this study | |
| Api_RNA8_F | 5′‐CACYGGATTGGATACCCRG‐3′ | Léveillé, Bland, et al. 2019 | |
| Api_RNA8_R | 5′‐CYGGGTATCCAATCCRGT‐3′ | Designed for this study | |
| Api_LSUE_F | 5′‐GGTAAGACCCTGAGCACCT‐3′ | Léveillé, Bland, et al. 2019 | |
| Cocci_MT‐WG‐R | 5′‐GCAGCTGTAGATGGATGCTT‐3′ | Ogedengbe et al. 2014 | |
| Adel_RNA15_R a | 5′‐TWTGWAACACACTTCCCTTCT‐3′ | Léveillé et al. 2020 | |
| Api_SSUE_R | 5′‐CGTGACGAGCGGTGTGT‐3′ | Léveillé, Bland, et al. 2019 | |
| Kloss_CytB_201F | 5′‐CGTGAAATAGGAAGTGGTTGGT‐3′ | Léveillé, Bland, et al. 2019 | |
| Fragment 3.1 | Api_RNA18_F | 5′‐TYGGTATTGCATGCCTGGT‐3′ | Zeldenrust et al. 2026 |
| Fragment 4 | Api_LSUE_R | 5′‐AGGTGCTCAGGGTCTTACCG‐3′ | Léveillé, Bland, et al. 2019 |
TABLE 5.
Sequencing primers used to Sanger sequence the Klossia helicina mt genome.
| Klossia helicina amplicon | Primer name | Primer sequence | References |
|---|---|---|---|
| Fragment 1.1 | Api_LSUF_F | 5′‐GTWCGCCGGGGATAACAGGT‐3′ | Léveillé, Bland, et al. 2019 |
| COX1_500R | 5′‐CATRTGRTGDGCCCAWAC‐3′ | El‐Sherry et al. 2013 | |
| Eim_mt_RNA19_R | 5′‐GTGAGTTCGCATGTTTACGAGAT‐3′ | Kruth et al. 2020 | |
| Api_LSUE_F | 5′‐GGTAAGACCCTGAGCACCT‐3′ | Léveillé, Bland, et al. 2019 | |
| Fragment 1.2 | Api_LSUG_R | 5′‐AGATAGGGAACAAACTGYCTCAA‐3′ | Léveillé, Bland, et al. 2019 |
| Api_RNA10_R | 5′‐GCGGTTAAYCTTWCCTWTTCCTTAC‐3′ | Zeldenrust et al. 2025 | |
| Fragment 3 | Api_SSUE_ F | 5′‐ACACACCGCTCGTCACG‐3′ | Designed for this study |
| Em‐WG‐MT_6219F | 5′‐GCATCCATCTACAGCTGCGG‐3′ | Ogedengbe et al. 2013 | |
| Api_RNA8_F | 5′‐CACYGGATTGGATACCCRG‐3′ | Léveillé, Bland, et al. 2019 | |
| Cocci_MT‐WG‐R | 5′‐GCAGCTGTAGATGGATGCTT‐3′ | Ogedengbe et al. 2014 | |
| Em‐WG‐MT_3658_F | 5′‐CTGGCGAGAAGGGAAGTGTG‐3′ | Ogedengbe et al. 2013 | |
| mtRNA4_72R | 5′‐CATGTTTATAACCTTACGGACT‐3′ | Designed for this study | |
| Api_LSUF_F | 5′‐GTWCGCCGGGGATAACAGGT‐3′ | Léveillé, Bland, et al. 2019 |
Note: Fragments refer to the same amplicon fragments as in Table 2.
2.4. Genome Assembly and Annotation
Chromatograms were assessed for quality and assembled using Geneious R10, version 10.2.6 for both K. helicina and K. razorbacki and Geneious Prime for K. vaderbriani (www.geneious.com; Kearse et al. 2012). The quality‐trimmed chromatograms were assembled to produce complete mitochondrial genomes; chromatograms overlapped a minimum of 94 bases with a pairwise sequence identity of 100% in all overlap regions. These resulting assembly contigs were searched against public sequence databases using the BLAST algorithm (Altschul et al. 1990) to identify similar sequences.
Annotation of the assembled mt genomes was accomplished by comparison with the comprehensively annotated mt genomes of a variety of apicomplexan taxa (Plasmodium falciparum M76611; Eimeria tenella NC_088458.1; Klossiella equi MH203050; Hepatozoon catesbianae KF894962). Annotated regions in these genomes were extracted individually and then assembled to the newly generated mt genome contigs to identify the protein coding sequences (CDS) and fragmented rDNA regions. Additionally, CDS regions were identified using the ORF‐finding utility in Geneious (using translation table 4; mt‐met) and then the putative start codon was identified by comparison with homologous CDS of other adeleorinid mt genomes. Fragmented rDNAs were annotated if the pairwise identity of the aligned rDNA fragment was 60% or greater to any previously annotated rDNA fragment from any of the reference genomes. This method was also applied to the publicly available mt genomes of Legerella nova (NC_088457; Na et al. 2024) and Hepatozoon sp. R29 (MT936929; Hrazdilová et al. 2021) for their comparisons to the arrangements of the mt genomes of Klossia species.
2.5. Genome Analysis—Comparison With Other Adeleorinid Protists
2.5.1. Pairwise Sequence Comparisons—Klossia Species
Pairwise sequence comparisons of the Klossia species mt COI, cytochrome c subunit III (COIII), and cytochrome b (CytB), were analyzed in Geneious using the “Multiple Align” tool (cost matrix 93%, gap open penalty 12, gap extension penalty 3; www.geneious.com, Kearse et al. 2012). The coding region of the COI gene for K. helicina was trimmed to the same length as the CDS regions from the other two Klossia species (1407 bp). The CytB coding region of both K. razorbacki and K. helicina was trimmed to the same length as K. vaderbriani (1140 bp).
2.5.2. Pairwise Sequence Comparisons—Adeleorinid Protists
Sequences from various adeleorinid protists were analyzed in Geneious using the “Translation Align” tool (cost matrix Blosum62, gap open penalty 11, gap extension penalty 3; www.geneious.com, Kearse et al. 2012). All COI sequences were trimmed to the same start codon and trimmed to the same length as the shortest COI sequence being used in the analysis (1407 bp). The two Hepatozoon species had a 3 bp deletion and were compared to the other sequences over 1404 bp. The COIII sequences were trimmed to the same start codon and had a length of 726 bp. The two Hepatozoon species had a 3 bp deletion and were compared to the other sequences over 723 bp. The CytB sequences were trimmed to the same start codon and trimmed to the same length as the shortest CytB sequence (1098 bp). The two Hepatozoon species had a 3 bp deletion and were compared to the other sequences over 1095 bp.
2.5.3. Translation and Amino Acid Sequence Comparisons—Adeleorinid Protists
The alignments from the pairwise sequence comparison of the adeleorinid protists were translated into amino acids (AA) using the “Translate” tool (translation table 4; mt‐met) after the removal of any remaining stop codons. AA sequences were then aligned using the “Multiple Alignment” tool (cost matrix Blosum62, gap open penalty 11, gap extension penalty 3; www.geneious.com, Kearse et al. 2012). COI AA sequences were trimmed to match the shortest sequence and pairwise identity and number of amino acid differences were calculated across 468 AAs (467 for Hepatozoon species, 1 AA deletion). COIII pairwise identity and number of amino acid differences were calculated across 241 AAs (240 for Hepatozoon species, 1 AA deletion). Stop codons were removed from the AA comparisons and all COIII AA sequences were trimmed to the same start codon. CytB AA sequences were trimmed to match the shortest sequence and calculated across 365 AAs (364 for Hepatozoon species, 1 AA deletion). Stop codons were removed from the AA comparisons and all CytB AA sequences were trimmed to the same start codon.
2.6. Mitochondrial Organization Comparison—Visual
The organization of complete mt genomes of adeleorinid protists and eimeriid coccidia varies greatly among genera (e.g., figure 8.1 in Léveillé 2019) and many published sequences do not have a known origin of replication. To align the mt genomes to analyze the organization and arrangement of CDS and rDNA fragments, a generic, uniform genome origin had to be selected. To best compare the genomes, the first base of the start codon of the mt COI was selected as base 1.
3. Results
3.1. Mitochondrial Genome
The mt genomes of all three Klossia species were found to be circular‐mapping and contain many fragmented rDNAs: 15 large subunit (LSU) rDNA, 12 small subunit (SSU) rDNA, and 8 unassigned rDNA were documented (Table 6). The mitochondrial genome of Klossia helicina was 6728 bp in length (NC_058857; Figure 1) and contained 3 CDS encoding COI, CytB, and COIII as well as many rDNA fragments (Table 6). The mt genome of Klossia razorbacki (NC_058856) was 6775 bp in length and had the same organization of its constitutive CDS and fragmented rDNA components. The mt genome of Klossia vaderbriani (OM891106) was also similar in its mt genome components and organization (Table 6) and was 6757 bp in length. The three Klossia species also shared the same organization of the CDS regions with minor variations in the lengths of the coding regions (Table 7).
TABLE 6.
Ribosomal DNA (rDNA) features of the mitochondrial genomes of Klossia helicina, Klossia razorbacki, and Klossia vaderbriani.
| Fragmented rDNA a | rRNA assignment a | Position b in Klossia helicina | Position b in Klossia razorbacki | Position b in Klossia vaderbriani | Sequence length (bp) |
|---|---|---|---|---|---|
| SSUA | SSU | 4461 → 4376 | 4492 → 4407 | 4477 → 4393 | 85 (K. vaderbriani)/86 (K. helicina, K. razorbacki) |
| SSUB | SSU | 4686 → 4800 | 4717 → 4831 | 4702 → 4816 | 115 |
| SSUD | SSU | 4335 → 4268 | 4366 → 4299 | 4352 → 4285 | 68 |
| SSUE | SSU | 682 → 721 | 677 → 716 | 682 → 721 | 40 |
| SSUF | SSU | 3861 → 3806 | 3860 → 3805 | 3862 → 3807 | 56 |
| LSUA | LSU | 4153 → 4109 | 4167 → 4123 | 4167 → 4123 | 45 (part 1 of 2) |
| 4536 → 4647 | 4567 → 4678 | 4552 → 4663 | 112 (part 2 of 2) | ||
| LSUB | LSU | 2012 → 1979 | 2007 → 1974 | 2012 → 1981 | 32 (K. vaderbriani)/34 (K. helicina, K. razorbacki) |
| LSUC | LSU | 6631 → 6651 | 6678 → 6698 | 6660 → 6680 | 21 |
| LSUD | LSU | 5046 → 5128 | 5078 → 5160 | 5063 → 5145 | 83 |
| LSUE | LSU | 5498 → 5691 | 5550 → 5741 | 5532 → 5725 | 192 (K. razorbacki)/194 (K. helicina, K. vaderbriani) |
| LSUF | LSU | 3786 → 3685 | 3785 → 3684 | 3787 → 3686 | 102 |
| LSUG | LSU | 5446 → 5342 | 5498 → 5394 | 5480 → 5376 | 105 |
| RNA 1 | LSU | 5288 → 5203 | 5320 → 5235 | 5305 → 5220 | 86 |
| RNA 2 | LSU | 3923 → 3967 | 3921 → 3965 | 3924 → 3968 | 45 |
| RNA 3 | LSU | 4867 → 4944 | 4898 → 4975 | 4883 → 4960 | 78 |
| RNA 4 | — | 337 → 266 | 337 → 266 | 337 → 266 | 72 |
| RNA 5 | SSU | 1892 → 1980 | 1887 → 1975 | 1892 → 1980 | 89 |
| RNA 6 | LSU | 4168 → 4220 | 4182 → 4234 | 4182 → 4234 | 53 |
| RNA 7 | — | 506 → 584 | 501 → 579 | 506 → 584 | 79 |
| RNA 8 | SSU | 2106 → 2013 | 2101 → 2008 | 2106 → 2013 | 94 |
| RNA 9 | SSU | 6610 → 6577 | 6657 → 6624 | 6639 → 6606 | 34 (partial) |
| RNA 10 | LSU | 443 → 492 | 441 → 490 | 443 → 492 | 50 (partial) |
| RNA 11 | LSU | 4083 → 4029 | 4097 → 4043 | 4097 → 4043 | 55 |
| RNA 12 (GenBank SSU/2) | SSU | 650 → 593 | 645 → 588 | 650 → 593 | 58 |
| RNA 13 | LSU | 3901 → 3874 | 3899 → 3872 | 3902 → 3875 | 28 |
| RNA 14 | SSU | 4845 → 4805 | 4876 → 4836 | 4861 → 4821 | 41 |
| RNA 15 | — | 2116 → 2144 | 2119 → 2147 | 2118 → 2146 | 29 |
| 4653 → 4674 | 4684 → 4705 | 4669 → 4690 | 22 | ||
| RNA 16 | — | 3993 → 4010 | 3995 → 4012 | 4008 → 4025 | 18 |
| RNA 17 | SSU | 4531 → 4492 | 4562 → 4523 | 4547 → 4508 | 40 |
| RNA 18 | LSU | 4376 → 4352 | 4407 → 4383 | 4392 → 4368 | 25 |
| RNA 19 | SSU | 5460 → 5489 | 5512 → 5541 | 5494 → 5523 | 30 |
| RNA 20 | — | 6487 → 6524 | 6534 → 6571 | 6516 → 6553 | 38 |
| RNA 21 | — | 3682 → 3660 | 3681 → 3659 | 3683 → 3661 | 23 |
| RNA 22 | — | 5338 → 5303 | 5370 → 5335 | 5355 → 5320 | 36 |
| RNA 23 t | — | 5167 → 5135 | 5199 → 5167 | 5184 → 5152 | 33 |
Note: Sequence length was the same for all 3 Klossia species unless otherwise noted.
Naming and assignments based on Feagin et al. (2012).
Ascending numbers indicate forward direction and descending numbers indicate reverse direction on mt genome.
FIGURE 1.
The circular‐mapping, mitochondrial genome of the genotype, Klossia helicina (NC_058857–6728 bp), illustrating the three protein coding (CDS) regions (cytochrome c oxidase subunit I [COI] and subunit III [COIII], and cytochrome b [CytB]) and the 37 rDNA fragments encoded by this genome (the subset of rDNA fragments with unique colors in the legend are similarly colored in Figures 2 and 3; the remaining rDNA fragments are colored similarly with black/white striping but are not shown in the other figures). Three repeat regions are annotated; the smaller unique annotated region an inverted repeat interpreted as a potential origin of replication, and the two similarly sized larger repeats are near‐perfect regions at upstream of, and continuing into, the CDS regions of CytB and COIII. Both Klossia razorbacki (NC_058856—6775 bp) and Klossia vaderbriani (OM891106–6757 bp) share the same gene content and organization as illustrated for K. helicina. Initial genome images were produced by Geneious (www.geneious.com; Kearse et al. 2012).
TABLE 7.
Features of the three mitochondrial protein coding CDS regions, cytochrome c oxidase subunit I (COI), cytochrome c oxidase subunit III (COIII), and cytochrome b (CytB) of Klossia razorbacki, Klossia helicina, and Klossia vaderbriani.
| Sequence position a (bp) | Sequence length (bp) | Translation start codon | Translation stop codon | |
|---|---|---|---|---|
| COI | ||||
| Klossia razorbacki | 2252 → 3658 | 1407 | ATT | TAA |
| Klossia helicina | 2252 → 3805 | 1554 | ATT | TAG |
| Klossia vaderbriani | 2253 → 3659 | 1407 | ATT | TAA |
| COIII | ||||
| Klossia razorbacki | 6486 → 5761 | 726 | ATT | TAA |
| Klossia helicina | 6438 → 5713 | 726 | ATT | TAA |
| Klossia vaderbriani | 6467 → 5742 | 726 | ATT | TAA |
| CytB | ||||
| Klossia razorbacki | 1797 → 643 | 1155 | ATT | TAG |
| Klossia helicina | 1801 → 572 | 1230 | ATT | TAG |
| Klossia vaderbriani | 1801 → 662 | 1140 | ATT | TAG |
Ascending numbers indicate forward direction and descending numbers indicate reverse direction on mt genome.
The mt genome of K. helicina shared 94.2% pairwise identity overall to the mt genome of K. razorbacki and 96.2% pairwise identity with K. vaderbriani. The complete mt genomes of the K. vaderbriani and K. razorbacki shared a 95.4% pairwise identity overall. The pairwise identities and number of single nucleotide differences in the CDS regions encoding COI, COIII and CytB of the three Klossia species are summarized in Table 8. In all of the mt genomes of the Klossia species, 83 bp repeat regions starting 48 bp upstream of the start codons of the CytB and COIII CDS and terminating 35 bp into each CDS were present. The first 11 amino acids encoded by the CytB and COIII CDS in all three Klossia spp. were identical in these repeat regions.
TABLE 8.
Interspecific genetic distances and pairwise sequence comparisons of the three mitochondrial CDS regions (cytochrome c oxidase subunit I (COI), cytochrome c oxidase subunit III (COIII) and cytochrome B (CytB)) from all Klossia species for which there is a complete mitochondrial genome available. Jukes‐Cantor genetic distances (K) are found above the diagonal and percent identity and number of single nucleotide differences (SND) below diagonal.
| Klossia vaderbriani | Klossia razorbacki | Klossia helicina | |
|---|---|---|---|
| COI—1407 bp | |||
| Klossia vaderbriani | 0.0538 | 0.0416 | |
| Klossia razorbacki |
94.81% 73 |
0.0692 | |
| Klossia helicina |
95.95% 57 |
93.39% 93 |
|
| COIII—726 bp | |||
| Klossia vaderbriani | 0.0469 | 0.0396 | |
| Klossia razorbacki |
95.45% 33 |
0.0513 | |
| Klossia helicina |
96.14% 28 |
95.04% 36 |
|
| CytB—1140 bp | |||
| Klossia vaderbriani | 0.0396 | 0.0304 | |
| Klossia razorbacki |
96.14% 44 |
0.0603 | |
| Klossia helicina |
97.02% 34 |
94.21% 66 |
|
Note: The coding region of the COI gene for Klossia helicina was trimmed to the same length as the CDS regions from the other two Klossia species (1407 bp). The CytB coding region of both Klossia razorbacki and Klossia helicina was trimmed to the same length as K. vaderbriani (1140 bp).
The mitochondrial CDS regions of the three Klossia species were more similar to one another than to the mt genomes of other adeleorinid parasites (Tables 9, 10 and 11). Among the adeleorinid taxa outside of the genus Klossia examined, the recently generated mt genome of Legerella nova (see Na et al. 2024) was closest genetically to the invertebrate–infecting monoxenous Klossia species.
TABLE 9.
Pairwise sequence comparisons, number of single nucleotide differences (SND) and Jukes–Cantor interspecific genetic distances (K) from the mitochondrial cytochrome c oxidase subunit I (COI) CDS region of Klossia species and related adeleorinid coccidia are found above the diagonal.
| Klossia vaderbriani | Klossia razorbacki | Klossia helicina | Legerella nova | Klossiella equi | Haemogregarina sp. Genotype B | Hepatozoon catesbianae | Hepatozoon griseisciuri Genotype B | |
|---|---|---|---|---|---|---|---|---|
|
Klossia vaderbriani |
94.81% 73 0.0538 |
95.95% 57 0.0416 |
90.55% 133 0.1010 |
81.95% 254 0.2065 |
70.15% 421 0.3818 |
71.50% 401 0.3595 |
70.58% 414 0.3746 |
|
|
Klossia razorbacki |
98.50% 7 |
93.39% 93 0.0692 |
89.69% 145 0.1109 |
81.59% 259 0.2112 |
70.36% 418 0.3783 |
70.79% 411 0.3711 |
70.43% 416 0.3770 |
|
|
Klossia helicina |
98.50% 7 |
99.57% 2 |
89.62% 146 0.1117 |
81.09% 266 0.2178 |
69.51% 430 0.3925 |
70.93% 409 0.3688 |
70.08% 421 0.3829 |
|
|
Legerella nova |
93.38% 31 |
94.02% 28 |
94.02% 28 |
80.38% 276 0.2274 |
69.65% 428 0.3901 |
70.08% 421 0.3829 |
69.58% 428 0.3912 |
|
|
Klossiella equi |
87.39% 59 |
87.61% 58 |
87.61% 58 |
86.97% 61 |
68.30% 447 0.4132 |
72.78% 383 0.3391 |
72.92% 381 0.3369 |
|
| Haemogregarina sp. Genotype B PQ009464 |
74.36% 120 |
74.36% 120 |
74.36% 120 |
72.44% 129 |
74.36% 120 |
63.89% 509 0.4953 |
63.89% 509 0.4953 |
|
|
Hepatozoon catesbianae |
75.85% 113 |
75.43% 115 |
75.43% 115 |
73.72% 123 |
75.85% 113 |
66.67% 156 |
87.46% 176 0.1372 |
|
|
Hepatozoon griseisciuri Genotype B MK452389 |
76.92% 108 |
76.50% 110 |
76.50% 110 |
74.79% 118 |
76.92% 108 |
66.45% 157 |
95.50% 21 |
Note: These COI sequences were trimmed to the same start codon and trimmed to the same length as the shortest COI sequence of Klossia vaderbriani and Klossia razorbacki (1407 bp). The two Hepatozoon species had a 3 bp deletion and were compared to the other sequences over 1404 bp. Amino acid (AA) percent identity and number of differences (below diagonal) were calculated across 468 AAs (467 for Hepatozoon species, 1 AA deletion). COI AA sequences were trimmed to match the shortest sequence. Stop codons were removed from the AA comparisons and all COI AA sequences were trimmed to the same start codon.
TABLE 10.
Pairwise sequence comparisons, number of single nucleotide differences (SND) and Jukes‐Cantor interspecific genetic distances (K) from the mitochondrial cytochrome c oxidase subunit III (COIII) CDS region of Klossia species and related adeleorinid coccidia are found above the diagonal.
| Klossia vaderbriani | Klossia razorbacki | Klossia helicina | Legerella nova | Klossiella equi | Haemogregarina sp. Genotype B | Hepatozoon catesbianae | Hepatozoon griseisciuri Genotype B | |
|---|---|---|---|---|---|---|---|---|
|
Klossia vaderbriani |
95.45% 33 0.0469 |
96.14% 28 0.0396 |
93.11% 50 0.0722 |
81.27% 136 0.2155 |
58.13% 304 0.6129 |
59.92% 291 0.5770 |
60.88% 284 0.5563 |
|
|
Klossia razorbacki |
97.93% 5 |
95.04% 36 0.0513 |
92.01% 58 0.0845 |
81.40% 135 0.2137 |
57.85% 306 0.6191 |
60.19% 289 0.5710 |
62.40% 273 0.5251 |
|
|
Klossia helicina |
97.10% 7 |
98.34% 4 |
91.87% 59 0.0860 |
80.99% 138 0.2192 |
57.44% 309 0.6286 |
58.40% 302 0.6105 |
60.88% 284 0.5563 |
|
|
Legerella nova |
97.51% 6 |
98.34% 4 |
98.34% 4 |
81.13% 137 0.2174 |
58.54% 301 0.6036 |
60.06% 290 0.5740 |
60.47% 287 0.5651 |
|
|
Klossiella equi |
87.14% 31 |
87.97% 29 |
87.97% 29 |
88.80% 27 |
59.09% 297 0.5913 |
61.29% 281 0.5477 |
61.98% 276 0.5335 |
|
| Haemogregarina sp. Genotype B PQ009464 |
53.94% 111 |
53.11% 113 |
53.94% 111 |
54.36% 110 |
52.28% 115 |
53.44% 338 0.7323 |
53.03% 341 0.7434 |
|
|
Hepatozoon catesbianae |
53.94% 111 |
53.94% 111 |
53.53% 112 |
53.36% 110 |
53.94% 111 |
46.47% 129 |
80.77% 139 0.2221 |
|
| Hepatozoon griseisciuri Genotype B MK452389 |
53.53% 112 |
53.94% 111 |
53.53% 112 |
53.36% 110 |
53.53% 112 |
44.40% 134 |
90.83% 22 |
Note: These COIII sequences were trimmed to the same start codon and had a length of 726 bp. The two Hepatozoon species had a 3 bp deletion and were compared to the other sequences over 723 bp. Amino acid (AA) percent identity and number of differences (below diagonal) were calculated across 241 AAs (240 for Hepatozoon species, 1 AA deletion). Stop codons were removed from the AA comparisons and all COIII AA sequences were trimmed to the same start codon.
TABLE 11.
Pairwise sequence comparisons, number of single nucleotide differences (SND) and Jukes‐Cantor interspecific genetic distances (K) from the mitochondrial cytochrome B (CytB) CDS region of Klossia species and related adeleorinid coccidia are found above the diagonal. Amino acid (AA) percent identity and number of differences are found below the diagonal.
| Klossia vaderbriani | Klossia razorbacki | Klossia helicina | Legerella nova | Klossiella equi | Haemogregarina sp. Genotype B | Hepatozoon catesbianae | Hepatozoon griseisciuri Genotype B | |
|---|---|---|---|---|---|---|---|---|
|
Klossia vaderbriani |
96.08% 43 0.0402 |
96.99% 33 0.0307 |
93.08% 76 0.0726 |
82.51% 192 0.1991 |
63.93% 396 0.4917 |
66.21% 371 0.4508 |
66.30% 370 0.4491 |
|
|
Klossia razorbacki |
99.18% 3 |
94.17% 64 0.0607 |
90.89% 100 0.0971 |
81.79% 200 0.2087 |
64.07% 395 0.4900 |
65.12% 383 0.4710 |
65.39% 380 0.4659 |
|
|
Klossia helicina |
96.99% 11 |
96.16% 14 |
91.89% 89 0.0858 |
81.42% 204 0.2135 |
64.12% 394 0.4882 |
65.57% 378 0.4625 |
65.85% 375 0.4575 |
|
|
Legerella nova |
96.71% 12 |
96.16% 14 |
95.34% 17 |
83.24% 184 0.1897 |
64.53% 390 0.4813 |
65.76% 376 0.4591 |
66.67% 366 0.4425 |
|
|
Klossiella equi |
87.67% 45 |
88.22% 43 |
86.58% 49 |
88.49% 42 |
62.75% 409 0.5149 |
65.57% 378 0.4625 |
66.67% 366 0.4425 |
|
|
Haemogregarina sp. Genotype B PQ009464 |
62.47% 137 |
62.19% 138 |
63.01% 135 |
62.47% 137 |
61.10% 142 |
58.97% 451 0.5975 |
59.43% 446 0.5874 |
|
|
Hepatozoon catesbianae |
66.30% 123 |
66.03% 124 |
66.30% 123 |
66.85% 121 |
66.03% 124 |
58.90% 150 |
86.21% 151 0.1535 |
|
| Hepatozoon griseisciuri Genotype B MK452389 |
65.75% 125 |
65.21% 127 |
65.75% 125 |
66.30% 123 |
65.48% 126 |
58.63% 151 |
94.51% 20 |
Note: These CytB sequences were trimmed to the same start codon and trimmed to the same length as the shortest CytB sequence while maintaining the alignment (1098 bp). The two Hepatozoon species had a 3 bp deletion and were compared to the other sequences over 1095 bp. Amino acid (AA) percent identity and number of differences were calculated across 365 AAs (364 for Hepatozoon species, 1 AA deletion). CytB AA sequences were trimmed to match the shortest sequence. Stop codons were removed from the AA comparisons and all CytB AA sequences were trimmed to the same start codon.
4. Discussion
The generation of the complete mt genomes of 3 Klossia species, K. helicina (the type species), K. razorbacki and K. vaderbriani, represented the first complete mt genome sequence data from any adeleid protist. The organization of the fragmented rDNAs in these mt genomes was conserved among all Klossia species but unique among other adeleorinid parasites sequenced thus far. The nuclear 18S rDNA and mt sequence data from these species will contribute to better resolution of the phylogenetic relationships within the Adeleorina and the Apicomplexa as a whole.
Nuclear 18S rDNA sequences have been used traditionally as a locus for determining the relatedness of parasites within the Apicomplexa. This locus was favored based on its ubiquity among eukaryotic organisms, generally high copy number within the nuclear genome, and the availability of conserved eukaryote‐specific regions suitable for PCR primer design (e.g., Medlin et al. 1988). Due to the ease of amplification, this locus has the largest number and diversity of publicly available sequences allowing for taxonomically diverse datasets to examine phylogenetic relationships among members of the Apicomplexa.
However, paralogous copies of the nuclear 18S rDNA locus have been found in some apicomplexan genera such as Plasmodium (see McCutchan et al. 1988) or Eimeria (see El‐Sherry et al. 2013) making assumptions of homology sometimes challenging. Further, interspecific variation of the gene is frequently too limited to provide robust estimates of species relatedness among closely related species within a genus; worse yet, genetic distance between paralogous copies of 18S rDNA within a single parasite can sometimes exceed the genetic distance between homologous copies of different species (El‐Sherry et al. 2013). Attempts to use the nuclear 18S rDNA locus for inferring relationships among adeleorinid taxa have suffered from both multiple, paralogous copies (e.g., Léveillé, Baneth, and Barta 2019 for Hepatozoon canis) and lack of resolution because of limited divergence among adeleorinid taxa (e.g., Barta et al. 2012). Clearly, a genetic locus with a more suitable (faster) rate of divergence and more reliable assumption of homology is desirable in such cases.
Mitochondrial (mt) cytochrome c oxidase subunit I (COI) has been used for estimating phylogenetic relationships and assessing species delimitation across a wide range of taxa (Herbert et al. 2003). Sequences from the COI CDS have been found to discriminate between closely related species because there is a higher level of interspecific variation at this locus than is found in the nuclear 18S rDNA regions (Ogedengbe et al. 2011, 2018). At 1%–2% divergence per million years, mt COI evolves much more rapidly than nuclear 18S rDNA (Herbert et al. 2003). However, within the phylum Apicomplexa, the rapidly evolving nature of the mt COI makes this locus unsuitable for inferring more ancient relationships present in this early diverging eukaryotic phylum perhaps due to substitution saturation, particularly of the third codon position, as reported between coccidia in the families Sarcocystidae and Eimeriidae (see Ogedengbe et al. 2018).
The mt COIII locus has been examined also as a potential target for barcoding (Léveillé et al. 2021). It was shown that in the adeleorinid genus Hepatozoon, the mt COIII locus has more variation (larger percent pairwise differences) among closely related Hepatozoon species (e.g., among frog‐infecting parasites compared to between parasites of amphibia and mammals) than the traditional barcoding target, COI (Léveillé et al. 2020, 2021). Interestingly, the Klossia spp. mt COIII locus did not demonstrate the increased pairwise differences between species that was observed in the related adeleorinid genus Hepatozoon. These data show that examining only one locus is perhaps unsuitable for differentiating and determining the relatedness of adeleorinid species as was found for eimeriorinid coccidia (Ogedengbe et al. 2018). Phylogenetic reconstructions using a combined, multi‐genome dataset analyzed with appropriate locus‐specific nucleotide substitution models are better able infer both more ancient and more recent evolutionary events better than trees based on either locus independently.
Pairwise sequence comparisons of the CDS regions reflect the phylogenetic placement of these Klossia species among the Adeleorina (see Na et al. 2024; Zeldenrust et al. 2025); however, their affinities to the family Adeleidae can only be tested appropriately with additional molecular data from these monoxenous parasites of arthropods. Unfortunately, there remains a paucity of sequences from mt genomes representing the diversity of adeleorinid taxa described to date. Consequently, the nuclear 18S rDNA region is often used as a genotyping region with which to examine relatedness among species.
Most adeleorinid genera infect invertebrate animals for the duration or part of their life cycle (sans Klossiella spp.) (Barta 2000). Multicellular invertebrates appeared roughly 800–650 million years ago (Mya), meaning that the existing protists may have begun to parasitize invertebrates soon after they arose. The ancient origins of parasites that infect invertebrates have provided ample opportunity for extensive mt genome reorganizations over millions of years. The comparatively “recent” divergence of vertebrates (450 Mya) is reflected in the limited genome reorganizations among their associated monoxenous parasites, the eimeriid coccidia. That said, members of the Sarcocystidae (Toxoplasma gondii and its relatives) display a bewildering array of mt genome organizations (Namasivayam et al. 2021) despite the comparatively recent origins of their vertebrate hosts. The underlying mechanisms driving such diversity remain unclear.
The arrangement and organization of the Klossia spp. mt genomes is unique among apicomplexan mt genomes sequenced to date. The organization and content of the mt genome of the Klossia species are most similar to the mt genome of Legerella nova (family Legerellidae), a monoxenous adeleorinid that infects Glomeris species (family Glomeridae, pill millipede). The organization of both the CDS coding regions and the rDNA fragments between L. nova and the Klossia species differ only in the orientation of RNA14 in L. nova and some differences in the lengths of these features (see Figure 2). Interestingly, the heteroxenous Haemogregarina species also share the same organization and arrangement of the Klossia species mt genomes, with minor variations in the lengths of some rDNA and CDS regions (Figure 2) (see Léveillé 2019). However, the Haemogregarina species lack both RNA11 and RNA15 rDNA fragments that are present in the Klossia species and Legerella nova mt genomes. Perhaps not surprisingly, the Annelida (definitive hosts of Haemogregarina spp.) and Mollusca (definitive hosts of Klossia species) are relatively closely related to one another and share a most recent common ancestor to other invertebrate hosts used by, for example, Legerella species.
FIGURE 2.
Mitochondrial genome arrangements of adeleorinid protists highlighting fragmented ribosomal DNAs and coding regions. CDS regions (cytochrome c oxidase subunit I [COI] and subunit III [COIII], and cytochrome b [CytB]) and a subset of rDNA fragments are illustrated. A translocation containing multiple rDNA fragments is highlighted for Klossiella equi. RNA14 demonstrates a reversal of coding direction on the Legerella nova genome compared with the other adeleorinid taxa. Initial genome images were produced by Geneious (www.geneious.com; Kearse et al. 2012).
The similarity in the contents and organization of the Klossia and Legerella mt genomes makes some evolutionary sense because their respective hosts also share a relatively “recent” common ancestor. The validity of the family Legerellidae could be questioned based on the phylogenetic analyses from Na et al. (2024) and Zeldenrust et al. (2025). In the last analysis, Legerella nova was shown to be the sister taxon to a clade of Klossia species within a paraphyletic Adeleidae (including a number of Obvallatus spp.); a final decision on the validity of the family Legerellidae must await additional sequence data (especially mt genome sequences) from a variety of taxa currently residing in the family Adeleidae (see Barta 2000; Zeldenrust et al. 2025).
Apicomplexan parasites mirror the evolutionary history of their definitive hosts that, for heteroxenous adeleorinid parasites, are invertebrates, typically acquiring infections through hematophagous feeding (Votýpka et al. 2017). The content and organization of Hepatozoon spp. mt genomes seems to be conserved among species sharing the same type of definitive host (e.g., mosquitoes vs. mites). For example, Hepatozoon castesbianae and Hepatozoon clamatae both have mosquito definitive hosts. The content and organization of these mosquito‐infecting Hepatozoon species are identical with minor variations in the lengths in some CDS and rDNA regions (Figure 3). The same pattern can be seen with mite‐infecting Hepatozoon species, Hepatozoon griseisciuri genotype B (mite‐squirrel) and Hepatozoon sp. R29 (mite‐rat) (Figure 3). Hepatozoon sp. R29 is used to represent all of the complete Hepatozoon mt genomes generated by Hrazdilová et al. (2021) in Figure 3 because they were all the same in both content and organization of their CDS and rDNA fragments. However, within one species, Hepatozoon griseisciuri, there is a flip and translocation of RNA2 in genotype A that is, thus far, unique to this genotype when compared to the other mite‐infecting Hepatozoon species (Figure 3). There are only 10 complete circular‐mapping mt genomes available for Hepatozoon species, representing only 2 types of vectors, mosquitos and mites. With more sequence data from a wider variety of Hepatozoon species infecting different definitive hosts like ticks and fleas, we may see an increase in the diversity of mitochondrial genome arrangements. Some Hepatozoon species may not have a complete mt genome as was demonstrated for Hepatozoon canis (Léveillé, Baneth, and Barta 2019) or may be more than double the length of a typical mitochondrial genome sequence as seen in an unnamed Hepatozoon species from a brown spotted pit viper (15,349 bp) (Léveillé 2019).
FIGURE 3.
Mitochondrial genome arrangements of Hepatozoon species infecting two different classes of definitive host (Insecta and Arachnida). CDS regions (cytochrome c oxidase subunit I [COI] and subunit III [COIII], and cytochrome b [CytB]) and a subset of rDNA fragments are illustrated. All Hepatozoon species with an acarine definitive host shared the same genome organization with the exception of RNA2 that demonstrated a translocation in one of the two Hepatozoon griseisciuri genotypes (asterisk). Hepatozoon species infecting mosquito definitive hosts shared conserved genome organizations, but their genomes were highly divergent compared with those of the mite‐infecting Hepatozoon species. Initial genome images were produced by Geneious (www.geneious.com; Kearse et al. 2012).
We expected that the Klossia species mt genomes would be more similar in organization to all of the monoxenous mt genomes including that of Klossiella equi. Klossiella species are the only monoxenous adeleorinid parasites that possess vertebrate definitive hosts. Klossia species overall share a more similar mt genome organization to that of the monoxenous Legerella nova and heteroxenous Haemogregarina spp. rather than the more closely related monoxenous Klossiella equi. Klossiella equi is the only monoxenous adeleorinid parasite (thus far) that has a translocation of seven rDNA fragments (see Figure 2). As more sequences from members of the genus Klossiella are generated, we may see the same positioning of these rDNA fragments or a completely new rearrangement for all Klossiella species. Until more sequence data are available, this remains unknown.
Funding
This work was supported by the Natural Sciences and Engineering Research Council of Canada (400566) and Ontario Veterinary College, University of Guelph.
Acknowledgments
This research was supported by a Discovery Grant to J.R.B. from the Natural Sciences and Engineering Research Council of Canada (NSERC‐DG #400566). E.G.Z. is supported by an OVC PhD scholarship from the Ontario Veterinary College.
Data Availability Statement
All sequences have been submitted and published in NCBI GenBank—accession numbers in MS.
References
- Altschul, S. F. , Miller W., Myers E. W., and Lipman D. J.. 1990. “Basic Local Alignment Search Tool.” Journal of Molecular Biology 215, no. 3: 403–410. 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
- Anton, M. 2010. Terrestrial Snails. Molluskman.com: The Website for Houston Mollusks. https://molluskman.com/field‐guide. [Google Scholar]
- Barta, J. R. 2000. “Suborder Adeleorina Léger, 1911.” In An Illustrated Guide to the Protozoa 2nd Edition, edited by Lee J. J., Leedale G. F., and Bradbury P. C., 305–318. Society of Protozoologists. https://protistologists.org/publications/illustrated‐guide‐to‐the‐protozoa/. [Google Scholar]
- Barta, J. R. , Ogedengbe J. D., Martin D. S., and Smith T. G.. 2012. “Phylogenetic Position of the Adeleorinid Coccidia (Myzozoa, Apicomplexa, Coccidia, Eucoccidiorida, Adeleorina) Inferred Using 18S rDNA Sequences.” Journal of Eukaryotic Microbiology 59, no. 2: 171–180. 10.1111/j.1550-7408.2011.00607.x. [DOI] [PubMed] [Google Scholar]
- El‐Sherry, S. , Ogedengbe M. E., Hafeez M. A., and Barta J. R.. 2013. “Divergent Nuclear 18S rDNA Paralogs in a Turkey Coccidium, Eimeria meleagrimitis, Complicate Molecular Systematics and Identification.” International Journal for Parasitology 43, no. 8: 679–685. 10.1016/j.ijpara.2013.03.005. [DOI] [PubMed] [Google Scholar]
- Feagin, J. E. , Harrell M. I., Lee J. C., et al. 2012. “The Fragmented Mitochondrial Ribosomal RNAs of Plasmodium falciparum .” PLoS One 7: e38320. 10.1371/journal.pone.0038320. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Folmer, O. , Black M., Hoeh W., Lutz R., and Vrijenhoek R.. 1994. “DNA Primers for Amplification of Mitochondrial Cytochrome c Oxidase Subunit I From Diverse Metazoan Invertebrates.” Molecular Marine Biology and Biotechnology 3, no. 5: 294–299. [PubMed] [Google Scholar]
- Herbert, P. D. N. , Ratnasingham S., and deWaard J. R.. 2003. “Barcoding Animal Life: Cytochrome c Oxidase Subunit 1 Divergences Among Closely Related Species.” Proceedings of the Royal Society of London. Series B: Biological Sciences 270, no. Suppl. 1: S96–S99. 10.1098/rsbl.2003.0025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hesse, E. 1911. “Sur le genre Adelea a propos d'une nouvelle coccidie des oligochètes.” Archives de Zoologie Expérimentale et Générale 5, no. 7: xv–xx. [Google Scholar]
- Hrazdilová, K. , Červená B., Blanvillian C., Foronda P., and Modrý D.. 2021. “Quest for the Type Species of the Genus Hepatozoon—Phylogenetic Position of Hemogregarines of Rats and Consequences for Taxonomy.” Systematics and Biodiversity 19, no. 6: 622–631. 10.1080/14772000.2021.1903616. [DOI] [Google Scholar]
- Imai, R. K. , and Barta J. R.. 2019. “Distribution and Abundance of Eimeria Species in Commercial Turkey Flocks Across Canada.” Canadian Veterinary Journal 60, no. 2: 153–159. [PMC free article] [PubMed] [Google Scholar]
- Kearse, M. , Moir R., Wilson A., et al. 2012. “Geneious Basic: An Integrated and Extendable Desktop Software Platform for the Organization and Analysis of Sequence Data.” Bioinformatics 28, no. 12: 1647–1649. 10.1093/bioinformatics/bts199. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Korbie, D. J. , and Mattick J. S.. 2008. “Touchdown PCR for Increased Specificity and Sensitivity in PCR Amplification.” Nature Protocols 3, no. 9: 1452–1456. 10.1038/nprot.2008.133. [DOI] [PubMed] [Google Scholar]
- Kruth, P. S. , Michel C., Amery‐Gale J., and Barta J. R.. 2020. “Full Mitochondrial Genome and Nuclear 18S rDNA Sequences Refine the Taxonomic Placement of Choleoeimeria taggarti n. Comb. From the Prostate of Antechinus flavipes (Yellow‐Footed Antechinus).” Journal of Parasitology 106, no. 1: 71–81. 10.1645/19-57. [DOI] [PubMed] [Google Scholar]
- Léveillé, A. N. 2019. Scratching the Surface: Diversity Among the First Sequenced Extrachromosomal Genomes of Parasites in the Suborder Adeleorina (Apicomplexa) With a Focus on Hepatozoon Species, 1–241. University of Guelph. http://hdl.handle.net/10214/16973. [Google Scholar]
- Léveillé, A. N. , Baneth G., and Barta J. R.. 2019. “Next Generation Sequencing From Hepatozoon canis (Apicomplexa: Coccidia: Adeleorina): Complete Apicoplast Genome and Multiple Mitochondrion‐Associated Sequences.” International Journal for Parasitology 49, no. 5: 375–387. 10.1016/j.ijpara.2018.12.001. [DOI] [PubMed] [Google Scholar]
- Léveillé, A. N. , Bland S. K., Carlton K., et al. 2019. “ Klossiella equi Infecting the Kidneys of Ontario Horses: Life Cycle Features and Multilocus Sequence‐Based Genotyping Confirm the Genus Klossiella Belongs in the Adeleorina (Apicomplexa: Coccidia).” Journal of Parasitology 105, no. 1: 29–40. 10.1645/18-80. [DOI] [PubMed] [Google Scholar]
- Léveillé, A. N. , El Skhawy N., and Barta J. R.. 2020. “Multilocus Sequencing of Hepatozoon Cf. Griseisciuri Infections in Ontario Eastern Gray Squirrels ( Sciurus carolinensis ) Uncovers Two Genotypically Distinct Sympatric Parasite Species.” Parasitology Research 119, no. 2: 713–724. 10.1007/s00436-019-06583-5. [DOI] [PubMed] [Google Scholar]
- Léveillé, A. N. , Ogedengbe M. E., Hafeez M. A., Tu H., and Barta J. R.. 2014. “The Complete Mitochondrial Genome Sequence of Hepatozoon catesbianae (Apicomplexa: Coccidia: Adeleorina), a Blood Parasite of the Green Frog, Lithobates (Formerly Rana) Clamitans .” Journal of Parasitology 100, no. 5: 651–656. 10.1645/13-449.1. [DOI] [PubMed] [Google Scholar]
- Léveillé, A. N. , Zeldenrust E. G., and Barta J. R.. 2021. “Multilocus Genotyping of Sympatric Hepatozoon Species Infecting the Blood of Ontario Ranid Frogs Reinforces Species Differentiation and Identifies an Unnamed Hepatozoon Species.” Journal of Parasitology 107, no. 2: 246–261. 10.1645/20-18. [DOI] [PubMed] [Google Scholar]
- McCutchan, T. F. , de la Cruz V. F., Lal A. A., Gunderson J. H., Elwood H. J., and Sogin M. L.. 1988. “Primary Sequences of Two Small Subunit Ribosomal RNA Genes From Plasmodium falciparum .” Molecular and Biochemical Parasitology 28, no. 1: 63–68. 10.1016/0166-6851(88)90181-8. [DOI] [PubMed] [Google Scholar]
- Medlin, L. , Elwood H. J., Stickel S., and Sogin M. L.. 1988. “The Characterization of Enzymatically Amplified Eukaryotic 16S‐Like rRNA‐Coding Regions.” Gene 71, no. 2: 491–499. 10.1016/0378-1119(88)90066-2. [DOI] [PubMed] [Google Scholar]
- Na, I. , Campos C., Lax G., Kwong W. K., and Keeling P. J.. 2024. “Phylogenomics Reveals Adeleorina Are an Ancient and Distinct Subgroup of Apicomplexa.” Molecular Phylogenetics and Evolution 195: 108060. 10.1016/j.ympev.2024.108060. [DOI] [PubMed] [Google Scholar]
- Namasivayam, S. , Baptista R. P., Xiao W., et al. 2021. “A Novel Fragmented Mitochondrial Genome in the Protist Pathogen Toxoplasma gondii and Related Tissue Coccidia.” Genome Research 31, no. 5: 852–865. 10.1101/gr.266403.120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ogedengbe, J. D. , Hanner R. H., and Barta J. R.. 2011. “DNA Barcoding Identifies Eimeria Species and Contributes to the Phylogenetics of Coccidian Parasites (Eimeriorina, Apicomplexa, Alveolata).” International Journal for Parasitology 41, no. 8: 843–850. 10.1016/j.ijpara.2011.03.007. [DOI] [PubMed] [Google Scholar]
- Ogedengbe, M. E. , El‐Sherry S., Ogedengbe J. D., Chapman H. D., and Barta J. R.. 2018. “Phylogenies Based on Combined Mitochondrial and Nuclear Sequences Conflict With Morphologically Defined Genera in the Eimeriid Coccidia (Apicomplexa).” International Journal for Parasitology 48, no. 1: 59–69. 10.1016/j.ijpara.2017.07.008. [DOI] [PubMed] [Google Scholar]
- Ogedengbe, M. E. , El‐Sherry S., Whale J., and Barta J. R.. 2014. “Complete Mitochondrial Genome Sequences From Five Eimeria Species (Apicomplexa; Coccidia; Eimeriidae) Infecting Domestic Turkeys.” Parasites & Vectors 7: 335. 10.1186/1756-3305-7-335. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ogedengbe, M. E. , Hafeez M. A., and Barta J. R.. 2013. “Sequencing the Complete Mitochondrial Genome of Eimeria mitis Strain USDA 50 (Apicomplexa: Eimeriidae) Suggests Conserved Start Positions for mtCOI‐ and mtCOIII‐Coding Regions.” Parasitology Research 112, no. 12: 4129–4136. 10.1007/s00436-013-3604-z. [DOI] [PubMed] [Google Scholar]
- Perkins, F. O. , Barta J. R., Clopton R. E., Peirce M. A., and Upton S. J.. 2000. “Phylum Apicomplexa Levine, 1970.” In An Illustrated Guide to the Protozoa, edited by Lee J. J., Leedale G. F., and Bradbury P. C., 2nd ed., 190–200. Society of Protozoologists. https://protistologists.org/publications/illustrated‐guide‐to‐the‐protozoa/. [Google Scholar]
- Schneider, A. 1875a. “Note sur la psorospermie oviforme du poulpe.” Archives de Zoologie Expérimentale et Générale 4: xl–xlv. [Google Scholar]
- Schneider, A. 1875b. “Contributions a l'histoire des Grégarines des invertébré de Paris et de Roscoff.” Archives de Zoologie Expérimentale et Générale 4: 493–604. [Google Scholar]
- Schneider, A. 1885. “Coccidies nouvelles ou peu connues.” Tablettes Zoologiques 1: 4–9. [Google Scholar]
- Smith, T. , and Johnson H. P.. 1902. “On a Coccidium (Klossiella muris, Gen. Et Spec. Nov.) Parasitic in the Renal Epithelium of the Mouse.” Journal of Experimental Medicine 6, no. 3: 303–316. 10.1084/jem.6.3.303. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Texas Parks and Wildlife . 2004. “Texas Three‐Tooth Snails (genus Triodopsis).” Terrestrial Mollusks of Texas, Projects, Nature Trackers. https://tpwd.texas.gov/huntwild/wild/wildlife_diversity/texas_nature_trackers/projects/.
- Votýpka, J. , Modrý D., Oborník M., Šlapeta J., and Lukeš J.. 2017. “Apicomplexa.” In Handbook of the Protists, edited by Archibald J. M., Simpson A. G. B., and Slamovits C. H., 2nd ed., 567–624. Springer. 10.1007/978-3-319-28149-0_20. [DOI] [Google Scholar]
- Zeldenrust, E. G. , and Barta J. R.. 2021. “Description of the First Klossia Species (Apicomplexa: Eucoccidiorida: Adeleorina: Adeleidae) Infecting a Pulmonate Land Snail, Triodopsis hopetonensis (Mollusca: Polygyridae), in North America.” Journal of Parasitology 107, no. 3: 421–429. 10.1645/21-3. [DOI] [PubMed] [Google Scholar]
- Zeldenrust, E. G. , Carlton K., Jenkins E. J., et al. 2026. “ Klossiella equi, an Underreported Parasite of Equids in the Americas.” Veterinary Parasitology 345: 110781. 10.1016/j.vetpar.2026.110781. [DOI] [PubMed] [Google Scholar]
- Zeldenrust, E. G. , Léveillé A. N., and Barta J. R.. 2025. “Description of a New Klossia Species (Apicomplexa; Adeleorina; Adeleidae) in Canada From an Introduced European Land Snail (Trochulus hispidus), with a Discussion on the Taxonomy of the Family Adeleidae Mesnil, 1903.” Canadian Journal of Zoology 103: 1–15. 10.1139/cjz-2024-0130. [DOI] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All sequences have been submitted and published in NCBI GenBank—accession numbers in MS.