Therapeutic Effect of Postbiotics Cocktail on DSS‐Induced Colitis in Mice by Modulating of Autophagy Pathway

ABSTRACT

Autophagy plays a critical role in regulating inflammation, and its modulation is essential for managing inflammatory disorders such as inflammatory bowel disease (IBD). Postbiotics, derived from probiotic bacteria, have recently attracted attention for their health‐promoting properties. This study evaluated the protective effects of postbiotics produced by native Limosilactobacillus spp. and Bifidobacterium spp. on inflammation through autophagy regulation. Fifteen male C57BL/6 mice were randomly assigned to three groups: control (PBS), DSS‐induced colitis, and DSS plus postbiotics. Colitis was induced with 2% DSS, and postbiotics (1 × 10⁹ CFU/mL) were administered daily for 14 days. Disease activity index, colon length, histopathology, and autophagy‐related gene expression (Atg5, Atg7, Atg12, Atg13, and Beclin 1) were assessed. DSS treatment resulted in significant body weight loss, shortened colon length, increased disease activity, and higher pathological scores (p value < 0.05). In contrast, postbiotics administration mitigated these colonic damages and preserved body weight. Furthermore, postbiotics enhanced the expression of autophagy‐related genes compared to the DSS group. Collectively, molecular and phenotypic findings highlight the regulatory role of native postbiotics in modulating inflammation via autophagy. These results suggest that native postbiotics may serve as a safe and effective therapeutic alternative for IBD management.

Our native postbiotics from Limosilactobacillus spp. and Bifidobacterium spp. help reduce DSS‐induced colitis by activating autophagy signaling pathways. Giving postbiotics to DSS‐treated C57BL/6 mice led to less body weight loss, improved colon structure, reduced disease activity index and tissue damage, and significantly increased autophagy‐related genes including beclin1, atg5, atg7, atg12, and atg13. These results show that our native postbiotics could help manage intestinal inflammation by improving autophagy and also offer a safe treatment option for inflammatory bowel disease (IBD).

1. Introduction

Autophagy represents a cellular process that assumes pivotal functions in the recycling of impaired organelles, as well as the elimination of invaded pathogens. Activation of the autophagy pathway may arise from a range of detrimental consequences, such as starvation, hypoxia, DNA damage, accumulation of protein aggregates, and impairment of organelles [1]. However, in addition to its damaging mechanism, autophagy also assumes an important function00 in various vital biological processes, such as immune response, development, and differentiation [2, 3]. Therefore, autophagy may potentially be associated with diverse physiological processes within the human body, thereby playing a pivotal role in the onset or mitigation of a wide range of pathologies.

In addition to autophagy, there are other biological mechanisms that assume functions in the context of stress adaptation, such as inflammation [4]. Inflammation is a double‐edged sword that assumes a fundamental function in the invasion of pathogens and the impairment of tissues. Through the activation of inflammation, specific cellular components and processes are triggered, subsequently leading to the eradication of pathogens or damaged cells. However, upon the completion of these processes, the stopping of inflammation ought to occur; otherwise, the protracted and unregulated activation of the immune system could potentially lead to an obstruction of tissue healing [5]. Inflammatory bowel disease (IBD) is a vital medical condition that arises as a result of malfunction in the inflammatory process that could affect the gastrointestinal tract, distinguished by persistent episodes of mucosal inflammation [6]. Chronic inflammation, which is of paramount importance in the context of IBD, has the potential to pose important threats to patients by increasing their susceptibility to various malignancies. Hence, it is crucial to exercise control over the inflammatory processes to ensure the well‐being of individuals afflicted with IBD [7].

The linkage between inflammation and autophagy is one of the important processes in body. On one hand, autophagy and inflammation act in the same direction, as autophagy can greatly influence the advancement of inflammation through its role in the immune system [4]. On the other hand, when inflammation becomes uncontrolled, as seen in IBD, autophagy becomes compromised. In this instance, the implementation of any therapy that supports autophagy could prove efficacious in enhancing the condition of IBD patients [8]. One of the agents that has received significant attention in recent years is postbiotic, which is considered highly advantageous.

According to the International Scientific Association for Probiotics and Prebiotics (ISAPP), postbiotics are defined as “a preparation of inanimate microorganisms and/or their components that confers a health benefit on the host.” However, in experimental and mechanistic studies, the term has also been used more broadly to describe metabolite‑rich preparations derived from probiotic fermentation. Recent studies have reported the beneficial anti‑inflammatory and immunomodulatory effects of postbiotics [9, 10]. Therefore, the utilization of these advantageous agents in the fight against inflammatory conditions, such as IBD, may be considered a crucial strategy for patients afflicted with IBD. In this study, we use the term ‘postbiotic’ to refer to the cell free supernatant obtained from probiotic cultures, containing a complex mixture of soluble microbial metabolites produced during fermentation (including, but not limited to, organic acids, peptides and other bioactive molecules), which may exert beneficial effects on the host.

Our recent investigation demonstrated the anti‐inflammatory effects of our native potential probiotic strains, including Limosilactobacillus spp. and Bifidobacterium spp. in reduce and modulation of inflammation [11]. Given the important anti‐inflammatory function of postbiotics and considering the dysfunction of autophagy during states of inflammation, the aim of the current study was to assess the impact of our native postbiotics on the regulation of inflammation by modulating the autophagy pathway.

2. Materials and Methods

2.1. Bacterial Culture Condition

Six bacterial strains including Limosilactobacillus reuteri 100, Limosilactobacillus plantarum 42, Limosilactobacillus plantarum 119, Limosilactobacillus plantarum 155, Bifidobacterium bifidum 1001, Bifidobacterium longum 1044, which were isolated from stool and breast milk of healthy subjects in our previous study, were grown in MRS medium as previously described [12, 13]. To monitor microbial proliferation within the mixed culture, we performed serial dilutions and colony forming unit (CFU) counts on selective agar plates for each strain. The cultures were harvested when the total viable count reached approximately 10^9CFU/mL, which was then used for subsequent experimental procedures. Anaerobic growth conditions were maintained using an anaerobic jar system equipped with gas generating packs, ensuring oxygen free conditions throughout the incubation period.

2.2. Preparation of Postbiotics

Postbiotics were prepared by culturing live cells at 37°C for 18 h. An equal amount of bacterial suspension (10⁹ CFU/mL) was inoculated into MRS broth (Merck, Germany) at a ratio of 10% (v/v). The suspension was incubated anaerobically at 37°C for 96 h. The supernatant was then collected (centrifugation at 13 000 g for 5 min at a temperature of 4°C) and filtered (0.22 µm). For the preparation of the postbiotic cocktail, the inoculation method was carried out according to the single strain preparation method. The postbiotic cocktail was aliquoted and stored at 80°C until use.

2.3. Animals Experiment

Fifteen male wild‐type C57BL/6 mice were obtained at 4 weeks of age from the Pasteur Institute of Iran and housed in three cages for the acclimation period. Acclimation was performed in equal conditions (12 h of light, 22°C to 23°C, and 40% humidity) with free access to a standard normal diet (SD) and water during acclimation and throughout the study. All mice were weighed daily. Institutional guidelines for the care and use of laboratory animals were followed in this study, and all animal experiments were designed to minimize suffering of the mice. The study protocol was approved by the Animal Experimentation Committee of the Pasteur Institute of Iran (IR.PII.REC.1400.061).

2.4. DSS‐Induced Colitis Mouse Model and Treatments

Experimental colitis was induced by oral administration of 2% DSS (Sigma, Germany) for 14 days. Postbiotics (1 × 10⁹ CFU/mL) were also administered once daily by oral gavage. All mice were fed by SD. Mice were randomly divided into three groups (n = 5), including: Cont (treatment with 200 µL/day PBS), DSS (treatment with 200 µL/day DSS), DSS+Post (treatment with 200 µL/day cocktail of selective postbiotics [1 × 10⁹ CFU/mL] together with DSS). Animals were sacrificed by cervical dislocation under anesthesia, using ketamine and xylazine along with atropine sulfate at dose 200/15 mg/kg and atropine 0.05 mg.kg⁻¹. To clean the stool, the colon was gently washed using PBS. Then, the colon was cut into 2–3 pieces and stored in −80°C for RNA isolation. Mice were monitored daily for body weight, diarrhea and rectum and stool bleeding. Disease activity index (DAI) scores were calculated based on weight loss, stool type, and bleeding as described by Kwon et al. described [14].

2.5. Histopathological Examination

On the 14th day, the mice were sacrificed and their colons were collected. The colon's length was measured as an indirect inflammatory marker. After fixation in 4% (w/v) paraformaldehyde, multiple paraffin colon sections were stained with hematoxylin and eosin (H&E). The histopathological score blindly was determined according to the methods described by Ghanavati et al. [15]. Some colon parameters, for example, crypt architecture, inflammation, muscle thickness, and goblet cell depletion were used to calculate the histopathological score.

2.6. Analysis of Autophagy‐related Genes in the Colon by Quantitative Real‐Time PCR

Total RNA was isolated from homogenized mouse colon using the RNeasy Mini Kit (Favorgen Biotech Corp, Taiwan). The RNA was reverse transcribed using a cDNA synthesis kit (Yekta Tajhiz Azma Co, Iran). Real‐time PCR was performed with 2x SYBR‐Green (RealQ Plus Master Mix Green, Amplicon A/S, Denmark). The gapdh, as a housekeeping gene, was used to normalize the expression of the target gene. A list of primer sequences used in the current study is demonstrated in Table 1.

TABLE 1.

The primers used in this study.

Gene name	Primer forward	Primer reverse
Beclin 1	TCAGCCGGAGACTCAAGGT	CACAGCGGGTGATCCACATC
Atg5	AGCCAGGTGATGATTCACGG	GGCTGGGGGACAATGCTAA
Atg7	TCTGGGAAGCCATAAAGTCAGG	GCGAAGGTCAGGAGCAGAA
Atg12	TCCCCGGAACGAGGAACTC	TTCGCTCCACAGCCCATTTC
Atg13	TTCCCCGACGGGTTCAGAT	GGCCTTCTTTGCTTCATGGG

2.7. Statistical Analysis

GraphPad Prism 8.0 (GraphPad Software Inc, CA, USA) was used to calculate the changes in gene expression. One‐way analysis of variance (ANOVA) was used for calculating differences between groups. Results are presented as the mean ± SD of at least three experiments. A p value of 0.05 was considered statistically significant.

3. Results

3.1. Postbiotic Cocktail Controlled Symptoms and Pathology Associated with DSS‐Induced Colitis

To evaluate the development of symptoms of DSS treatment in the colon of DSS‐treated mice and the effects of postbiotic mixture, the change in body weight, decrease in colon length, and DAI were determined in DSS‐induced colitis mice. The study design of colitis induction and treatment with our native postbiotic cocktail is shown in Figure 1A. After 14 days, the Cont group showed weight gain compared to day zero. In contrast, a remarkable weight loss was observed in the DSS group compared to the Cont group (p < 0.0001). Notably, our native postbiotic cocktail controlled the weight loss induced by DSS (p < 0.0001). Moreover, a decrease in colonic length, DAI score, and pathological score was observed in the DSS group (p < 0.0001, p < 0.0001, and p < 0.0001, respectively), whereas the ratio of these decreases was lower in the DSS + Post group (p < 0.0001) (Figure 1B–E). Compared with the Cont group, the DSS group showed significant pathological damage (p < 0.05). However, administration of our native postbiotic cocktail for 14 days effectively controlled DSS‐induced these colonic damages. In terms of histomorphological changes, severe inflammatory cell infiltration, greater depletion of goblet cells, and crypt abscesses were observed in the DSS group compared to the Cont group. While our native postbiotic cocktail significantly reduced inflammation, goblet cell depletion and crypt abscesses, and an increase in muscle thickness (p < 0.05) (Figure 1F). In fact, administration of our postbiotic mixture obviously inhibited the severity of DSS‐induced pathological damage in the colon and maintained it in a mild form. Taken together, our native postbiotic mixture was able to control colitis in mice with DSS‐induced colitis.

FIGURE 1.

Postbiotics cocktail controling symptoms and pathology associated with DSS‐induced colitis. (A) Study design, (B) body weight change, (C) colon length, (D) DAI score, (E) pathology score, and (F) H&E staining of colon section of mice (a: crypts architecture, b: inflammation, c: muscle thickness, d: goblet cells depletion, and e: crypts absesses) in Cont, DSS, and DSS + Post groups. Data are presented as the mean ± SD, n =  5 per group. *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001; among treatment groups were considered statistically significant, respectively. Cont: normal standard diet (SD) + PBS, DSS: SD + DSS (2%) + PBS, and DSS + Post: SD + DSS+ postbiotics cocktail (10⁹ CFU).

3.2. Postbiotic Cocktail Upregulated Genes Are Involved in Autophagy Signaling Pathways

To understand the anti‐inflammatory effect of the postbiotic cocktail under DSS treatment, we examined autophagy gene expression (i.e., Beclin1, Atg5, Atg7, Atg12, and Atg13) in the inflamed colon of the mouse colitis model. Compared with the control group, the expression of Beclin1 was significantly decreased in the colon of DSS‐treated mice (p = 0.005). Interestingly, treatment with the postbiotic cocktail was able to upregulate this expression (p = 0.0001) (Figure 2A). The slight decrease in the expression of Atg5 and Atg7 was observed in the DSS group compared to the Cont group, while in the DSS + Post group, upregulation of the mRNA levels of Atg5 and Atg7 in the colon was observed (p < 0.0001, p = 0.001, respectively) (Figures 2B, C). In addition, Atg12 overexpression was observed in the DSS+Post group (p < 0.0001), while DSS treatment significantly decreased colonic Atg12 expression (p = 0.008) (Figure 2D). In the case of Atg13, a slight downregulation of Atg13 was observed after 14 days of DSS treatment compared with the control group, whereas our native postbiotic mixture controlled this reduction, accompanied by an upregulation of Atg13 (p = 0.0003) (Figure 2E). Overall, our native postbiotic cocktail is able to modulate genes related to autophagy and control inflammation caused by DSS. Therefore, this postbiotic cocktail could be considered as an alternative agent for IBD patients.

FIGURE 2.

Postbiotics cocktail upregulated genes are involved in autophagy signaling pathways. The fold change of autophagy genes that is, (A) Beclin, (B) Atg5, (C) Atg7, (D) Atg12, and (E) Atg13 in Cont, DSS, and DSS + Post groups. Data are presented as the mean  ±  SD, n = 5 per group. *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001; among treatment groups were considered statistically significant, respectively. Cont: normal standard diet (SD) + PBS, DSS: SD + DSS (2%) + PBS, and DSS + Post: SD + DSS + postbiotics cocktail (10⁹ CFU).

4. Discussion

IBD and its two subtypes, Crohn's disease (CD) and ulcerative colitis (UC), are abnormalities in which inflammation is the predominant outcome [16]. Inflammation is a form of biological process that serves as a beneficial and necessary approach during the initial stages of certain abnormalities, such as infections. However, if not appropriately regulated, the body may experience various unfavorable outcomes. Consequently, uncontrolled inflammation, also referred to as chronic inflammation, is commonly known as a silent killer [17]. Therefore, it is of utmost importance for patients suffering from IBD to utilize agents with minimal adverse reactions that possess the ability to effectively control, lessen, or regulate inflammation [18]. Postbiotics are a category of aforementioned beneficial substances that have the potential to contribute significantly to the maintenance of overall well‐being. These substances exert a wide range of effects, encompassing anti‐inflammatory, antibacterial, anti‐oxidant, and immunomodulatory properties, as well as other notable impacts on the integrity of the intestinal barrier [19]. Noteworthy, it is important to consider that while some agents may have benefits in certain conditions, the risks and benefits should be evaluated before starting any therapy in IBD patients and postbiotics also require proper identification, characterization, and demonstration of safety and health benefits before use [20]. Among the numerous pathways that may be associated with inflammation, autophagy stands out as a noteworthy one [21] and the establishment of equilibrium between inflammation and autophagy holds utmost importance in order to control the detrimental consequences of excessive inflammation activity [22]. Based on this data, the current study aimed to investigate the anti‐inflammatory or regulatory effects of our native postbiotics, derived from a probiotic mixture containing Limosilactobacillus spp. and Bifidobacterium spp. through the autophagy pathway.

In the current research, the examination of symptoms of DSS‐induced colitis revealed the clear implications of utilizing DSS as the instigator of inflammation. The evaluation of the distal part of the colon indicated that the use of DSS resulted in detrimental effects on the symptoms of DSS‐induced colitis, resulting in significant decreases in body weight and colon length, as well as significant increases in DAI and pathological scores (p < 0.05). This demonstrated the unfavorable consequences of DSS on the colon tissue. In contrast, using our native postbiotic mixture could have a significant impact on controlling the symptoms of colitis induced by DSS in comparison (p < 0.05). The anti‐inflammatory effects of our native postbiotic is so notable that it brings the colon length and pathological scores to the same level as the control group. The current results are in accordance with other reports. Zhang et al., described that both probiotics and postbiotics could have beneficial effects on controlling the adverse effects of DSS, including modulation of DAI, length of the colon, and body weight change in the similar way [23]. Also, according to the investigation carried out by Xu et al., it can be inferred that both Saccharomyces boulardii and its postbiotics possess the ability to elicit beneficial impacts in counteracting the adverse effects of DSS by influencing the amelioration of tissue impairment and reduction of colonic length [24].

According to recent studies, postbiotics may offer health advantages due to their structures or diverse properties. Nevertheless, the precise mechanisms through which postbiotics can bring about their beneficial effects remain uncertain [25]. Here, in addition to our phenotypic results that completely illustrate the positive impacts of our native postbiotic, the current findings also could confirm the secondary aim of our research, which relates to the molecular effectiveness of our native postbiotic mixture on the autophagy pathway. In other words, we have the capacity to predominantly demonstrate the manner in which postbiotics might have potentially adapted in order to exert their effects. Based on our molecular analyses, the utilization of DSS has been found to substantially reduce the level of expression of autophagy genes, such as Atg12 and Beclin1, in comparison to the control group. Conversely, the application of our native postbiotic mixture has been observed to considerably increase the aforementioned genes. These findings align with the research that stated that impaired autophagy may be associated with the exacerbation of inflammatory status by increasing the production of pro‐inflammatory cytokines, such as IL‐1β [26]. Therefore, the employment of agents possessing the ability to induce autophagy can be considered as a valuable approach to alleviate inflammation [27]. Our native postbiotics serve as such agents that can diminish inflammation by exerting an influence on the level of autophagy expression. The examination of the remaining autophagy genes under investigation, such as Atg13, Atg5, and Atg7, revealed that the utilization of DSS resulted in a decline in the level of expression. However, this decrease did not reach a level of statistical significance when comparing the group treated with DSS to the group in the control condition. This phenomenon may arise because, as previously indicated, autophagy and inflammation could acts both in same or dissimilar directions [4, 8] and in the current study, it appears that the expression level of autophagy genes should be decreased in a controlled manner in order to regulate the impact of inflammation.

In summary, molecular assays and phenotypic observations in our study have elucidated the regulatory effects of our native postbiotics in modulating the state of inflammation. Broadly speaking, the management of IBD through medical and surgical interventions poses several obstacles, necessitating the identification of the most efficacious means to alleviate symptoms associated with this ailment. Our native postbiotics appear to hold promise in ameliorating the quality of life for individuals afflicted with IBD while concurrently mitigating the exacerbation of this condition. The ongoing investigation that is currently being conducted has certain limitations that are present. These limitations, despite their existence, do not diminish the importance of the study. Instead, they provide an opportunity for further exploration and expansion in the field of research. Hence, it would be extremely valuable and significant to consider and delve into the examination of other genes that may potentially play a role in the various stages of autophagy. By doing so, future research efforts can be focused on gaining a more comprehensive understanding of autophagy and its intricate mechanisms for controlling and modulating inflammation.

Author contributions

Niloofar Rezaie: Performed the experiments, Wrote the paper; Fatemeh Shidvash: Performed the experiments; Fatemeh Ashrafian: Analyzed and interpreted the data; Shadi Aghamohammad: Wrote the paper, Revised manuscript; Conceived and designed the experiments.; Mahdi Rohani: Revised manuscript, Conceived and designed the experiments.

Funding

The current research was done in support of Pasteur Institute of Iran supported as a funding agency (grant number B‐9740).

Ethics Statement

This study was established following the Declaration of Helsinki and approved by the ethics committee of Pasteur Institute of Iran (IR.PII.REC.1400.061).

Consent

The authors have nothing to report.

Conflicts of Interest

The authors declare no conflicts of interest.

Data Availability Statement

The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.