Discovery and synthesis of phenylthiophene sulfonamide derivatives with promising anti-inflammatory activity

Abstract

Dysregulated inflammation is central to chronic diseases such as rheumatoid arthritis and atherosclerosis. In this study, an in-house screening assay identified L464-0189 as a promising anti-inflammatory hit. Based on the phenylthiophene sulfonamide scaffold, 31 novel compounds bearing diverse electronic properties and ring systems were synthesized through multistep reactions. Preliminary structure–activity relationship (SAR) analysis revealed that compounds PTS-15 and PTS-22 significantly inhibited LPS-induced NO production in a concentration-dependent manner. Subsequent biological evaluation demonstrated that PTS-15 and PTS-22 inhibited the gene transcription of IL-1β, IL-6, and TNF-α. In addition, compound PTS-22 significantly inhibited the release of key pro-inflammatory cytokines, including IL-6 and TNF-α. Immunoblotting results further elucidated that PTS-22 exerts its anti-inflammatory efficacy by downregulating the NF-κB signaling pathway, as evidenced by the significant inhibition of p65 phosphorylation. Moreover, molecular docking analysis revealed the potential binding modes of PTS-15 and PTS-22 towards NF-κB. Collectively, these results highlighted the anti-inflammatory potential of phenylthiophene sulfonamide derivatives and supported their further optimization as scaffolds for the development of novel anti-inflammatory therapeutics.

Discovery, synthesis and biological evaluation of novel phenylthiophene sulfonamide compounds with promising anti-inflammatory activity.

1. Introduction

Inflammation is a complex biological response to harmful stimuli such as pathogens, wounds, or irritants. Based on the duration and pathological characteristics, inflammation can be classified into acute and chronic inflammation. Moderate acute inflammation plays a beneficial role in clearing pathogens and repairing tissue damage. However, excessive acute inflammation can result in collateral tissue damage and immune pathologies such as sepsis.^1,2 Chronic inflammation, characterized by persistent, low-grade inflammation and immune dysregulation, is associated with a wide range of diseases, including cancer,³ autoimmune hepatitis, inflammatory bowel disease,⁴ rheumatoid arthritis,⁵ obesity,⁶ type 2 diabetes,⁶ Alzheimer's disease,⁷ and atherosclerosis.⁸

Lipopolysaccharides (LPS), a major component of the outer membrane of Gram-negative bacteria, is a potent activator of the innate immune response. Upon recognition by pattern recognition receptors (PRRs), particularly Toll-like receptor 4 (TLR4), LPS initiates a cascade of inflammatory signaling pathways. Following stimulation by LPS and other inflammatory triggers, TLR4 forms a heterodimer with myeloid differentiation factor 2 (MD-2), subsequently activating downstream signaling through both MyD88-dependent and MyD88-independent pathways. This activation leads to the stimulation of mitogen-activated protein kinases (MAPKs) and nuclear factor-kappa B (NF-κB), ultimately promoting the production of various inflammatory mediators by macrophages, including nitric oxide (NO), interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α).⁹ Among these mediators, NO is a lipophilic gaseous molecule synthesized from l-arginine by nitric oxide synthases (NOS). As a potent vasodilator, NO plays a critical role not only in inflammation but also in immune regulation, antimicrobial defense, tumor progression, and resolution of infection.^10–13

Current therapeutic strategies for inflammation include the use of nonsteroidal anti-inflammatory drugs (NSAIDs) such as aspirin, ibuprofen, indomethacin, and diclofenac sodium. These agents exert antipyretic, analgesic, and anti-inflammatory effects primarily by inhibiting the activities of cyclooxygenase (COX) and lipoxygenase (LOX), thereby reducing the production of pro-inflammatory prostaglandins.¹⁴ In addition, targeted cytokine inhibitors, such as anakinra, canakinumab, and rilonacept,¹⁵ and TNF-α inhibitors, including adalimumab, infliximab, and afimkibart,^16,17 have been developed to specifically neutralize key inflammatory mediators. Glucocorticoids, such as hydrocortisone, prednisone, and dexamethasone, are also widely used for their broad immunosuppressive effects to treat acute and chronic inflammatory conditions, including allergic and autoimmune diseases. However, the long-term use of these drugs is frequently associated with severe adverse effects, such as gastrointestinal injury, cardiovascular complications, and significant hepatotoxicity and nephrotoxicity.¹⁸ Moreover, the limited specificity of cytokine inhibitors and glucocorticoids often leads to unwanted immunosuppression.

Several compounds, including BAY 11-7082,¹⁹ andrographolide,²⁰ bardoxolone methyl,¹⁹ parthenolide,²¹ and JSH-23,²² have been identified as inhibitors of the NF-κB signaling pathway, highlighting their broad therapeutic potential.²³ Furthermore, inhibition of inducible nitric oxide synthase (iNOS) has emerged as a promising strategy for controlling inflammation under various pathological conditions.²⁴ Several iNOS inhibitors have been reported, including compounds 53 (ref. 25) YPW,²⁶ 4a,²⁷ BN-4,²⁸ 12e,²⁹ 2d,³⁰ KD7332,³¹ and D27.³² The chemical structures of these representative anti-inflammatory compounds are illustrated in Fig. 1.

Fig. 1. Chemical structures of representative anti-inflammatory compounds.

In this work, 31 novel phenylthiophene sulfonamide derivatives with diverse electronic properties and ring systems were synthesized through substitution, hydrogenation, and coupling reactions. Preliminary SAR analysis revealed that compounds PTS-15 and PTS-22 significantly inhibited LPS-induced NO production in a concentration-dependent manner, displaying IC₅₀ values of 39 ± 2 µM and 29 ± 1 µM, respectively. Considering both anti-inflammatory efficacy and cytotoxicity, PTS-15 and PTS-22 were selected for further evaluation. The results demonstrated that both compounds markedly suppressed the transcriptional expression of IL-1β, IL-6, and TNF-α. Moreover, PTS-22 inhibited the release of IL-6 and TNF-α in a concentration-dependent manner. More importantly, immunoblotting results elucidated that PTS-22 exerts its promising anti-inflammatory efficacy by downregulating the NF-κB signaling pathway, primarily through the significant inhibition of p65 phosphorylation. Molecular docking studies further revealed the potential binding modes of PTS-15 and PTS-22 within the p50 subunit of NF-κB. Collectively, these findings suggest that compounds bearing the phenylthiophene sulfonamide scaffold exhibit promising inhibitory effects against LPS-induced inflammatory responses and represent promising lead compounds for further structural optimization in the development of therapeutics for inflammatory diseases.

2. Results and discussion

2.1. Chemistry

An in-house screening assay identified L464-0189, an N-phenylthiophene-3-sulfonamide derivative, as a hit compound with promising anti-inflammatory activity. Guided by this scaffold, a focused series of 31 analogs was synthesized via a multistep synthetic route (Schemes 1–3). Specifically, 5-fluoro-2-nitrotoluene was reacted with diethylamine under reflux in acetonitrile using potassium carbonate as the base to afford intermediate 1 in 57% yield. The nitro group of intermediate 1 was reduced to an amine using Pd/C under a hydrogen atmosphere. The reaction mixture, without further purification, was then reacted with 5-bromothiophene-2-sulfonyl chloride in the presence of triethylamine and dichloromethane, affording intermediate 2 with an overall yield of 60% across the two steps, as shown in Scheme 1.

Scheme 1. Synthesis route of intermediate 2.

Scheme 2. Synthesis route of compounds PTS-1–PTS-4.

Scheme 3. Synthesis of compounds PTS-5–PTS-31.

As shown in Scheme 2, compounds PTS-1 to PTS-4 were synthesized through a similar strategy. Intermediate 2 was protected with a tert-butyloxycarbonyl (Boc) group to form intermediate 3. Under conditions of −72 °C, intermediate 3 underwent metal–halogen exchange with n-BuLi to generate the aryl anion, which then reacted with the corresponding alkyl iodide in an SN₂ reaction, replacing the bromine on the thiophene ring with an alkyl group. The resulting product was deprotected using trifluoroacetic acid and dichloromethane, yielding compounds PTS-1 to PTS-4.

Compounds PTS-5 to PTS-31 were synthesized through Suzuki–Miyaura coupling reactions between intermediate 2 and the corresponding boron reagents. Notably, different boron reagents required distinct catalysts, ligands, bases, and solvents, as shown in Scheme 3. Intermediate 2 reacted with cyclohexene-1-boronic acid and (1H-indol-3-yl)boronic acid in the presence of Pd(PPh₃)₂Cl₂ and sodium carbonate solution to afford compounds PTS-5 and PTS-7, respectively. Under conditions of Pd(OAc)₂, potassium carbonate, and DMF, intermediate 2 reacted with the corresponding boron reagents to yield compounds PTS-22, PTS-23, PTS-24, PTS-26, PTS-28, PTS-29, and PTS-30. However, for the synthesis of compounds PTS-6, PTS-9, PTS-10, PTS-14, PTS-15, PTS-16, PTS-17, PTS-18, PTS-20, PTS-21, and PTS-27, n-butanol was used as the solvent, and the addition of the ligand 2-dicyclohexylphosphino-2′,6′-dimethoxybiphenyl was required to improve the coupling efficiency. Compounds PTS-19 and PTS-31 proved more challenging to synthesize under conventional Suzuki–Miyaura conditions. Specifically, intermediate 2 reacted with isoxazol-4-ylboronic acid in the presence of Pd(OAc)₂ and n-butanol, requiring the addition of tri-tert-butylphosphine tetrafluoroborate to achieve the reaction and obtain compound PTS-19 with a yield of only 31%. For the synthesis of PTS-31, intermediate 2 was coupled with cyclopropylboronic acid under heterogeneous conditions using Pd(OAc)₂, PCy₃ and K₃PO₄, in a toluene–water mixture, affording the desired product only in 35% yield. Compounds PTS-8, PTS-11, PTS-12, and PTS-25 were obtained by reacting intermediate 2 with the corresponding boron reagents under Pd(dppf)Cl₂ catalysis, while compound PTS-13 was synthesized by microwave-assisted coupling of intermediate 2 with (1H-pyrazol-3-yl)boronic acid in the presence of Pd(PPh₃)₄, sodium carbonate, and dioxane.

2.2. Preliminary structure–activity relationship study

The anti-inflammatory activities of the synthesized phenylthiophene sulfonamide derivatives were evaluated by measuring NO production in LPS-stimulated RAW 264.7 macrophages at two concentrations (25 µM and 50 µM). Dexamethasone and Bay 11-7082 were used as the positive controls. As shown in Table 1, most of the phenylthiophene sulfonamide derivatives exhibited good inhibitory activity against LPS-induced NO release at a concentration of 50 µM, with inhibition rates ranging from 7.5% to 79.9%, depending on the R substituents.

Table 1. Anti-inflammatory evaluation of N-(4-(diethylamino)-2-methylphenyl)thiophene-2-sulfonamide derivatives.

Compd.	R Group	Inhibitory rates of NO releasea (%)		CC50 (µM) cytotoxicityb
		25 µM	50 µM
L464-0189		28.9 ± 0.4	46.0 ± 0.4	>100
PTS-1		13.0 ± 1.3	22.0 ± 2.8	>100
PTS-2		12.3 ± 2.6	33.2 ± 1.1	>100
PTS-3		12.1 ± 1.2	32.0 ± 2.2	>100
PTS-4		21.1 ± 3.6	33.8 ± 3.4	>100
PTS-5		17.3 ± 0.6	33.0 ± 0.7	>100
PTS-6		11.6 ± 0.6	16.7 ± 1.3	>100
PTS-7		17.9 ± 0.8	44.1 ± 0.6	82.5
PTS-8		4.4 ± 2.5	7.5 ± 3.8	>100
PTS-9		12.2 ± 0.5	17.2 ± 0.8	71.3
PTS-10		20.5 ± 0.4	50.2 ± 0.3	>100
PTS-11		28.2 ± 2.0	59.1 ± 0.6c	58.3
PTS-12		8.8 ± 0.3	15.9 ± 1.8	>100
PTS-13		27.8 ± 1.0	65.20 ± 1.0c	80.7
PTS-14		27.0 ± 0.5	44.3 ± 1.3	>100
PTS-15		27.6 ± 1.8	58.9 ± 1.1	>100
PTS-16		52.5 ± 0.8	79.9 ± 1.5c	37.0
PTS-17		15.6 ± 0.8	48.0 ± 0.6	82.2
PTS-18		14.2 ± 0.3	28.8 ± 1.1	>100
PTS-19		22.9 ± 0.3	34.8 ± 1.1	>100
PTS-20		24.0 ± 0.3	27.9 ± 0.8	>100
PTS-21		18.2 ± 0.1	21.5 ± 0.8	>100
PTS-22		39.8 ± 0.2	57.5 ± 0.4	>100
PTS-23		25.3 ± 2.5	55.8 ± 0.3	>100
PTS-24		23.3 ± 1.0	56.1 ± 1.1	67.8
PTS-25		15.8 ± 0.8	50.5 ± 0.5	>100
PTS-26		22.2 ± 0.2	33.1 ± 1.2	>100
PTS-27		21.8 ± 0.5	23.4 ± 0.3	>100
PTS-28		17.4 ± 1.9	36.7 ± 0.6	>100
PTS-29		20.3 ± 2.0	43.8 ± 0.2	>100
PTS-30		18.5 ± 1.1	30.4 ± 0.5c	20.6
PTS-31		30.3 ± 1.2	54.6 ± 0.8 c	37.9
Dexamethasone	—	66.4 ± 1.6	78.5 ± 0.3	—
BAY 11-7082d	—	48.4 ± 0.8 (5 µM)	94.6 ± 1.1 (25 µM)	—

^aNO production was measured in RAW 264.7 macrophages pretreated with tested compounds for 2 h and then stimulated with LPS (1 µg/mL) for 24 h. Nitric oxide levels in the culture supernatants were quantified using the Griess assay.

^bCell viability was assessed in THP-1-derived macrophages treated with the tested compounds (3.125–100 µM) for 48 h using the CCK-8 assay.

^cThe apparent high NO suppression rate is attributed to severe cytotoxicity, rendering the compound's actual anti-inflammatory potential unevaluable at this concentration.

^dThe tested compounds were evaluated at concentrations of 25 and 50 µM, whereas BAY 11-7082 was evaluated at 5 and 25 µM.

In this study, we used N-(4-(diethylamino)-2-methylphenyl)thiophene-2-sulfonamide as the core scaffold to explore the effects of various R groups, including alkyl, aryl, and heteroaryl groups, as well as the influence of electronic effects on anti-inflammatory activity. Specifically, alkyl substituents at the R position showed poor anti-inflammatory potential. Compounds PTS-1 to PTS-4 exhibited weak activity at 25 µM (12.1–21.1%), and doubling the concentration to 50 µM yielded only marginal improvements, topping out at 33.8% for PTS-4. When R was a cyclopropyl group (PTS-31), a significant concentration-dependent increase was observed (from 30.3% at 25 µM to 54.6% at 50 µM). However, this significant high-dose suppression is associated with its severe cytotoxicity (CC₅₀ = 37.9 µM), invalidating its apparent efficacy at 50 µM.

When the R group was a substituted aryl, the dual-concentration data revealed crucial differences that were masked at the high dose. From an electronic perspective, the introduction of electron-withdrawing groups on the phenyl ring generally enhanced the anti-inflammatory activity, whereas typical electron-donating groups proved detrimental. Focusing on the fluorine-substituted phenyl groups, the para-fluorophenyl (PTS-22), ortho-fluorophenyl (PTS-23), and meta-fluorophenyl (PTS-24) all reached similar inhibition rates at 50 µM (57.5%, 55.8%, and 56.1%, respectively). However, at the lower concentration of 25 µM, PTS-22 maintained a robust inhibition rate of 39.8%, significantly outperforming PTS-23 (25.3%) and PTS-24 (23.3%). Furthermore, compounds with electron-donating groups (PTS-20) or bulky biphenyl groups (PTS-27) exhibited minimal concentration-dependent changes. For instance, the inhibition rate of PTS-20 barely increased from 24.0% at 25 µM to 27.9% at 50 µM. In contrast, the naphthyl-1-substituted PTS-15 and aminophenyl-substituted PTS-25 demonstrated concentration-dependent increases in efficacy without evident toxicity.

Heteroaryl substitutions yielded diverse outcomes. Compounds like PTS-8 (pyridine-3-yl) and PTS-12 (pyrimidine-5-yl) were essentially inactive, failing to reach 16% inhibition even at 50 µM. The thiophene-3-yl substituted PTS-10 displayed a favorable and safe profile, with inhibition from 20.5% at 25 µM to 50.2% at 50 µM. Notably, specific heteroaryl derivatives like 1H-indol-4-yl (PTS-16) and pyridine-4-yl (PTS-11) exhibited high inhibition rates at 25 µM (52.5% and 28.2%, respectively). However, these compounds concurrently demonstrated severe cytotoxicity (CC₅₀ = 37.0 µM and 58.3 µM, respectively). The high NO suppression rates of these specific heteroaryl derivatives at 50 µM (e.g., 79.9% for PTS-16) are likely attributable to cell death rather than true anti-inflammatory signaling modulation.

2.3. Cytotoxicity evaluation of phenylthiophene sulfonamide derivatives

Cytotoxicity was assessed using the CCK-8 assay. All synthesized phenylthiophene sulfonamide derivatives were evaluated for their effects on cell viability using a THP-1 derived macrophages (THP-Ms) model. THP-1 cells were differentiated into THP-Ms by stimulation with 100 ng/mL phorbol 12-myristate 13-acetate (PMA) for 12 h. After resting for 24 h, THP-Ms were treated with varying concentrations of the test compounds (3.125–100 µM) for 48 h, and cell viability was subsequently measured using the CCK-8 assay. The results indicated that most compounds did not show significant cytotoxicity. However, compounds bearing pyridyl, 1H-pyrazol-3-yl, 1H-indol-4-yl, meta-fluorophenyl, 4-acetylphenyl, and cyclopropyl substituents (PTS-11, PTS-13, PTS-16, PTS-24, PTS-30, and PTS-31) showed significant inhibition of cell proliferation.

In addition, the cytotoxicity of several compounds, including PTS-10, PTS-11, PTS-13, PTS-15, PTS-22, PTS-23, PTS-24, PTS-25, and PTS-31, with favorable anti-inflammatory activity was further evaluated in RAW 264.7 cells, as shown in Fig. 2. Cells were treated with compounds at concentrations of 0.01, 0.1, 1, 10, 25, and 50 µM for 24 h. The results demonstrated that PTS-11, PTS-13, and PTS-31 significantly inhibited RAW 264.7 cell viability at 50 µM.

Fig. 2. Cytotoxicity evaluation of phenylthiophene sulfonamide derivatives. Cytotoxicity of PTS-10 (A), PTS-11 (B), PTS-13 (C), PTS-15 (D), PTS-22 (E), PTS-23 (F), PTS-24 (G), PTS-25 (H), and PTS-31 (I) in RAW 264.7 cells after 24 h of treatment ranging from 0.01 to 50 µM, as assessed by the CCK-8 assay.

2.4. Anti-inflammatory activity of phenylthiophene sulfonamide derivatives in LPS-induced NO production

To further quantitatively evaluate the anti-inflammatory potency of the active derivatives, six representative compounds, PTS-10, PTS-15, PTS-22, PTS-23, PTS-24, and PTS-25, were selected to determine their IC₅₀ values against NO production. As illustrated in Fig. 3, all evaluated compounds exhibited concentration-dependent inhibition of NO release in LPS-stimulated RAW 264.7 macrophages. Among them, compound PTS-22 displayed the most prominent anti-inflammatory activity, with an IC₅₀ value of 29 ± 1 µM. Compound PTS-15 also demonstrated favorable inhibitory efficacy with an IC50 value of 39 ± 2 µM. The IC₅₀ values for the remaining compounds, PTS-10, PTS-23, PTS-24, and PTS-25, ranged from 42 to 53 µM. Taking into account both their outstanding anti-inflammatory efficacy and favorable low cytotoxicity, compounds PTS-15 and PTS-22 emerged as the most promising lead compounds, which were subsequently selected for further evaluation of their regulatory effects on the gene transcription of pro-inflammatory cytokines.

Fig. 3. (A–F) Dose-response curves of compounds PTS-10 (A), PTS-15 (B), PTS-22 (C), PTS-23 (D), PTS-24 (E), and PTS-25 (F) on the inhibition of NO release. RAW 264.7 macrophages were pre-treated with various concentrations of the indicated compounds for 2 h, followed by stimulation with LPS (1 µg/mL) for 24 h. IC₅₀ values were calculated using non-linear regression analysis. All data are expressed as the mean ± SD of three independent experiments.

2.5. Compounds PTS-15 and PTS-22 downregulate inflammatory cytokine gene transcription

Quantitative polymerase chain reaction (qPCR) was employed to assess the effects of compounds PTS-15 and PTS-22 on the gene transcription levels of inflammatory cytokines in RAW 264.7 cells. Cells were pretreated with each compound at concentrations of 1, 10, and 25 µM for 2 hours, followed by stimulation with 1 µg/mL LPS for 24 hours. Total RNA was extracted, reverse transcribed into cDNA, and subjected to qPCR analysis. The results indicated that compounds PTS-15 and PTS-22 inhibited the mRNA expression of IL-1β, IL-6, and TNF-α in a concentration-dependent manner. As shown in Fig. 4A–D, compound PTS-22 exhibited stronger inhibition of IL-1β and IL-6 gene transcription at 25 µM compared to PTS-15. However, both compounds showed comparable inhibition of TNF-α transcription (Fig. 4E and F). Given its excellent anti-inflammatory activity and low cytotoxicity, compound PTS-22 was selected for subsequent biological evaluations.

Fig. 4. Compounds PTS-15 and PTS-22 inhibit inflammatory cytokine gene transcription. (A and B) Effects of compounds PTS-15 (A) and PTS-22 (B) on IL-1β gene expression; (C and D) effects of compounds PTS-15 (C) and PTS-22 (D) on IL-6 gene expression; (E and F) effects of compounds PTS-15 (E) and PTS-22 (F) on TNF-α gene expression. Statistical differences were evaluated using a one-way ANOVA. ^####p < 0.0001 versus the blank control group; **p < 0.01, ****p < 0.0001 versus the LPS-stimulated group.

2.6. PTS-22 inhibits the release of inflammatory cytokines

To further investigate its anti-inflammatory potential, the effect of PTS-22 on the secretion of pro-inflammatory cytokines was evaluated, using dexamethasone (10 µM) as a positive control. After 24 hours of LPS stimulation, RAW 264.7 macrophages secreted substantial amounts of IL-6 and TNF-α, two key mediators of inflammatory and immune responses. Enzyme-linked immunosorbent assay (ELISA) results demonstrated that treatment with PTS-22 significantly suppressed the secretion of IL-6 and TNF-α. Consistent with the qPCR results, PTS-22 exhibited notable inhibitory activity against the release of both cytokines at 25 µM (Fig. 4 and 5A, B).

Fig. 5. Inhibitory effects of PTS-22 on the release of inflammatory cytokines and the NF-κB pathway. (A) ELISA analysis of IL-6 levels in RAW 264.7 cells treated with PTS-22. (B) ELISA analysis of TNF-α levels in RAW 264.7 cells treated with PTS-22. (C) Western blot analysis of total p65, p-p65, Pro-IL-1β, and IκBα protein expressions, with GAPDH used as the loading control. Cells were pre-treated with various concentrations of PTS-22 (10, 25, 50 µM) or BAY 11-7082 (BAY, 25 µM) for 1 h, followed by LPS stimulation for 12 h. (D–G) The fold changes of (D) total p65, (E) p-p65, (F) Pro-IL-1β, and (G) IκBα normalized to GAPDH are presented, respectively. Statistical differences were evaluated using a one-way ANOVA. ^####p < 0.0001 versus the blank control group; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 versus the LPS-stimulated group. NS: no significant difference.

2.7. Compound PTS-22 inhibits the NF-κB signaling pathway

qPCR results indicated that the N-(4-(diethylamino)-2-methylphenyl)thiophene-2-sulfonamide derivatives significantly inhibited the transcription of pro-inflammatory cytokines such as IL-1β and IL-6. Therefore, we further investigated the effect of the lead compound PTS-22 on the NF-κB signaling pathway, using the classical NF-κB inhibitor BAY 11-7082 as a positive control. Under physiological conditions, NF-κB forms a stable complex with the inhibitory protein IκBα in the cytoplasm.³³ Upon LPS stimulation in macrophages, the TLR4 signaling cascade activates the IKK complex, leading to the phosphorylation and subsequent degradation of IκBα. This causes the dissociation of the NF-κB complex, followed by the phosphorylation (p-p65) and nuclear translocation of its core subunit p65. This nuclear entry subsequently initiates the robust expression of iNOS and pro-inflammatory cytokines, alongside the compensatory transcriptional resynthesis of IκBα.^34,35

As shown in Fig. 5, the level of phosphorylated p65 and the downstream pro-inflammatory cytokine precursor Pro-IL-1β was significantly upregulated after 3 h of LPS stimulation. The experimental results demonstrated that compound PTS-22 markedly suppressed the phosphorylation of p65 and the subsequent protein expression of IL-1β in a concentration-dependent manner. Furthermore, the transcription of the IκBα gene is directly regulated by NF-κB, which constitutes a classical negative feedback loop within the pathway. Consequently, the blockade of p65 activation by PTS-22 interrupted this compensatory resynthesis pathway, explaining the observed dose-dependent inhibitory effect of PTS-22 on IκBα protein expression as well. NF-κB serves as a critical upstream transcription factor for the iNOS gene.^33,36 Therefore, the significant blockade of the NF-κB signaling pathway by PTS-22 provides a mechanistic explanation for the diminished NO production observed in our initial phenotypic screening.

2.8. Molecular docking

Prompted by the promising qPCR results and the confirmed suppression of the NF-κB pathway, molecular docking studies were performed to theoretically analyze the binding modes. NF-κB (PDB ID: 1IKN) and IKK were used for docking with the target compounds. The results showed that both PTS-15 and PTS-22 bind to the p50 subunit of NF-κB, with docking scores of −4.588 and −5.393 kcal mol⁻¹, respectively. Specifically, as shown in Fig. 6, the sulfonamide oxygen of PTS-15 forms a hydrogen bond with the amino group of Gln212 on the NF-κB p50 subunit. A hydrogen on the naphthalene ring of PTS-15 forms an aromatic H-bond with the carbonyl oxygen of Pro342. For compound PTS-22, the two oxygen atoms of the sulfonamide group form hydrogen bonds with the –NH₃⁺ of Lys343 and the –NH₃⁺ of Lys249, respectively. The N⁻ of the sulfonamide in compound PTS-22 forms a salt bridge with the –NH₃⁺ of Lys249. In addition, the hydrogens on the p-fluorophenyl ring and the thiophene ring form two aromatic H-bonds with the carbonyl oxygen of Gln212. Taken together, these docking results provide a theoretical explanation for the superior inhibitory activity of PTS-22 against NF-κB.

Fig. 6. Molecular docking of compounds PTS-15 and PTS-22 with NF-κB (PDB ID: 1IKN). (A) The 3D docking model of compound PTS-15 binding to NF-κB. (B) The 3D docking model of compound PTS-22 binding to NF-κB.

2.9. Theoretical ADME calculations

The theoretical ADME analyses carried out via the SwissADME platform were used to evaluate the drug-likeness and pharmacokinetic parameters of 31 phenyl thiophene sulfonamide derivatives. As summarized in Table 2, the majority of the compounds exhibited promising drug-like properties, including key drug-likeness criteria, such as Lipinski's rule of five and Ghose's criteria. Among the evaluated compounds, the compounds PTS-15 and PTS-22 demonstrated promising anti-inflammatory activity, supported by favorable drug-likeness properties. PTS-15, with a molecular weight of 450.62 g mol⁻¹, a moderate lipophilicity (WLOGP: 7.41), and 7 rotatable bonds, exhibited promising drug-like features despite its relatively high molecular weight and lipophilicity. Although it showed no violations of Lipinski's criteria, its predicted low gastrointestinal (GI) absorption indicated a need for further structural refinement to enhance bioavailability. PTS-22 also demonstrated good drug-likeness, with a WLOGP of 6.82 and 3 hydrogen bond acceptors. It displayed physicochemical properties conducive to membrane permeability. However, similar to PTS-15, its low predicted GI absorption suggested that structural optimization may be necessary to improve systemic exposure following oral administration. Together, these findings highlighted PTS-15 and PTS-22 as promising lead compounds with drug-like characteristics, suitable for further development and pharmacokinetic enhancement.

Table 2. Analysis of SwissADME parameters of 31 phenyl thiophene sulfonamide derivatives^a.

Comp.	MW (g mol−1)	#Rotatable bonds	#H-bond acceptors	#H-bond donors	MR	WLOGP	MLOGP	GI absorption	Lipinski #violations	Ghose #violations
PTS-1	352.51	7	2	1	99.99	5.16	2.54	High	0	0
PTS-2	366.54	8	2	1	104.8	5.55	2.77	High	0	0
PTS-3	380.57	9	2	1	109.61	5.94	3.01	High	0	1
PTS-4	394.59	10	2	1	114.41	6.33	3.23	Low	0	1
PTS-5	404.59	7	2	1	117.42	6.55	3.38	Low	0	1
PTS-6	451.6	7	3	1	130.96	6.81	3.14	Low	0	2
PTS-7	451.6	7	3	1	130.96	6.81	3.14	Low	0	2
PTS-8	401.55	7	3	1	113.45	5.66	2.18	High	0	1
PTS-9	390.52	7	3	1	107.92	5.85	1.99	Low	0	1
PTS-10	406.59	7	2	1	113.53	6.32	2.82	Low	0	1
PTS-11	406.59	7	2	1	113.53	6.32	2.82	Low	0	1
PTS-12	402.53	7	4	1	111.25	5.05	1.54	High	0	0
PTS-13	390.52	7	3	2	107.8	4.98	1.75	Low	0	0
PTS-14	522.7	7	3	1	146.29	8.52	4.52	Low	2	3
PTS-15	450.62	7	2	1	133.16	7.41	3.91	Low	0	2
PTS-16	450.62	7	2	1	133.16	7.41	3.91	Low	0	2
PTS-17	440.58	7	3	1	125.43	7.01	2.96	Low	0	1
PTS-18	456.64	7	2	1	131.04	7.48	3.79	Low	0	2
PTS-19	391.51	7	4	1	105.72	5.25	1.75	Low	0	0
PTS-20	414.58	7	2	1	120.62	6.57	3.45	Low	0	1
PTS-21	485.66	8	3	1	141.38	5.72	2.71	High	0	3
PTS-22	418.55	7	3	1	115.61	6.82	3.61	Low	0	1
PTS-23	418.55	7	3	1	115.61	6.82	3.61	Low	0	1
PTS-24	418.55	7	3	1	115.61	6.82	3.61	Low	0	1
PTS-25	415.57	7	2	2	120.06	5.85	2.67	Low	0	1
PTS-26	430.58	8	3	1	122.15	6.27	2.89	Low	0	1
PTS-27	476.65	8	2	1	141.09	7.93	4.28	Low	1	2
PTS-28	445.56	8	4	1	124.48	6.17	2.27	Low	0	1
PTS-29	425.57	7	3	1	120.37	6.13	2.55	Low	0	1
PTS-30	442.59	8	3	1	125.85	6.46	2.76	Low	0	1
PTS-31	364.53	7	2	1	102.69	5.41	2.77	High	0	0

^aTheoretical ADME analyses were performed using the SWISSADME platform.

3. Conclusion

Inflammation is a tightly regulated physiological process that plays a dual role in host defense and tissue homeostasis. It involves a complex interplay of immune cells and signaling molecules that coordinate protective responses to harmful stimuli. However, when dysregulated, inflammation can contribute to acute tissue injury and the pathogenesis of chronic diseases. Accordingly, therapeutic strategies targeting inflammation must strike a delicate balance—attenuating excessive or persistent inflammatory responses while preserving essential immune functions.

In this study, an in-house anti-inflammatory screening identified a phenylthiophene sulfonamide compound as a hit inhibitor of LPS-induced NO production. Based on the phenylthiophene sulfonamide scaffold, a series of 31 novel derivatives were synthesized via multi-step reactions, including substitution, hydrogenation, and coupling reactions. The cytotoxicity of these derivatives against THP-Ms and RAW 264.7 cells was evaluated using the CCK-8 assay. Most compounds exhibited no obvious cytotoxicity, whereas a few derivatives—those bearing pyridine, 1H-pyrazol-3-yl, 1H-indol-4-yl, meta-fluorophenyl, 4-acetylphenyl, and cyclopropyl substituents (PTS-11, PTS-13, PTS-16, PTS-24, PTS-30, and PTS-31)—significantly inhibited cell proliferation. In the preliminary SAR analysis, the effects of electronic properties and (hetero)aryl substitutions on anti-inflammatory activity were investigated. Open-chain alkyl substitutions generally led to weaker anti-inflammatory effects. Among aryl substitutions, electron-withdrawing groups conferred enhanced anti-inflammatory activity. Moreover, the substitution position on the aryl ring had a relatively minor influence on activity. Considering both efficacy and cytotoxicity profiles, PTS-15 and PTS-22 emerged as the most promising compounds, significantly suppressing LPS-induced NO production with IC₅₀ values of 39 ± 2 µM and 29 ± 1 µM, respectively, without apparent cytotoxic effects. These two compounds were therefore selected for further investigation.

Further biological evaluations revealed that both PTS-15 and PTS-22 effectively suppressed the mRNA transcription levels of key inflammatory cytokines, including IL-1β, IL-6, and TNF-α. In addition, ELISA assays confirmed that PTS-22 markedly inhibited the LPS-induced release of IL-6 and TNF-α in a concentration-dependent manner. To deeply elucidate the underlying pharmacological mechanisms, western blot analysis was conducted. The results demonstrated that PTS-22 exerts its promising anti-inflammatory efficacy by downregulating the NF-κB signaling pathway. Specifically, PTS-22 significantly inhibited the phosphorylation of the p65 subunit and promoted the expression of IκBα via a negative feedback mechanism, thereby preventing subsequent inflammatory cascades. Furthermore, molecular docking studies corroborated these findings by revealing the potential binding modes of PTS-15 and PTS-22 within the binding pocket of the NF-κB p50 subunit (PDB ID: 1IKN).

In summary, phenylthiophene sulfonamide-based compounds, particularly PTS-15 and PTS-22, demonstrated significant inhibitory effects on LPS-induced inflammatory responses. Through the regulation of the NF-κB signaling pathway, these compounds represent promising candidates for further optimization and development as potential therapeutics for inflammatory diseases.

4. Experimental section

4.1. Biological reagents

Dulbecco's modified Eagle's medium (DMEM, C3113-0500) and fetal bovine serum (FBS, C04001-500) were obtained from XP BioMed Co., Ltd, Shanghai, China. The Cell Counting Kit-8 (CCK-8, CD2001-030) was acquired from INNIBIO Co., Ltd, Guangzhou, China. Lipopolysaccharides (LPS, L2880) were obtained from Sigma-Aldrich, Louis, USA. Nitric Oxide (NO) Assay Kit (S0021M) was purchased from Beyotime Biotechnology Co., Ltd, Shanghai, China. Mouse IL-6 ELISA Kit (EK0411), and Mouse TNF-α ELISA Kit (EK0527) were purchased from Boster Biological Technology, Ltd Wuhan, China. The TransZol UP RNA Extraction Kit (ET111-01-V2), TransScript® All-in-One First-Strand cDNA Synthesis Kit (AT341), and PerfectStart® Green qPCR SuperMix (AQ602) were procured from TransGen Biotech Co., Ltd, Beijing, China.

4.2. Cell culture

The RAW 264.7 and THP-1 cell lines were acquired from Abiowell Biotechnology Co., Ltd, Hunan, China and the Shanghai Institute of Biochemistry and Cell Biology, respectively. RAW 264.7 cells were grown in DMEM supplemented with 10% FBS in a humidified incubator at 37 °C with 5% CO₂. Human THP-1 cells were maintained in RPMI 1640 medium, enriched with 10% (v/v) FBS.

4.3. Cell viability assay

THP-1 cells were plated at 1.0 × 10⁴ cells per well in a 96-well plate and differentiated into THP-Ms using 100 ng/mL PMA overnight. THP-Ms were incubated with varying concentrations of the phenylthiophene sulfonamide derivatives (ranging from 3.125 µM to 100 µM) for 48 hours. Subsequently, 10.0 µL of CCK-8 reagent was added and incubated for 2 hours. Absorbance at 450 nm was recorded using a PerkinElmer Victor Nivo Alpha 5 microplate reader.

RAW 264.7 cells were seeded into 96-well plates at 2 × 10⁴ cells per well and incubated for 24 h. Subsequently, cells were treated with varying concentrations of phenylthiophene sulfonamide derivatives (0.01, 0.1, 1, 10, 25, 50 µM) or vehicle control for 24 h. The CCK-8 solution (10 µL per well) was added to the 96-well plate, thoroughly mixed, and incubated in the humidified incubator for 2 h. The absorbance of each well at 450 nm was measured using a microplate reader (PerkinElmer, Waltham, USA). Cell viability (%) was subsequently calculated as (OD sample − OD control/OD control) × 100%.

4.4. Measurement of NO production

The RAW 264.7 cells were seeded into 96-well plates at 2 × 10⁴ cells per well and incubated for 24 h. Then, RAW 264.7 cells were stimulated by 1 µg/mL LPS for 24 h, with or without compound pretreatment for 2 h before stimulation. The NO content in cell culture supernatants was measured using NO assay kit according to the manufacturer's instructions.

4.5. ELISA

The RAW 264.7 cells were seeded into 96-well plates at 2 × 10⁴ cells per well for 24 h. Subsequently, the cells were pre-treated with different concentrations of the test compounds or dexamethasone (Dex, 10 µM) as a positive control for 2 h, prior to stimulation with 1 µg/mL LPS. After 24 h, the culture supernatants were collected, and the secretion levels of IL-6 and TNF-α were quantified using the respective ELISA kits, according to the manufacturer's instructions.

4.6. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

RAW 264.7 cells were seeded into 6-well plates at 5 × 10⁵ cells per well and incubated for 24 h. Pretreatment with different concentrations of compounds for 2 h followed by 1 µg/mL LPS induction for 24 h. Total RNA was extracted using TransZol UP reagent and quantified using a Microvolume spectrophotometer (YoMim, Hangzhou, China). Total RNA was reverse-transcribed into complementary DNA (cDNA) using the TransScript® All-in-One First-Strand cDNA Synthesis Kit. RT-qPCR was conducted on the Time-resolved quantitative PCR system (ROCGENE, Beijing, China) using PerfectStart® Green qPCR SuperMix. The 2^−ΔΔC_t method was employed to quantify relative gene expression levels, with GAPDH serving as a housekeeping reference gene for data normalization. The primers used for qPCR were obtained from Generay Biotech Co. Ltd (Shanghai, China) and are detailed in Table 3.

Table 3. List of primer sequences for RT-qPCR.

Gene name	Sequence
IL-1β	F: TCGCAGCAGCACATCAACAAGAG
	R: AGGTCCACGGGAAAGACACAGG
IL-6	F: CTTCTTGGGACTGATGCTGGTGAC
	R: AGGTCTGTTGGGAGTGGTATCCTC
TNF-α	F: GCCTCTTCTCATTCCTGCTTGTGG
	R: GTGGTTTGTGAGTGTGAGGGTCTG
GAPDH	F: GGCAAATTCAACGGCACAGTCAAG
	R: TCGCTCCTGGAAGATGGTGATGG

4.7. Western blots

RAW 264.7 macrophages were pre-treated with the compounds for 12 h and then stimulated with LPS (1 µg/mL) for 3 h. Total protein samples were collected by lysing the cells with NP-40 lysis buffer supplemented with protease and phosphatase inhibitor cocktails (Beyotime) on ice for 60 min. The cell lysates were centrifuged at 12 000 rpm for 15 min at 4 °C, and the supernatants were collected. Protein concentrations were determined using a BCA protein assay kit (NCM Biotech).

Protein samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to PVDF membranes (Immobilon-PSQ Membrane, Merck Millipore) using a wet-transfer system. The membranes were blocked at room temperature for 2 h. Specifically, the membrane for the phosphorylated target (p-p65) was blocked with 5% bovine serum albumin (BSA) in TBS-T solution, while the membranes for the other non-phosphorylated targets were blocked with 5% non-fat milk in TBS-T solution. After blocking, the membranes were incubated with the respective primary antibody solutions overnight at 4 °C. The primary antibodies used were: anti-p-p65 (HuaBio, 1:5000), anti-p65 (HuaBio, 1:5000), anti-IκBα (HuaBio, 1:5000), anti-IL-1β (Cell Signaling Technology, 1:1000), and anti-GAPDH (Proteintech, 1:10 000). The next day, the PVDF membranes were incubated with horseradish peroxidase (HRP)-labeled secondary antibody solution (Beyotime, 1:2000) for 1.5 h at room temperature. After incubation with ultra-sensitive ECL chemiluminescence reagent (Beyotime, P0018S), the membranes were visualized using the ChemiDoc imaging system (Bio-Rad, Chemidoc XRS+). The optical densities of the bands were quantified utilizing ImageJ software.

4.8. Molecular docking

Schrödinger software was utilized to investigate the binding affinities and interaction patterns between phenylthiophene sulfonamide derivatives and the predicted targets. The crystal structures of NF-κB (PDB ID: 1IKN) were downloaded from PDB and prepared using the Schrödinger Protein Preparation Wizard, which included water molecule removal and energy minimization. The compounds PTS-15 and PTS-22 were prepared using the LigPrep module. Molecular docking studies were conducted using the Glide module, with binding energy serving as an indicator of the ligand-protein binding affinity.

4.9. Theoretical ADME analysis

The structures of the 31 phenylthiophene sulfonamide derivatives were drawn up using ChemDraw and then uploaded to the SwissADME (https://www.swissadme.ch/index.php) platform for theoretical calculations. Key ADME properties were computed and thoroughly assessed to determine their pharmacokinetic profiles.

4.10. Statistical analysis

All results are expressed as the mean ± SEM. Statistical analysis was performed with GraphPad Prism. Statistical comparisons were performed by a one-way analysis of variance (ANOVA) followed by Dunnett's test. The statistical significance was as follows: ^####p < 0.0001 versus the Blank group; *p < 0.05, **p < 0.01, and ***p < 0.001 and not significant (NS) versus the LPS-treated group.

Author contributions

Zhen Dai: conceptualization, investigation, formal analysis, writing – original draft, funding acquisition. Ting Peng: conceptualization, writing – review and editing, supervision, funding acquisition. Xiuli Yang: investigation. Chenli Bai: investigation and formal analysis. Ke Wang: investigation. Jie Huang: investigation. Xin Wen: investigation. Xia Wu: investigation. Jianjun Ding: investigation, methodology. Yong Li: writing – original draft, funding acquisition. Yujiao He: writing – review and editing, supervision, funding acquisition. All authors approved the manuscript's final version.

Conflicts of interest

The authors confirm no financial or personal conflicts of interest that could have influenced this study.

Data availability

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Supplementary information (SI): chemical synthesis of intermediates, NMR spectra for synthetic compounds and HPLC-MS spectra for synthetic compounds. See DOI: https://doi.org/10.1039/d6ra03406c.