Effects of Intravenous Lidocaine on Rheumatoid Arthritis in Preclinical Rat Model and Clinical Trial

Abstract

Background

Rheumatoid arthritis (RA) is characterized by chronic synovial inflammation and pain. Lidocaine has anti-inflammation and pain-relieving properties. This study intends to evaluate the effects of lidocaine on RA in a preclinical rat model and a clinical trial.

Methods

Rats with adjuvant-induced arthritis (AIA) received intravenous lidocaine or no treatment. Pain behavior parameters and arthritis index (AI) were assessed. Synovial tissue lesions, the number of M1 macrophages and gene expression of inflammatory molecules: IKKα, NF-κB p65, IL-1β and TNF-α were profiled by immunohistochemical staining or quantitative PCR. In clinical trial, RA patients (n=40) were assigned into two groups: control group received conventional treatments, lidocaine group: received conventional treatment and intravenous lidocaine for 5 days. Visual analogue scale score (VAS), disease activity score 28 (DAS28) and temperature in painful joint area were recorded.

Results

Lidocaine-treated rats had significantly lower pain parameters, synovial pathology and AI scores, M1 macrophages and gene expressions of inflammatory molecules in synovial tissues on day 28 post modeling compared to AIA rats without the treatment. In a clinical trial, patients who received intravenous lidocaine had similar VAS, DAS28 and SDAI scores in comparison with patients without the treatment. However, lidocaine-treated patients had significantly lower temperatures in the painful joint areas and dosages of glucocorticoids and nonsteroidal anti-inflammatory drugs during the treatment period, compared to patients without intravenous lidocaine.

Conclusion

Intravenous lidocaine attenuated joint pain and synovial inflammation in preclinical AIA rat model and provided adjunctive beneficial effects for the treatment of RA patients.

Introduction

Rheumatoid arthritis (RA) is an autoimmune disease of unknown etiology characterized by chronic synovial inflammation.¹ Its course is protracted and recurrent, often accompanied by moderate to severe chronic pain. Prolonged pain significantly impacts patients’ physical and mental health as well as their quality of life.² Current therapeutic approaches for RA primarily include pharmacological treatments such as nonsteroidal anti-inflammatory drugs (NSAID), disease-modifying anti-rheumatic drugs (DMARD), glucocorticoids (GC), biologic DMARDs (bDMARD), and immunosuppressants;³ surgical interventions like synovectomy and total joint replacement;⁴ as well as emerging techniques including stem cell transplantation⁵ and lesion-specific nerve blockades.⁶ Therapeutics such as GC and NSAID often target macrophages to suppress inflammation and prevent joint erosion⁷ and provide rapid relief from pain and joint swelling in RA.³

Lidocaine is a rapid-acting amide-type anesthetic and used for local and regional anesthesia in standard surgical and dental procedures and chronic pain management.⁸ Systemic administration of lidocaine exhibits anti-nociceptive, anti-arrhythmic and anti-thrombotic effects⁹ by reversibly blocking voltage-gated sodium channels in nerve and cardiac tissues and halting the propagation of pain signals and stabilizing electrical activity in the heart.¹⁰ Clinical study shows that lidocaine patches can significantly improve pain, stiffness and physical function for knee osteoarthritis.¹¹ Lidocaine also has potent anti-inflammatory effects on macrophages through inhibiting macrophage adhesion, chemotaxis and phagocytosis.^12,13 Macrophages play a critical role in the pathogenesis of RA.¹⁴ The cellular infiltrates accumulate in synovium - the joint lining where pro-inflammatory M1 macrophages function as the primary drivers of joint inflammation¹⁵ and destroy cartilage and bone.¹⁶ It is unclear whether lidocaine possesses an inhibitory function on macrophage and therapeutic effects on RA. In this study, we utilized a preclinical adjuvant-induced arthritis (AIA) rat model and a clinical trial to evaluate the therapeutic potential of lidocaine on RA.

Methods

Preclinical AIA Rat Model

Pathogen-free healthy adult Lewis male rats (7–8 weeks old, weight 200±50g) (Supplied by Beijing VTLH Laboratory Animal Technology Co., Ltd.) were used to establish a preclinical AIA model that is a highly utilized preclinical framework in rheumatology and pain research.¹⁷ The rats were acclimated in the animal facility for one week (12h–12h light-dark cycle, free access to water and food, temperature 23–25°C); and randomly assigned into three groups (n = 11 per group): saline + adjuvant (Complete Freund’s Adjuvant) group (CFA group, CG), lidocaine + CFA group (LG), naïve rats without any treatment served as blank control group (BG). As previously described,¹⁸ rats in CG and LG groups underwent footpad injection of 0.1 mL (CFA (10 mg/mL) after disinfection of the hind paw. The needle was slowly withdrawn post-injection, and the injection site was pressed with a sterile cotton ball to prevent fluid leakage. The BG group received an equal volume of physiological saline via the same injection method. Observations were conducted at pre-modeling (Day 0, T0), 21 days (T1), and 28 days post-modeling (T2) to assess dietary intake, fur condition, activity levels, body weight changes, behavioral patterns, joint radiography, paw prints, and footpad swelling measured using a Vernier caliper. Following the criteria,¹⁹ modeling was considered successful at 21 days. All the animal experiments were reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of Guizhou Provincial People’s Hospital (Approval No.: Lun Shen (Animal) (2022–015)). All procedures were performed in accordance with the national guidelines for IACUC regulations, followed for the welfare of the laboratory animals.

Internal Jugular Vein Catheterization

Following successful modeling, rats were weighed and administered with 30 mg/kg of 1% sodium pentobarbital (MERCK, P3761) via intraperitoneal injection. After anesthesia took effect, the neck and back regions were shaved and prepared. The area was disinfected with povidone-iodine, followed by alcohol removal of iodine. An incision was made along the midline of the neck.

Muscle and mucosal tissues were bluntly dissected to expose the jugular vein. The vein was dissected, its distal end ligated, and its proximal end clamped with a hemostat. A small opening was then created in the vein using microforceps for later use. A 12 cm segment of PE catheter was cut, filled with saline, and sealed at one end. This prepared catheter was sterilized for later use. Make a 2–3 cm incision on the rat’s back. Use hemostatic forceps to bluntly dissect the subcutaneous tissue, allowing the PE catheter to traverse subcutaneously from the anterior neck to the back. Prepare a suture at the proximal end of the vein. Carefully insert the PE catheter 3–4 cm through the incision and secure it. Turn the rat onto its side. Cut off the sealed end of the PE catheter. Inject approximately 0.2 mL of saline solution using a 1 mL syringe to confirm successful catheterization. Fill the catheter with heparin sodium (1 mg/mL) and reseal the PE catheter. Suture the neck and back incisions sequentially. Disinfect with povidone-iodine. After the rat regains consciousness on the electric heating pad, return it to the housing cage for general condition observation and documentation.

Intra-Jugular Pump Infusion

Following successful catheter placement: LG group: Prepare lidocaine solution at 5 mg/kg based on species-specific dosage conversion, then continuously infuse at 2 mL/h for 2 hours. BG and G groups: Administer equal volumes of saline solution (2 mL/h) via the same method for 2 hours. Administered once daily, with a maximum daily infusion volume not exceeding 4 mL. Continuous administration was maintained for 5 days. Vital signs were monitored throughout infusion to detect signs of local anesthetic toxicity, such as convulsions.

This study referenced current clinical anesthesia protocols for lidocaine continuous infusion, primarily ranging from 0.5–1.5 mg/kg/hour.²⁰ Dosage conversion was performed using the rat-to-human conversion factor of 0.018 from “Equivalent Dose Conversion Between Animals and Humans in Pharmacological Trials”,²¹ which specifies a conversion factor between rats and humans. The final dose was calculated as 5 mg/kg based on body weight, diluted with saline to 4 mL. The solution was prepared immediately before use and administered via a simple pump. LG rats: The prepared lidocaine (5 mg/kg) solution was continuously infused at 2 mL/h for 2 hours. BG and CG groups received saline via the same method. The intervention required continuous infusion for 5 days. During infusion, vital signs were closely monitored for stability, and adverse effects such as convulsions (indicating local anesthetic toxicity) or allergic reactions were observed.

General Condition and Arthritis Index Scoring

At T0, T1, and T2, observe the general condition of rats in each group. Indicators include diet, fur condition, activity level, weight changes, behavioral habits, joint photography, paw prints, and caliper measurements of paw swelling in each group. At T0, T1, and T2, the arthritis index (AI)²² was scored for the rats. The AI scoring criteria are detailed in Table 1.

Table 1.

AI Score

Score	Scale of Marks
0	No redness or swelling in the ankle joint
1	Erythema and mild swelling in ankle joint
2	Erythema, mild swelling in ankle, toe or metacarpal joint
3	Erythema, moderate swelling in ankle, metatarsophalangeal or metacarpophalangeal joints.
4	Erythema and severe swelling in ankle and toe joints

Pain Behavioral Testing

Mechanical Withdrawal Thresholds (MWT):²³ At time points T0, T1, and T2, MWT in rats were assessed. Rats were placed in a cage with a perforated bottom (30 cm × 20 cm × 50 cm). After a 15-minute adaptation period until exploratory behavior ceased, pain stimulation was administered by applying vertical pressure to the rat’s hind paw using a Von Frey fiber (avoiding the pad). Each stimulus lasted ≤1 second, with ≥10 seconds between stimuli. Positive responses included paw withdrawal or licking of the hind paw. The fiber intensity yielding a positive response was recorded. Each hind paw was tested five times on the same side, and the average value represented the MWT.

Thermal Withdrawal Latency (TWL):²⁴ set the temperature to 52°C ± 0.2°C. Allow the rat to adapt to the apparatus by holding it in its cage until it exhibits no struggle response. Then place the rat in the apparatus, ensuring full contact between its hind paw and the heating plate. Record the time until the rat lifts its paw or licks its hind paw. Repeat the measurement five times, with a 5-minute interval between each measurement. The average of the last three measurements represents the rat’s TWL.

X-Ray Measurement

Following the intervention, rats in each group were anesthetized with 1% sodium pentobarbital and placed supine on the operating table for X-ray examination. The medial and lateral diameters at the most swollen site of the ankle joint were measured for comparison. After recovery, the rats were returned to their housing cages for general condition observation and documentation.

Sample Collection

Rats were weighed and euthanized using a carbon dioxide gas chamber via a gradual-fill method, following the AVMA Guidelines for the Euthanasia of Animals (2020 Edition) to humanely minimize pain and distress. They were placed in a supine position, the abdomen was disinfected, and the abdominal cavity was fully exposed. The abdominal aorta was dissected, and blood was collected using red tubes without anticoagulant. After centrifugation at 3500 rpm for 15 minutes, the samples were stored at −20°C. Following blood collection, the thoracic cavity was opened, the right atrial appendage incised, and excess blood drained before perfusion. H&E samples: After perfusion with physiological saline + paraformaldehyde, ankle tissue was harvested and fixed in 4% paraformaldehyde. Immunofluorescence and PCR samples: After physiological saline perfusion, ankle tissue was harvested on ice and stored at −80°C.

H&E Staining and Pathological Scoring Criteria

Rat ankle joint tissue was fixed in 4% paraformaldehyde for 30 minutes, followed by routine dehydration and embedding. Embedded paraffin blocks were mounted on a microtome and sectioned into 5–8 μm thick slices, then subjected to routine dewaxing and rehydration. Rehydrated sections were placed in Harris hematoxylin stain for 3–8 minutes, rinsed with tap water, differentiated with 1% hydrochloric acid in ethanol for several seconds, rinsed with tap water, counterstained with 0.6% ammonia solution, rinsed with running water, and then stained with eosin solution for 1–3 minutes. Stained sections underwent routine dehydration and clearing, neutral resin embedding, and finally, qualified samples underwent synovial pathology scoring. The synovial pathology scoring criteria are shown in Table 2.

Table 2.

Scoring Criteria for Synovial Pathology

Synovial Cells	Lymphocytes	Neovascularization	Score
< 3 layers	No	No	0
3~4 layers	Aggregation	Mild	1
5~6 layers	Forming lymphoid follicles	Moderate	2
>6 layers	Forming germinal centers	Severe	3

Immunohistochemical Staining

Prepare paraffin sections from rat ankle joints and deparaffinize to water:

Sequentially place sections in Xylene I for 20 minutes, Xylene II for 20 minutes, anhydrous ethanol I for 5 minutes, anhydrous ethanol II for 5 min, 75% ethanol for 5 min, then rinse with tap water; Place tissue sections in a pressure cooker filled with citric acid (pH 6.0) antigen retrieval solution for antigen retrieval. Steam for 2.5 minutes, and cool naturally, then place slides in PBS (pH 7.4) and wash three times on a decolorization shaking platform, 5 minutes each time. Place sections in 0.3% methanol hydrogen peroxide solution and incubate at room temperature in the dark for 20 minutes. Transfer slides to PBS (pH 7.4) and wash three times on a decolorization shaker, 5 min each time; After gently blotting the slides dry, circle the tissue periphery with a histochemistry pen. Add 5% BSA solution within the circle and block at room temperature for 1 hour. Following blocking, the primary antibody (1:200 dilution) against CD197 molecule – the hallmark of RA synovial fluid M1 macrophages,²⁵ was added onto the slides. Place the slides flat in a humid chamber and incubate overnight at 4°C. Place slides in PBS (pH 7.4) and wash three times on a decolorization rocker, each for 8 minutes. After briefly centrifuging to remove excess solution, add biotin-conjugated secondary antibody within the circled area. Cover the tissue and incubate at room temperature for 50 minutes. Then place slides in PBS (pH 7.4) and wash three times on the decolorization rocker, each for 8 minutes. After briefly centrifuging the slides to remove excess solution, add HRP-labeled streptavidin-conjugated third antibody within the circle, cover the tissue, and incubate at room temperature for 50 min. Subsequently, place the slides in PBS (pH 7.4) and wash three times on a decolorization rocker, each for 8 min. Place the slides in PBS (pH 7.4) and wash three times on a decolorizing rocking platform, each for 5 minutes; after lightly shaking off excess solution, add freshly prepared DAB chromogen solution within the circle. Control the staining time under the microscope; positive results appear brownish yellow. Rinse the slides with tap water to stop staining; Harris’s hematoxylin counterstain for approximately 3 minutes, rinse with tap water, differentiate in differentiation solution for several seconds, rinse with tap water, and restore blue color under running water. Place sections sequentially in 75% ethanol for 6 minutes, 85% ethanol for 6 minutes, anhydrous ethanol I for 6 minutes, anhydrous ethanol II for 6 minutes, xylene I for 7 minutes, xylene II for 7 minutes for dehydration and clearing. Remove the sections from xylene, air-dry briefly, and mount with neutral resin. Finally, examine under a microscope, acquire images, and analyze.

Quantitative PCR

Take a 2 mL grinding tube, add 1 mL of RNA extraction solution, add 3 grinding beads, and pre-cool on ice. Add approximately 20 mg of tissue to the tube. Grind thoroughly using a three-dimensional cryogenic grinder until no visible tissue chunks remain. After sample pretreatment, centrifuge at 12,000 rpm at 4°C for 10 minutes. Transfer the supernatant to a new centrifuge tube. Add 400 μL of chloroform. Mix thoroughly using a Saville vortex mixer or by inverting the tube for 15 seconds and stand for 3 minutes. Centrifuge at 12,000 rpm at 4°C for 10 minutes. Transfer 400 μL of the supernatant to a new centrifuge tube. Add 550 μL of isopropanol and mix by inversion. Incubate at −20°C for 15 minutes. Centrifuge at 12,000 rpm at 4°C for 10 minutes. The white precipitate at the bottom of the tube is RNA. Remove the supernatant. Add 1 mL of 75% ethanol and invert to wash the pellet. Centrifuge at 12,000 rpm at 4°C for 5 minutes. Remove the supernatant completely. Place the tube on a laminar flow hood and blow for 3 minutes. Add 15 μL RNA lysis buffer to dissolve the RNA, then incubate at 55°C for 5 minutes. Measure RNA concentration and purity using Nanodrop 2000: After zeroing the instrument blank, dispense 2.5 μL of the RNA sample onto the detection pad. Lower the sample arm and initiate absorbance measurement using the software. Prepare the reverse transcription reaction mixture by gently mixing and centrifuging. Set the reverse transcription program. Take a 0.1 mL PCR reaction plate and prepare the following reaction mixture, performing triplicate replicates for each sample. Seal the plate using an automated sealer and centrifuge with a microplate centrifuge. Set the PCR amplification program and process the results. Primer information for each gene is listed in Table 3.

Table 3.

Primers for Each Gene

Gene	Forward (5′–3′)	Reverse (5′–3′)
GAPDH	CTGGAGAAACCTGCCAAGTATG	GGTGGAAGAATGGGAGTTGCT
MYD88	CGAGGAGGACTGCCAGAAATAC	CAGTAGCAGATGAAGGCGTCG
IKKα	TTCTCAAGGAGCTGTTTGGTCAC	TTTCTTTCTGCCTCTTTCCCTG
NF-κB p65	CAGATACCACTAAGACGCACCC	CTCCAGGTCTCGCTTCTTCACA
IL-1β	TGTGACTCGTGGGATGATGAC	CCACTTGTTGGCTTATGTTCTGTC
TNF-a	CCAGGTTCTCTTCAAGGGACAA	GGTATGAAATGGCAAATCGGCT

Ethics and Patients

This study complied with the Declaration of Helsinki and registered at the Chinese Clinical Trial Registry (ChiCTR2000033004). All patients and their families signed informed consent forms. Ethical approval was obtained from the Medical Ethics Committee of Guizhou Provincial People’s Hospital [Approval No.: Ethics Document (Research) (2020) No. 12].

Inclusion Criteria: Following the 2010 American College of Rheumatology/European League Against Rheumatism criteria for RA diagnosis,²⁶ 42 RA patients were enrolled between September 2020 and September 2021. Participants were of any gender, aged 30–80 years and weighed 40–75 kg. [Diagnostic criteria: 1. Joint involvement; 2. Serological markers; 3. Duration of synovitis; 4. Acute phase reactants. A total score ≥6 points across these criteria confirmed RA diagnosis].

Exclusion Criteria: 1. Coagulation abnormalities; 2. Psychiatric disorders; 3. Concurrent severe infectious diseases; 4. History of critical conditions involving hematopoietic system, cardiovascular, or cerebrovascular systems; 5. Allergic constitution; 6. Recent self-administration of glucocorticoids (GC), nonsteroidal anti-inflammatory drugs (NSAIDs), or opioid medications. Using a random number table, 42 eligible patients were randomly assigned into two groups (n=21 each) with allocation concealment and blinding: the control group (CG) and the lidocaine group (LG).

Patient Treatment

The conventional treatment regimen: Both groups received standard conventional treatment upon admission: intramuscular injection of methotrexate (Batch No. 271002, Guangdong Lingnan Pharmaceutical Co., Ltd). 5 mg once daily, administered weekly; Intravenous infusion of Luguaduobrain Injection (Batch No. 211202, Harbin Yuheng Pharmaceutical Co., Ltd). 16 mg, once daily; If the patient’s VAS score was ≥5 points, oral administration of prednisolone acetate tablets (Batch No. LA21268, Zhejiang Xianju Pharmaceutical Co., Ltd). 5–60 mg, once daily; oral celecoxib capsules (Batch No. 01211224, Sichuan Guowei Pharmaceutical Co., Ltd). 2 mg, twice daily, until VAS score reaches 4 points.

Lidocaine group, in addition to the conventional treatment regimen, patients received intravenous infusion of lidocaine hydrochloride (Batch No. D32110272, Tianjin Jinyao Group Hubei Tianyao Pharmaceutical Co., Ltd. All patients fasted and abstained from drinking prior to treatment. Upon entering the treatment room, emergency medications and equipment were prepared. Blood pressure, heart rate, blood oxygen saturation (SPO₂) and electrocardiogram were monitored, with nasal cannula oxygen administered (2 L/minute). Vital signs were closely monitored. A 3 mg/kg intravenous infusion of 0.2% lidocaine hydrochloride injection (diluted in 500 mL 0.9% sodium chloride injection) was administered at a rate of 25 L/hour for 2 hours, once daily for 5 consecutive days.²⁷ After each infusion, observe for 30 minutes. If vital signs remain normal, the patient may be safely returned to the ward. If adverse reactions such as bradycardia (<50 beats/minute), hypotension (<90/60 mmHg (1 mmHg = 0.133 kPa)), nausea, or vomiting occur during infusion and show no significant improvement after observation and management, immediately discontinue the infusion.

VAS, DAS28 and SDAI Scores

Adverse reactions including bradycardia, hypotension, nausea and vomiting, abdominal discomfort, moon face, and central obesity were monitored in both patient groups throughout treatment. VAS scores were recorded on day 7 (T1 time point), day 28 (T2), and day 56 (T3) post treatment. A 10 cm straightedge or ruler was used, with 0 representing “no pain” and 10 representing “most severe pain.” A score of 0 indicated no pain sensation; 1–3 indicated mild pain; 4–6 indicates moderate pain affecting sleep but tolerable; 7–10 indicates severe pain, potentially unbearable, with sleep disturbances and poor appetite.

The endpoint of this clinical study is one day after T3 time point.

At T0-T3, disease activity in RA patients was assessed using the Disease Activity Score 28 (DAS28),²⁸ calculated as: DAS28 score = [0.56 × sqrt(t28) + 0.28 × sqrt(sw28) + 0.70 × ln(ESR)] × 1.08 + 0.16, where sqrt denotes square root, where t28 denotes tender joints, sw28 denotes swollen joints, n represents the natural logarithm, and ESR indicates erythrocyte sedimentation rate. DAS28 score > 5.1 indicates active disease; a score < 3.2 indicates slow disease activity; a score < 2.6 indicates remission. SDAI, a simple disease activity index for RA, is the numerical sum of outcome parameters.²⁹ Higher scores indicate more severe disease.

Statistical Analysis

All data were analyzed using Jamovi software version 2.3.21. Normally distributed quantitative data are presented as mean ± standard deviation (x ±s). Intergroup comparisons were performed using one-way analysis of variance (ANOVA). For quantitatively measured data with skewed distributions, median (interquartile range) [M (IQR)]. Intergroup comparisons were performed using the rank-sum test. For categorical data, comparisons were conducted using the chi-square test or Fisher’s exact test. For ordinal data, comparisons were performed using the rank-sum test. p<0.05 was considered statistically significant.

Results

Intravenous Lidocaine Reduced AI Scores in AIA Rats

To evaluate the potential effects of lidocaine on RA, we established a preclinical AIA rat model and treated the rats with intravenous lidocaine. During the experiment, one naïve rat died during internal jugular vein catheterization; one control rat in CG failed to establish the model; one lidocaine-treated rat in LG died during drug administration. The three rats were excluded from this study. Assessment of AI demonstrated that lidocaine-treated rats in LG group had significantly decreased AI scores compared to control rats in CG group at T2 time point (p<0.05) (Table 4). There was no significant difference in AI scores at T1 time point between rats in CG and LG. In addition, naïve rats in BG had zero AI scores (Table 4).

Table 4.

AI Scores at Different Time Points (n=10, M[IQR])

Group	T0	T1	T2
BG	0.00[0.00]	0.00[0.00]	0.00[0.00]
CG	0.00[0.00]	3.00[0.00]a	3.00[0.00]a
LG	0.00[0.00]	3.00[0.00]a	2.00[1.00]ab

Notes: Compared with BG, ^ap<0.05; compared with CG, ^bp<0.05.

Intravenous Lidocaine Attenuated Pain and Joint Swelling in AIA Rats

Analysis of pain behavior parameters showed that control rats in CG exhibited markedly decreased MWT (Table 5) and TWL (Table 6) at T1 and T2 time points in comparison with the values at T0 time point. Lidocaine-treated rats in LG had significantly increased MWT (Table 5) and TWL (Table 6) at T2 time point in comparison with rats in CG, almost reached TWL at T0 time point (Table 6). There was no significant change in MWT and TWL in naïve rats in BG at any time point (Table 5 and Table 6). X-Ray measurement further demonstrated that AIA rats in CG had swollen ankle joints at T2 time-point compared to naïve rats in BG (Figure 1A and B). However, intravenous lidocaine treatment significantly attenuated the joint swelling in LG rats in comparison with rats in CG that received no lidocaine treatment (p<0.05) (Figure 1A and B).

Table 5.

MWT at Different Time Points (n=10, ±S)

Group	T0	T1	T2
BG	9.20±1.03	9.60±0.84	9.60±0.84
CG	9.40±0.97	3.0±1.41a	3.40±0.97a
LG	9.60±0.84	2.8±1.03a	7.60±0.84ab

Notes: Compared with BG, ^ap<0.05; compared with CG, ^bp<0.05.

Table 6.

TWL at Different Time Points (n=10, X±S)

Group	T0	T1	T2
BG	11.24±0.41	11.57±0.40	12.14±0.72
CG	11.55±0.37	6.15±0.66a	7.05±0.34a
LG	11.46±0.40	6.86±0.40a	10.67±0.58ab

Notes: Compared with BG, ^ap<0.05; compared with CG, ^bp<0.05.

Figure 1.

X-Ray imaging of rat ankle joints. Rats were anesthetized at T2 time point and placed supine on the operating table. The ankle joints of rats in each group were subjected to X-ray examination. (A) Measurements of rat ankle joints from each group. (B) A representative X-ray photograph of rat ankle joints from each group (n=10). Compared with BG, ^ap<0.05; compared with CG, ^bp<0.05.

Intravenous Lidocaine Inhibited Synovial Lymphocyte Infiltration and Inflammatory Cytokine Production in AIA Rats

H&E staining demonstrated that the cartilage surface of AIA rats in CG was covered by proliferating synovial cells forming vascular villi at T2 time point, with severe synovial connective tissue hyperplasia and visible neovascularization accompanied by multifocal lymphocytic infiltration (Figure 2). After intravenous lidocaine treatment, the cartilage surface of the rats in LG was covered by proliferating synovial cells forming a vascular veil, with mild proliferation of synovial cells and severe proliferation of connective tissue, along with a small number of new blood vessels and lymphocytic infiltration at T2 time point (Figure 2). Immunohistochemical staining further revealed that intravenous lidocaine significantly reduced the number of CD197-positive infiltrates (a key marker for M1 macrophages)²⁵ in the synovial tissues of the treated rats in LG at T2 time point, compared to the numbers in control rats in CG (p<0.05) (Figure 3A and B). There were no synovial connective tissue hyperplasia and lower infiltrated cells in naïve rats in BG (Figure 2, Figure 3A and B).

Figure 2.

H&E staining of rat synovial tissues. Paraffin-embedded synovial tissue sections of ankle joints harvested from rats at T2 time point were subjected to routine dewaxing, rehydration and staining with Harris hematoxylin and eosin solution. Stained sections were photographed at 10x magnification. Data were representatives of each rat group (n=10).

Figure 3.

CD197⁺ infiltrates in rat synovial tissues. Paraffin-embedded synovial tissue sections of ankle joints harvested from rats at T2 time point were subjected to immunohistochemical staining with anti-CD197 primary antibodies, biotin-conjugated secondary antibody, and horseradish peroxidase-labeled streptavidin-conjugated third antibody. The tissue sections were finally reacted with a 3,3′-diaminobenzidine chromogen solution for visualizing dark brown CD197 protein. (A) The number of CD197 positive infiltrates in rat ankle joint synovial tissues in each group (n=10). (B) Representatives of stained rat synovial tissues from each group, photographed at 10x magnification under a microscope. Compared with BG, ^ap<0.05; compared with CG, ^bp<0.05.

Quantitative PCR assay showed that gene expression levels of pro-inflammatory molecules and cytokines: MYD88, IKKα, NF-κB p65, IL-1β, and TNF-α in ankle synovial tissues of lidocaine-treated rats in LG at T2 time point were significantly lower than the expression levels in rats without lidocaine treatment in CG (p<0.05) (Table 7). Consequently, synovial pathology scoring further demonstrated that lidocaine-treated rats in LG had significantly lower synovial pathology scores in comparison with the rats without the treatment in CG (p<0.05) (Figure 4). The synovial pathology scores in naïve rats were zero.

Table 7.

Gene (mRNA) Expressions in Rat Synovial Tissues (n=10, X±S)

Group	MYD88	IKKα	NF-κB p65	IL-1β	TNF-α
BG	0.79±0.16	1.41±0.26	0.94±0.10	1.07±0.06	1.14± 0.11
CG	5.64±0.73a	10.26±0.68a	10.09±2.20a	1.51±0.12a	1.97±0.14a
LG	2.59±0.41ab	2.44±0.42ab	0.94±0.25b	0.83±0.05ab	0.68±0.15ab

Notes: Compared with BG, ^ap<0.05; compared with CG, ^bp<0.05.

Figure 4.

Synovial pathology scores in rats. H&E-stained rat synovial tissues were subjected to synovial pathology scoring according to the synovial pathology scoring criteria in Table 2. Data was the average of synovial pathology scores in each group (n=10). ^a p<0.05, ^b p<0.05.

VAS, DAS28 and SDAI Scores in RA Patients Before and After Lidocaine Treatment

To investigate whether intravenous lidocaine has similar effects on RA in patients as shown in the preclinical rat model, we performed a clinical trial with 42 RA patients. One subject in CG and one subject in LG was excluded from this study due to poor compliance or bradycardia. There were no significant differences in terms of gender distribution, age, height, weight, disease duration, medical history (Table 8) or joint function classification (Table 9) between the two groups. Analysis of VAS, DAS28 and SDAI scores showed that RA patients treated with intravenous lidocaine in LG had had similar VAS (Table 10), DAS28 and SDAI (Table 11) scores compared to patients without the treatment in CG, although the score at T2 and T3 time points were markedly reduced in comparison with T0 or T1 time point in both groups of patients (Tables 10 and 11).

Table 8.

Patient Characteristics Between the Two Groups (n=20, x±S)

Group	CG	LG	p value
Male/female	10/10	9/11	0.75
Age (year)	76±4	76±5	0.79
Height (cm)	161±6	161±6	0.84
Weight (kg)	59±6	61±5	0.39
Disease (year)	1.6±1.2	1.6±1.2	0.89
Hypertension (case)	2	3	0.63
Gycuresis (case)	5	4	0.71

Table 9.

Joint Function Grades Before Treatment (n=20)

Group	I Level	II Level	III Level	IV Level
CG	10	6	3	1
LG	9	7	3	1
p-value	0.76	0.74	1.00	1.00

Table 10.

VAS Scores Before and After Treatment [n=20, M (IQR)]

Group	T0	T1	T2	T3
CG	6(1)	4(1)	3(0)	2(1)
LG	6(1)	4(1)	3(0)	2(1)
p-value	0.58	0.65	0.58	0.40

Table 11.

DAS28 and SDAI Scores Before and After Treatment (n=20, X±s)

	DAS28				SDAI
	T0	T1	T2	T3	T0	T1	T2	T3
CG	6.5±0.8	5.31±0.72	4.21±0.50	3.11±0.50	55±18	31.0±10.1	18.01±5.0	9.02±4.1
LG	6.2±0.9	5.42±0.81	4.11±0.81	3.01±0.71	68±40	39.3±24.0	19.0±8.01	9.1±4.00
p-value	0.87	0.76	0.50	0.54	0.22	0.18	0.70	0.68

Intravenous Lidocaine Reduced Temperature in Painful Joint Area of RA Patients

Measurement of joint area temperature revealed that RA patients who received intravenous lidocaine treatment in LG had significantly lower temperature in the painful joint area on both hands and the right foot dorsum at T1 time point (7 days post treatment) in comparison with patients without the treatment in CG (p<0.01) (Table 12), along with a lower incidence of adverse reactions. No cases of hypotension occurred in either group.

Table 12.

Temperature in Painful Joint Area of Patients (°C, n=20, X±s)

	Left Hand		Right Hand Back		Left Foot Dorsum		Right Foot Dorsum
	T0	T1	T0	T1	T0	T1	T0	T1
CG	34.41±0.37	33.42±0.56	34.30±0.41	33.28±0.41	33.56±0.31	32.27±0.31	33.51±0.37	32.21±0.55
LG	34.41±0.60	33.07±0.56	34.26±0.22	33.06±0.25	33.54±0.28	32.40±0.57	33.56±0.41	31.89±0.63
p-value	0.87	0.04	0.84	0.04	0.84	0.33	0.42	0.01

Lidocaine Treatment Lowered the Dosages of GC and NSAID for Patients

To check whether intravenous lidocaine treatment could reduce GC and NSAIDs dosages required for rapid pain relief and reducing inflammation in patients, we summarized the dosages of GC and NSAID employed for patients in the two groups during the treatment period. As shown in Table 13, patients in LG exhibited significantly lower dosages of GC and NSAID during the treatment period in comparison with control patients in CG (p<0.001). Patients without intravenous lidocaine had 2.4-fold higher GC and 15-fold higher NSAID dosages compared to lidocaine-treated patients in LG (Table 13).

Table 13.

GC and NSAIDs Dosage Between the Two Groups (n=20, X±s)

Group	GC	NSAIDs
CG	209.1±33.2	75.2±17.1
LG	86.2±52.1	5.0±2.1
p-value	<0.001	<0.001

Discussion

In this study, we utilized a preclinical rat model and a clinical trial to investigate the effects of intravenous lidocaine on RA. Our data demonstrated that lidocaine had the capability to inhibit synovial lymphocyte infiltration and inflammatory cytokine production, and attenuated joint swelling and pain in AIA rats. Lidocaine treatment also lowered painful joint area temperature in patients and reduced the dosages of GC and NSAID for the patients. The results indicate that lidocaine could provide adjunctive beneficial effects for the treatment of RA patients.

RA is characterized by chronic synovitis, joint swelling and pain caused by lymphocyte infiltration and pro-inflammatory cytokine production.^30,31 Macrophages are a crucial component of synovial cell infiltrates and correlated with the severity of RA.³² Infiltrated macrophages are mostly M1 macrophages³³ that express CD197 (also known as CCR7)²⁵ and produce high levels of pro-inflammatory cytokines such as IL-1β and TNF-α.³⁴ The two cytokines synergistically promote the breakdown of cartilage and bone.³² Indeed, we found that there were dominant CD197-positive infiltrates and upregulated expressions of IL-1β and TNF-α genes in the synovial tissues of AIA rats, contributing to the pathogenesis of synovial inflammation and joint pain.²⁵ Moreover, intravenous lidocaine significantly reduced synovial pathology score and AI score and alleviated joint swelling and pain in the preclinical AIA rat model, which could be resulted from the inhibition of CD197-positive cell infiltration and the downregulation of the expression of pro-inflammatory cytokines IL-1β and TNF-α and signaling molecules MYD88, IKKα and NF-κB p65 in synovial tissues by lidocaine treatment, as shown in this study. The therapeutic effect of intravenous lidocaine in the preclinical rat model suggests that lidocaine could offer potential for clinical treatment of RA patients.

Lidocaine has been used for numbing and pain relief,³⁵ due to its ability to block sodium channels to prevent nerve signal transmission and stabilize irregular heartbeats.³⁶ In a clinical setting, lidocaine is used as a local anesthetic before performing an intra-articular steroid injection to distinguish between peripheral joint pain and central nervous system pain.³⁷ Beyond its primary numbing effect, lidocaine also exhibits anti-inflammatory property.^38,39 In our clinical trial, we did not observe any difference in VAS, DAS28 and SDAI scores between RA patients treated with lidocaine and without the treatment, in contrast to the outcome in the preclinical AIA rat model, which could be due to the complexity of human biology, the divergence of human immune system and the long-term nature of human RA disease different from AIA rat model.^40,41 However, we observed that lidocaine-treated RA patients had significantly lower temperature in the painful joint area compared to patients lacking the treatment. RA patients normally have a raised temperature in a painful joint area, a typical sign of inflammation,⁴² showing that patient’s immune system is responding to joint injury. Our clinical trial results suggest that intravenous lidocaine could exhibit anti-inflammatory effect on joint injury in RA, consistent with the results from the preclinical rat model in this study, and with clinical observations in other disease settings.^43–45 Moreover, RA patients who received lidocaine treatment showed significantly lower usage of GC and NSAID, which also indicates that lidocaine could provide adjunctive beneficial effects for the treatment of RA patients.

Limitation

In this study, only a short-term 5-day effect of lidocaine infusion were evaluated in RA patients, while the long-term data was lacking. Additionally, a higher number of patients and a blink group of patients will be needed for further investigation.

Conclusion

Lidocaine, an amide-type drug with analgesic and anti-inflammatory properties, can inhibit NF-κB activation and inflammatory cytokine release in synovium and attenuate adjuvant-induced joint swelling and pain in rats. Intravenous lidocaine could offer adjunctive beneficial effects for the treatment of RA patients.

Data Sharing Statement

We intend to share individual deidentified participant data, including participants’ demographic information, disease condition and treatment parameters. Data can be obtained by contacting the corresponding author.

Disclosure

The authors declare there are no conflicts of interest in this study.