Activation of PPARγ and CPT1A Mediates the Hepatoprotective Effect of Ginsenoside CK against NAFLD in Rats

Abstract

Background

Nonalcoholic fatty liver disease (NAFLD) is a significant underlying driver of hepatocellular carcinoma; however, current clinical treatment options remain limited. Ginsenoside CK (CK), a natural bioactive compound, has shown promise in modulating lipid metabolism and protecting liver function. Nevertheless, its therapeutic potential against the pathogenesis of NAFLD and the associated molecular pathways is not fully understood. This study employed an integrated strategy that combines transcriptomic analysis with both in vivo and in vitro validation, utilizing a high-fat diet (HFD)-induced rat model to elucidate the efficacy and molecular mechanisms of CK in ameliorating NAFLD.

Methods

An NAFLD rat model was established through HFD feeding to assess the effects of CK on various physiological and biochemical parameters, thereby clarifying its role in regulating lipid metabolism and providing hepatoprotection in vivo. Additionally, a free fatty acid (FFA)-induced Huh7 cell model was constructed to evaluate the in vitro activity of CK in promoting lipid metabolism and inhibiting lipid accumulation. Subsequently, transcriptomic analysis was conducted to identify potential targets and elucidate the mechanisms underlying the effects of CK. Finally, the proposed mechanism was verified through in vivo experiments.

Results

In vivo results indicated that CK treatment significantly mitigated the increases in body weight and organ indices induced by a HFD. Additionally, CK improved biochemical parameters in both liver and serum, alleviated liver injury, steatosis, and insulin resistance, thereby providing a protective effect on liver tissue. Furthermore, CK markedly reduced the deposition of intracellular lipid droplets in hepatocytes. It also enhanced the expression of fatty acid metabolism-related genes, CPT1 and CPT2, in the liver, while downregulating the expression of lipogenic genes, including ACC1, FAS, and SREBP1c. Mechanistic investigations revealed that CK modulates the PPARγ/CPT1A signaling axis, suppresses the expression of hepatic lipogenic genes, reduces lipid accumulation, and consequently improves insulin resistance and liver injury.

Conclusion

Our study demonstrates that CK attenuates NAFLD progression by regulating the PPARγ/CPT1A signaling axis.

Introduction

Non-alcoholic fatty liver disease (NAFLD) is the most prevalent liver disorder globally, characterized by hepatic steatosis or the accumulation of triglycerides in the liver without alcohol consumption [1]. The prevalence of NAFLD is high in Western countries, reaching up to 30%, and approximately 20% in China, with a rising trend over time [2]. NAFLD is closely linked to obesity, dyslipidemia, hyperglycemia, hypertension, and metabolic syndrome. Current treatment approaches for NAFLD encompass lifestyle modifications, pharmacological interventions, and management of associated conditions [3]. However, the complex pathophysiology of NAFLD poses challenges in developing effective treatments, necessitating the exploration of novel and safe therapeutic options for the prevention and management of NAFLD.

In recent years, the understanding of NAFLD pathogenesis has shifted from the traditional “two-hit” model to the more complex “multiple-hit” hypothesis [4]. Despite significant progress in unraveling the mechanisms driving NAFLD progression, there remains a notable absence of pharmacological interventions capable of halting disease advancement effectively [5]. Recent research has highlighted the potential of natural products like curcumin, resveratrol, and catechins in ameliorating NAFLD through their antioxidant, anti-inflammatory, and metabolic regulatory properties [6]. Exploring therapeutic agents from traditional Chinese medicine holds promise in addressing the treatment gaps and improving outcomes for NAFLD patients.

Ginsenoside CK, a rare compound derived from ginseng, has demonstrated promising hepatoprotective properties [7]. Studies have shown that CK can mitigate oxidative stress by enhancing the hepatic antioxidant defense system and inhibiting lipid peroxidation, thereby offering protection against drug-induced liver injury [8]. Furthermore, CK has been found to alleviate hepatic steatosis induced by diabetes and obesity in animal models by modulating the expression of genes involved in lipid metabolism, promoting fatty acid oxidation through AMPK activation [9]. While existing research highlights the hepatoprotective effects of CK, its specific role in NAFLD and the underlying mechanisms remain less explored. Therefore, current investigations aim to elucidate the impact of ginsenoside CK on NAFLD improvement and delve into its mechanism of action, with the ultimate goal of developing an effective therapeutic agent for NAFLD management.

Materials and Methods

Animals and Experimental Design

All experimental procedures involving animals were conducted in accordance with the Guide for the Care and Use of Laboratory Animals and were approved by the Ethics Committee of Kunming Medical University (Approval Number: Kmmu20241849). Male Sprague-Dawley (SD) rats were housed under standard conditions with a 12-hour light/dark cycle. After a one-week acclimatization period, rats were randomly assigned to experimental groups using a random number table.

Dietary Regimen and Modeling: The control group (n = 6) was fed a standard chow diet (SPF-F02-003). To establish a high-fat diet (HFD) model, the remaining rats were fed a 60 kcal% high-fat diet (D12492; composition: standard chow supplemented with 10% lard, 10% sucrose, 1% cholesterol, and 0.5% sodium cholate) for 6 weeks [10]. Intervention Protocol: Starting from week 7, interventions were administered via daily oral gavage for 6 weeks. The experimental groups were as follows: Control Group: Received normal saline (10 mL/kg/d).

HFD Model Group: Received normal saline (10 mL/kg/d). CK Treatment Group: Received CK (Solebo, China) at 10 mg/kg/d. Positive Control Group: Received atorvastatin (Solebo, China) at 10 mg/kg/d [11]. Body weight and food intake were recorded weekly. The total duration of the study, including modeling and intervention, was 12 weeks. At the endpoint, rats were fasted overnight, anesthetized, and euthanized. Blood samples were collected, and livers were excised, weighed, and processed for subsequent analysis.

Blinding and Sample Size Calculation: The study employed a single-blind design. Personnel performing tissue sampling and biochemical assays (liver triglyceride content) were blinded to group assignments. Similarly, technicians responsible for data acquisition and analysis were unaware of the group allocation. The sample size was determined a priori using liver triglyceride (TG) content as the primary endpoint. Based on pilot data and previous literature, we assumed an expected intergroup difference of 25% and a standard deviation of 15%. Using a two-sample t-test with a significance level (α) of 0.05 (two-sided) and a power (1-β) of 0.80, the minimum required sample size was calculated to be n = 6 per group.

Cell Culture

Huh7 cells were cultured in DMEM/RPMI-1640 (Gibco, USA) medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin. The cells were maintained in a 5% carbon dioxide humidified incubator at 37 °C. To establish an in vitro fatty liver cell model, the cells were treated with a 1 mmol/L free fatty acid (FFA) mixture (PA: OA = 1:2) for 48 h. After successful modeling, each group was treated with the corresponding drugs. The experimental groups were as follows: Control Group; Fatty Liver Cell Model Group; Atorvastatin Group (10 µmol/ml); CK Intervention Group (10 µmol/ml); CK Intervention Group + PPAR Inhibitor Group (10 µmol/ml); CK Intervention Group + CPT1A Knockdown Group.

RNA-Seq Analysis

A total of 9 cell samples were subjected to transcriptome sequencing (DynaTech Biotechnology Co., Ltd.), and the sequencing results were analyzed by bioinformatics. The Edge R package (FoldChange ≥ 1.5, p-value < 0.05) was used to screen differentially expressed genes. Gene ontology (GO) functional annotation analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) signaling pathway enrichment analysis were performed using Hs.eg.dbGO and richKEGG, respectively.

Determination of Serum Biochemical Parameters

Blood samples were collected from the abdominal aorta of mice in each experimental group. The blood samples were left at room temperature for 1 h before being centrifuged at 4 °C, 1000×g for 20 min. The resulting supernatant was collected for further testing. Serum cholesterol TC, triglyceride TG, high-density lipoprotein HDL-C, low-density lipoprotein LDL-C, free fatty acid NEFA, serum enzymes ALT, AST, and lactate deaminase LDH were measured by using the relevant test kits to assess the liver damage (Beyotime, china).

H&E Staining

Liver and adipose tissues were collected from each group of mice, and frozen sections were prepared for further analysis. The frozen tissue sections were allowed to warm to room temperature and then washed with drops of distilled water. Subsequently, the tissue sections were washed with 60% isopropyl alcohol for 2 min. Oil red working solution was then added to the sections for staining, which typically lasted for about 2 to 5 min. After staining, the sections were rinsed with 60% isopropyl alcohol to remove excess dye. To visualize the cellular structures and lipid content, hematoxylin was used to restain the sections for 1 min. The stained tissue sections were then examined under a microscope, and photographs were taken to document and analyze the results of the staining process.

Oil Red O Staining

Liver tissues and Huh7 cells were fixed with 4% paraformaldehyde to fix the cells and stained with Oil Red O (Beyotime, china). The stained tissue or cell sections were placed under a microscope for observation, and the oil red O staining was quantified using Image J software.

ROS Assay

Huh7 cells were inoculated in 6-well plates at a density of 1 × 10⁵ cells/ml. Collect the cells in each group, discard the old medium and add pre-cooled PBS to gently wash the cells twice. Discard the PBS, add the DMEM-diluted DCFH-DA probe(Beyotime, china), and incubate at 37 °C for 20 min. After incubation, discard the probe, gently wash the cells twice with pre-cooled PBS, and observe and record the images under a forward-inverted fluorescence microscope. The average fluorescence intensity of ROS was counted by Image J software.

Plasmid and SiRNA Transfection

For plasmid and siRNA transfection (China, Qingke), 1 × 10^6 Huh7 cells were seeded into 6-well plates. After 24 h, 5 µl of negative control (NC) or CPT1A siRNA and 5 µl of Lipofectamine™ 3000 were mixed in 100 µl of Opti-MEM without fetal bovine serum (FBS). The 100 µl mixture was then evenly added to the Huh7 cells in the 6-well plates. After 24 h of transfection, the medium was replaced with fresh culture medium for subsequent experiments (Invitrogen, USA).

Immunofluorescence Staining

Liver sections and hepatocytes were rinsed with PBS, permeabilized with Triton X-100, and incubated with primary antibody at 37℃ for 1 h. Then the sections were washed with PBS and incubated with the corresponding secondary antibody for 1 h. After washed with PBS, fluorescent secondary antibody was added with a dilution of 1:50, and fluorescence staining was carried out on the tissues by incubating the samples at 37℃ for 1 h. The slices were washed clean with PBS, dried, and blocked with glycerol. The slices were scanned under a laser confocal microscope (Leica TCS-SP5), and the light source was used to excite the green and red fluorescence with 488 nm and 561 nm wavelength lasers, respectively, and the data were acquired by computer for digital imaging.

RT-qPCR

Total RNA was extracted from liver tissues and cells using the RNA extraction and isolation kit (Invitrogen, USA), and mRNA first strand cDNA was synthesized using the same kit (Tiangen, Beijing, China). qPCR kit was used to amplify double-stranded DNA, and GAPDH was used as a control for ΔΔ CT analysis. All primers were synthesized by Qingdao Biotechnology Company (Table 1). The expression levels of SREBP1c, FAS, ACC1, CPT1 and CPT2 genes in tissues and cells were examined by RT-qPCR.

Table 1.

Primer sequences

Primer	Forward(5’−3’)	Reverse(5’−3’)
CPT1A	CCTACCACGGCTGGATGTTT	TACAACATGGGCTTCCGACC
CPT2	AAGAAGCAGCGATGGGTAAGG	GTGGAGAAACTCTCGGGCAT
SREBP1c	CAGGAAACTGAGCCATGCAG	TCCATTGCTGGTACCGTGAG
FAS	GCAGCAGCATGATGTAGCAC	AGTTGCACACCACAAGGTCA
ACC1	GAAAAGCGATTCCCATCCGC	CATTCCATGCAGTGGTCCCT
GAPDH	CAGCCTCAAGATCATCAGCA	ATGATGTTCTGGAGAGCCCC

Western Blot

Protein extraction kit to extract total cell protein, BCA kit to determine the protein concentration, 50 µg/well on the sample, 10% SDS-PAGE gel separation for 1 h and then transferred to the PVDF membrane, closed with PBS buffer containing 5% skimmed milk powder for 1 h, respectively, add the target SREBP1c, FAS, ACC1, CPT1 primary antibody and the internal reference GAPDH antibody (Abcam, USA), overnight at 4 ℃. PBST buffer was rinsed 3 times, 5 min each time, the secondary antibody was added, and incubated at 37 °C for 2 h. PBST buffer was rinsed 3 times, ECL was developed, and the target proteins were imaged using a protein gel imaging system, and Image J analyzed the grayscale values of the target proteins.

Mitochondrial Membrane Potential Assay

The effect of CK treatment on the mitochondrial membrane potential of Huh7 cells was determined using the JC-1 fluorescent probe according to the kit (Yeasen, China) instructions. Huh7 cells were treated with the appropriate drugs for 24 h. The cell culture medium was aspirated and the cells were incubated with 10 µg/mL JC-1 for 20 min at 37 °C. The cells were incubated with 10 µg/mL JC-1 for 20 min at 37 °C. The JC-1 solution was aspirated, the cells were rinsed with PBS, and the cell fluorescence intensity was observed by fluorescence microscope imaging.

Statistical Analysis

Data in this study are expressed as mean ± standard deviation (SD), with values obtained from at least three independent experiments. Statistical analyses were performed using R software or GraphPad Prism 9.0. Comparisons between two independent groups were conducted using unpaired t-test or Wilcoxon rank-sum test (for non-normally distributed or heteroscedastic data). Comparisons among multiple groups were performed using analysis of variance (ANOVA) or Kruskal–Wallis test (for non-normally distributed or heteroscedastic data), followed by Tukey’s HSD post hoc test for multiple comparisons. A p value < 0.05 was considered statistically significant.

Results

CK Ameliorates HFD-Induced Liver Injury in Rats

To assess the therapeutic potential of CK against NAFLD, a HFD-induced rat model of NAFLD was established in this study. Subsequent treatments with either CK or AC were administered independently to the NAFLD rats. The results demonstrated that CK and AC treatments significantly reduced body weight, liver index, and fat index in NAFLD rats (Fig. 1A, C, D). Notably, these improvements in metabolic parameters were independent of changes in food intake across the experimental groups (Fig. 1B). Further pathological examinations revealed that CK and AC effectively reversed hepatic steatosis and liver injury. Macroscopically, the livers of NAFLD model rats exhibited a characteristic earth-yellow color, diffuse enlargement, and accumulation of pale-yellow lipid droplets. In contrast, CK treatment restored the normal color and texture of the liver (Fig. 1E). Histological analysis via H&E staining further confirmed that the NAFLD group displayed prominent hepatocyte ballooning degeneration (red arrows) and inflammatory infiltration (blue arrows). Importantly, treatment with CK or AC significantly mitigated these pathological lesions (Fig. 1E). Furthermore, compared with the NAFLD model group, CK and AC treatments markedly decreased the serum levels of liver injury markers, including AST, ALT, and LDH (Fig. 1F-H). Additionally, immunofluorescence staining revealed that CK and AC effectively inhibited ROS accumulation as well as the activation of the NF-κB and JNK signaling pathways (Fig. 1I-N). Collectively, these findings demonstrate that CK exerts a significant protective effect against HFD-induced liver injury in NAFLD rats.

Fig. 1.

CK ameliorates HFD-induced liver injury in rats. A Rat body weight curve, n = 4 B Mean food intake, n = 4. C Rat fat index, n = 4. D Rat liver index, n = 4. E Rat liver picture and HE stained picture of rat liver, n = 4. F-H Expression levels of biochemical indicators of liver injury in rats, n = 3. I, L Immunofluorescence and statistical graph of ROS in rat liver tissue, n = 4. J, M Immunofluorescence and statistical graph of JNK in rat liver tissue, n = 4. K, N Immunofluorescence and statistics of NF-κB in rat liver, n = 4. AC: Atorvastatin; CK: Ginsenoside CK. *: P < 0.05, **: P < 0.01

CK Ameliorates Hepatic Lipid Accumulation and Insulin Resistance Induced by HFD in Rats

Lipid accumulation and insulin resistance are pivotal in the pathogenesis of NAFLD. This study investigates the status of lipid accumulation and insulin resistance in NAFLD-induced rats. The results indicate that following treatment with CK, there were significant reductions in serum levels of TG, TC, NEFA, and LDL-C, alongside a notable increase in HDL-C) (Fig. 2A-E). Furthermore, Oil Red O staining of liver tissues revealed that CK treatment substantially mitigated lipid accumulation in the liver of NAFLD rats (Fig. 2F, G). Insulin resistance assessments also demonstrated that CK treatment effectively lowered blood glucose and insulin levels in NAFLD rats, thereby improving their insulin resistance status (Fig. 2H-J).

Fig. 2.

CK ameliorates hepatic lipid accumulation and insulin resistance induced by HFD in rats. A TG content in rat serum, n = 3. B TC content in rat serum, n = 3. C NEFA content in rat serum, n = 3. D LDL-C content in rat serum, n = 3. E HDL-C content in rat serum. F-G Oil red O staining and statistic graph of rat liver, n = 4. H Glucose levels in rats, n = 3. I Insulin level in rats, n = 3. J Insulin resistance index in rats, n = 3. AC: Atorvastatin; CK: Ginsenoside CK.*: P < 0.05, **: P < 0.01

CK Inhibits FFA-Induced Hepatocyte Injury and Lipid Accumulation

Indeed, our study demonstrated that CK treatment effectively suppressed the accumulation of NEFA, TG, and TC in Huh7 cells (Fig. 3A-C). Consistently, oil red O staining of Huh7 cells revealed that CK was successful in reducing lipid accumulation induced by FFA in hepatocytes (Fig. 3D, E). Furthermore, CK treatment significantly downregulated the expression of lipid synthesis-related factors, including ACC1, FAS, and SREBP1c, while increasing the expression of lipid metabolism-related factors CPT1 and CPT2 in Huh7 cells (Fig. 3F-K). Additionally, CK treatment reversed the decrease in mitochondrial membrane potential (Fig. 3N, O) and attenuated the accumulation of ROS (Fig. 3L, M), thereby ameliorating hepatocellular injury in the model group of Huh7 cells. These findings collectively indicate that CK effectively mitigated FFA-induced hepatocyte injury and lipid accumulation.

Fig. 3.

CK inhibits FFA-induced hepatocyte injury and lipid accumulation. A Content of TG per 106 cells, n = 3. B Content of TG per 10⁶ cells, n = 3. C Content of TG per 10⁶ cells, n = 3. D-E Oil red O staining of Huh7 cells and statistical graph, n = 3. F Expression of CPT1 gene in Huh7 cells, n = 3. G Expression of CPT2 gene in Huh7 cells, n = 3. H Expression of FAS gene in Huh7 cells, n = 3. I Expression of SREBP1c gene in Huh7 cells, n = 3. J, K Protein expression levels of genes related to lipid synthesis and metabolism in Huh7 cells and statistical graph, n = 3. L, M Immunofluorescence and statistical graph of mitochondrial membrane potential in Huh7 cells, n = 4. N, O Immunofluorescence and statistical graph of ROS in Huh7 cells, n = 4. *: P < 0.05, **: P < 0.01

PPARγ and CPT1A are Potential Targets of CK Action

To elucidate the potential mechanism by which CK ameliorates NAFLD, transcriptome analysis was conducted in this study. The results indicated that, compared to the control group, the model group exhibited 1,350 up-regulated genes and 435 down-regulated genes (Fig. 4A). The CK-treated group, in contrast, showed 1,267 up-regulated genes and 291 down-regulated genes (Fig. 4B). Notably, when compared to the model group, the CK-treated group displayed 29 significantly up-regulated genes and 90 significantly down-regulated genes (Fig. 4C). Venn analysis of the differentially expressed genes among the three groups revealed 23 genes, including CPT1A and TAGLN, that exhibited significant changes (Fig. 4D). Gene Ontology (GO) analysis of these 23 differentially expressed genes indicated their involvement in key pathways such as fatty acid biosynthesis, glucose metabolism, and long-chain fatty acid transport (Fig. 4E). Furthermore, KEGG pathway enrichment analysis demonstrated that the PPAR signaling pathway was significantly enriched in both the DZ vs. MX and MX vs. MXGYCK groups, suggesting a crucial role for the PPAR signaling pathway in CK-mediated improvement of NAFLD (Fig. 4F, G). Importantly, among these 23 differentially expressed genes, CPT1A was identified as a downstream target of the PPAR signaling pathway and was highly enriched within this pathway, underscoring the potential significance of CPT1A and PPAR as key targets for CK treatment of NAFLD.

Fig. 4.

PPARγ and CPT1A are potential targets of CK action. A-C Volcano diagrams. D Wayne diagram. E BP, CC, MF enrichment map. F-G KEGG pathway enrichment plot. H, I Target gene protein expression levels and statistical plots, n = 3. J-N Target gene mRNA expression levels, n = 3. DZ: control group; MX: model group; CXGYMX: model + CK group. ns: no statistically significant difference; *: P < 0.05, **: P < 0.01

The in vitro validation results further corroborated the findings of the transcriptome analysis. Compared to the control group, the gene and protein expression levels of PPARγ and CPT1A were significantly decreased in the model group but were significantly increased following CK treatment (Fig. 4H-N). These results highlight the importance of PPARγ and CPT1A as key targets for the therapeutic effects of CK against NAFLD.

Regulation of PPARγ and CPT1A Expression Interferes with Hepatocyte Injury and Lipid Accumulation

Based on the above study, we further inhibited the expression of CPT1A and PPARγ in Huh7 cells to elucidate the specific roles of these targets in CK treatment of NAFLD. The results show that CK treatment significantly reduced the expression levels of TG, TC and NEFA in hepatocytes induced by free fatty acids. However, inhibition of CPT1A and PPARγ reversed the therapeutic effect of CK on these lipid metabolic parameters (Fig. 5A-C). Notably, overexpression of CPT1A significantly reduced the levels of TG, TC, and NEFA in the PPARγ inhibition group (Fig. 5A-C). Furthermore, after the inhibition of CPT1A and PPARγ, the protein and gene expression levels of key lipid synthesis-related factors, including ACC1, FAS, and SREBP1c, were significantly upregulated, while the expression levels of lipid metabolism-related factors CPT1 and CPT2 were downregulated. Similarly, overexpression of CPT1A reversed the upregulation of lipid synthesis-related factors following PPARγ inhibition (Fig. 5F, G). Oil Red O staining further corroborated these findings, demonstrating a significant increase in lipid accumulation in hepatocytes following the inhibition of CPT1A and PPARγ. Conversely, the overexpression of CPT1A resulted in a reduction of lipid accumulation (Fig. 5D, E).

Fig. 5.

Regulation of PPARγ and CPT1A expression interferes with hepatocyte injury and lipid accumulation. A Content of TG per 10⁶ cells, n = 3. B Content of TG per 10⁶ cells, n = 3. C Content of TG per 10⁶ cell, n = 3. D, E Cell oil red O staining and statistical graph, n = 3. F, G Protein expression levels and statistical graphs of lipid synthesis and metabolism related genes, n = 3. H, I Immunofluorescence and statistical graph of ROS in Huh7 cells, n = 4. J, K Immunofluorescence and statistical graph of mitochondrial membrane potential of Huh7 cells, n = 4. KD: knockdown; OV: overexpression. *: P < 0.05, **: P < 0.01

Immunofluorescence analysis showed that the protective effect of CK on hepatocytes was significantly weakened after CPT1A and PPARγ inhibition. Moreover, inhibition of CPT1A and PPARγ led to a significant decrease in mitochondrial membrane potential and a notable increase in ROS levels, which were reversed by CPT1A overexpression (Fig. 5H-K). In summary, these results suggest that CK regulates the development of NAFLD by targeting CPT1A and PPARγ, thereby influencing lipid metabolism and cellular stress responses.

CK Ameliorates Liver Injury in NAFLD Rats by Activating PPARγ and CPT1A

Our study investigated the effects of inhibiting CPT1A and PPARγ expression in rats with NAFLD treated with CK. The results indicated that the inhibition of CPT1A and PPARγ resulted in a significant increase in body weight, liver index, and hepatic index in NAFLD rats (Fig. 6A-C). Furthermore, the suppression of CPT1A and PPARγ expression diminished the hepatoprotective effects of CK, as evidenced by an increase in liver tissue volume and the visibility of lipid particles (Fig. 6D). H&E staining confirmed that the inhibition of CPT1A and PPARγ reversed the improvements in hepatocyte ballooning degeneration (indicated by red arrows) and inflammatory infiltration (indicated by blue arrows) achieved through CK treatment (Fig. 6D). Notably, the serum levels of liver function injury markers, including AST, ALT, and LDH, decreased following CK treatment but increased again upon the inhibition of CPT1A and PPARγ (Fig. 6E-G). Additionally, the inhibitory effects of CK on the JNK and NF-κB liver injury pathways were significantly reversed following the suppression of CPT1A and PPARγ expression (Fig. 6H-K).

Fig. 6.

CK ameliorates liver injury in NAFLD rats by activating PPARγ and CPT1A. A Weight of ratl, n = 6. B Rat liver index, n = 6. C Rat fat index, n = 6. D Rat liver picture and H&E stained picture of rat liver, n = 6. E ALT content in rat serum, n = 3. F AST content in rat serum, n = 3. G LDH content in rat serum, n = 3. H, I Immunofluorescence and statistical graph of JNK in rat liver tissue, n = 4. J, K Immunofluorescence and statistical graph of NF-κB in rat liver tissue, n = 4. *: P < 0.05, **: P < 0.01

CK Ameliorates Lipid Accumulation and Insulin Resistance in NAFLD Rats through Activation of PPARγ and CPT1A.

Similarly, following the inhibition of CPT1A and PPARγ expression, the serum levels of TG, TC, NEFA and LDL-C were significantly increased, while the level of HDL-C was notably decreased in CK-treated NAFLD rats (Fig. 7A-E). Concurrently, there was a significant increase in lipid accumulation in the livers of NAFLD rats (Fig. 7F-G). Furthermore, while CK treatment suppressed the protein expression of lipid synthesis-related factors ACC1, FAS, and SREBP1c, the protein expression levels of these factors were significantly elevated in the liver after inhibiting the expression of CPT1A and PPARγ (Fig. 7H-L). These findings suggest that CK treatment mitigates lipid accumulation in NAFLD rats through the activation of PPARγ and CPT1A. Moreover, the beneficial effect of CK on insulin resistance in NAFLD rats was notably diminished by the inhibition of CPT1A and PPARγ expression. Inhibition of CPT1A and PPARγ led to a significant increase in insulin and glucose levels in NAFLD rats (Fig. 7J-L).

Fig. 7.

CK ameliorates lipid accumulation and insulin resistance in NAFLD rats through activation of PPARγ and CPT1A. A TG content in rat serum, n = 3. B TC content in rat serum, n = 3. C NEFA content in rat serum, n = 3. D LDL-C content in rat serum, n = 3. E HDL-C content in rat serum, n = 3. F, G Oil red O staining and statistic graph of rat liver, n = 4. H, I Protein expression levels of genes related to lipid synthesis and metabolism and statistical graphs, n = 3. J Insulin level in rats, n = 6. K Glucose levels in rats, n = 3. L Insulin resistance index in rats, n = 3. *: P < 0.05, **: P < 0.01

Discussion

NAFLD is closely associated with global liver disease mortality [12]. Given its continuously rising prevalence worldwide, identifying effective therapeutic strategies for NAFLD is of paramount importance for alleviating the global burden of liver diseases [2]. This study preliminarily investigates the effects of ginsenoside CK on the development and progression of NAFLD. Our results demonstrate that treatment with CK effectively alleviates HFD-induced NAFLD in rats. Importantly, CK exhibits efficacy comparable to that of the positive control drug, atorvastatin, in improving parameters of liver injury, reducing lipid droplet accumulation, ameliorating insulin resistance, mitigating oxidative stress, and attenuating hepatic damage. Further mechanistic analysis reveals that CK alleviates NAFLD progression, at least in part, through the activation of the PPARγ and CPT1A pathways. Therefore, ginsenoside CK may represent a potential therapeutic agent for the future management of NAFLD.

Abnormal lipid metabolism and intrahepatic lipid accumulation play a pivotal role in the pathogenesis of NAFLD [13]. Fatty acids are primarily metabolized via the β-oxidation pathway in the liver. Impaired liver function can lead to excessive lipid deposition within the liver, which in turn further suppresses lipid metabolism [14]. Consistently, suppression of hepatic lipid accumulation represents a pivotal therapeutic strategy for the alleviation of NAFLD. Atorvastatin, a first-line lipid-lowering drug extensively applied in clinical practice, markedly reduces circulating concentrations of TC, LDL-C, and TG, while increasing HDL-C. Beyond its lipid-regulating effects, atorvastatin also exerts potent antioxidant, anti-apoptotic, and anti-inflammatory activities [15]. Accordingly, mounting evidence from preclinical animal models and limited clinical trials has validated the protective efficacy of atorvastatin against NAFLD [16]. In the present study, atorvastatin was utilized as a positive control to systematically explore the potential effects of CK on the progression of HFD-induced NAFLD. We evaluated multiple pathophysiological disorders closely associated with NAFLD pathogenesis, including body weight gain, hepatic steatosis, insulin resistance, serum lipid profiles, inflammatory responses, and hepatic antioxidant capacity—all of which constitute core hallmarks of NAFLD development [17]. Our in vivo data demonstrated that CK administration significantly decreased body weight, liver index, and fat index in NAFLD rats, reduced hepatic lipid droplet deposition, and attenuated HFD-triggered hepatic steatosis, inflammatory damage, and oxidative stress. Meanwhile, CK treatment effectively restored insulin sensitivity in NAFLD rats. In agreement with the in vivo observations, in vitro experiments using FFA-stimulated Huh7 cells further confirmed that CK treatment notably reduced intracellular lipid accumulation and decreased intracellular levels of TG, TC, and NEFAs. Mechanistically, gene expression analysis revealed that CK treatment downregulated the transcriptional levels of key lipogenic genes, ACC1, AS, and SREBP1c, while upregulating the expression of lipid oxidation-related genes, such asCPT1 and CPT2. Collectively, these findings demonstrate that CK effectively mitigates hepatic lipid accumulation and improves pathological liver injury in HFD-induced NAFLD rats, highlighting its potential as a promising candidate for NAFLD intervention.

To elucidate the potential molecular mechanisms underlying the beneficial effects of CK on NAFLD, transcriptomic profiling was employed to identify key therapeutic targets. Our results identified PPARγ and CPT1A as critical mediators of CK’s action. Consistent across both in vivo and in vitro models, NAFLD induction was associated with a significant downregulation of PPARγ and CPT1A expression. Notably, CK treatment robustly restored the expression levels of these key factors, thereby effectively attenuating the progression of NAFLD. PPARγ, a ligand-activated transcription factor belonging to the nuclear hormone receptor superfamily [18], is widely recognized as a master regulator of hepatic adipogenesis, lipogenesis, and lipid metabolism [19]. Within the hepatic milieu, PPARγ facilitates the cellular uptake of FFAs through upregulation of fatty acid-binding protein 4 (FABP4) and concomitantly induces the expression of fatty acid synthase (FAS), collectively driving excessive intracellular triglyceride accumulation [20]. Activation of the PPARγ/LXRα/ABCA1 signaling pathway has been demonstrated to reduce triglyceride and free fatty acid accumulation in liver tissue, thereby ameliorating hepatic lipid deposition. Furthermore, PPARγ modulates mitochondrial function by influencing the activity of peroxisome proliferator-activated receptor gamma coactivator-1α (PGC-1α) [21, 22], which subsequently triggers mitochondrial fatty acid and heme biosynthetic pathways, enhances mitochondrial oxidative capacity, and reduces hepatic lipid accumulation. CPT1A, a pivotal isoform of the CPT1 enzyme family, plays an essential role in regulating triglyceride metabolism in vivo [23]. Studies indicate that upregulation of CPT1A expression suppresses JNK activation, mitigating insulin resistance and inflammatory responses induced by elevated FFA levels while maintaining normal adipocyte function [24]. Moreover, increased CPT1A expression has been shown to significantly reduce hepatic triglyceride content and improve metabolic disorders in hepatocytes. Collectively, these findings underscore PPARγ and CPT1A as critical targets for modulating lipid metabolism and alleviating NAFLD.

Of note, accumulating evidence has indicated that CPT1A is transcriptionally regulated by PPARγ, thereby coordinately modulating systemic lipid homeostasis. For example, Zhu X et al. reported that both PPARγ and its downstream target CPT1A were markedly downregulated in a cellular model of hepatic lipid metabolic dysfunction induced by bisphenol A exposure [25]. Moreover, activation of the PPARγ/CPT1A axis has been demonstrated to protect against cochlear hair cell injury by improving lipid metabolism and suppressing oxidative stress [26]. Additionally, previous studies revealed that the PPARγ/CPT1A axis modulates fatty acid oxidation in gastric cancer cells, thereby promoting lymphatic metastasis [27]. In line with these observations, the present study further verified that PPARγ contributes to NAFLD pathogenesis by transcriptionally regulating CPT1A expression. Mechanistically, in FFA-stimulated hepatocytes, pharmacological inhibition of PPARγ and CPT1A abolished the CK-mediated alleviation of lipid accumulation and oxidative damage. Importantly, enforced overexpression of CPT1A under PPARγ inhibition restored the protective effects of CK against hepatic steatosis and oxidative injury. Collectively, these results demonstrate that activation of the PPARγ/CPT1A signaling axis represents a pivotal molecular mechanism underlying the therapeutic effects of CK in attenuating HFD-induced NAFLD progression.

In conclusion, the present study, using both in vitro and in vivo models, demonstrates that CK effectively impedes the initiation and progression of NAFLD by activating the expression of PPARγ and CPT1A. Nevertheless, as a natural bioactive component, CK may modulate NAFLD pathogenesis through additional molecular mechanisms or signaling pathways independent of direct stimulation of the PPARγ/CPT1A axis. For instance, previous studies have documented that CK exerts anti-adipogenic effects in 3T3‑L1 preadipocytes by activating AMPK signaling while suppressing the ERK/p38 and AKT pathways [28]. CK has also been shown to alleviate hepatic lipid deposition in vitro and in vivo via the LKB1/AMPK signaling cascade [29]. Given that inhibition of adipogenesis and intracellular lipid accumulation constitutes a core therapeutic strategy for NAFLD, these pathways may collectively contribute to the hepatoprotective effects of CK. Furthermore, CK administration has been reported to enrich the abundance of the beneficial gut commensal Akkermansia, elevate the Bacteroidetes/Firmicutes ratio, and consequently attenuate hepatic injury in NAFLD mice [30]. Collectively, these findings support that CK ameliorates NAFLD through a multi‑modal regulatory network, encompassing both direct metabolic regulation and indirect signaling modulation.

Notably, using atorvastatin as a positive control, our preliminary data suggest that the mechanism underlying the protective effects of CK against NAFLD may partially overlap with that of atorvastatin. Although atorvastatin is classically characterized as a canonical PPARα agonist, mounting evidence has uncovered its potential crosstalk with the PPARγ/CPT1A signaling pathway [31]. Mechanistically, atorvastatin may influence the PPARγ/CPT1A axis through direct or indirect routes. On one hand, studies indicate that atorvastatin can directly activate PPARγ to exert lipid‑lowering effects and alter the intracellular lipid milieu [32, 33]. Given that ligands for PPARγ are typically fatty acids and their derivatives, changes in blood lipid levels could affect the concentration of these ligands, thereby modulating PPARγ activity [19]. On the other hand, atorvastatin may indirectly regulate the expression and activity of PPARγ and CPT1A by influencing intracellular signaling cascades, such as the AMPK pathway [34]. Upon activation, AMPK inhibits the expression of lipogenic genes while promoting the expression of fatty acid oxidation‑related genes, including CPT1A [35]. Thus, atorvastatin might also affect the PPARγ/CPT1A axis indirectly via AMPK activation.

Although the present study preliminarily elucidates that CK impedes the progression of NAFLD via activating the PPARγ/CPT1A signaling pathway, several limitations warrant consideration. First, owing to the relatively short intervention period, the long-term safety profile of ginsenoside CK was not fully evaluated, and a systematic dose‑response relationship was not established in the current investigation. Second, given the pleiotropic biological activities of CK, other potential direct or indirect metabolic regulatory pathways involved in its hepatoprotective effects remain to be further explored and verified. To overcome these limitations, future research directions are proposed as follows. We will prolong the intervention and observation period to systematically assess the long‑term safety of ginsenoside CK and monitor potential delayed adverse reactions. Simultaneously, a comprehensive dose‑response study will be performed to determine the optimal therapeutic window, effective dosage range, and maximum tolerated dose in vivo. Furthermore, additional critical metabolic pathways, including the AMPK and AKT signaling axes, will be investigated to further clarify their potential contributions to the protective mechanism of CK against NAFLD.

Conclusion

Collectively, our results indicate that the activation of the PPARγ/CPT1A pathway is central to the protective effects of ginsenoside CK against NAFLD pathology. Given its efficacy, CK represents a compound with considerable translational promise. Further in-depth studies on its mechanisms will pave the way for developing novel strategies to reduce the growing health burden of NAFLD.

Author contributions statement.

DF L, W Y and JY W writing-review & editing, B W and H X writing-original draft, methodology; GS S, KL L, SW L, ZY D and RZ Z data curation. All authors drafted and revised the manuscript. The final manuscript was read and approved by all authors.

Founding

This manuscript is supported by National Natural Science Foundation of China (82560125); The Yunnan Province’s Science and Technology Talent and Platform Program (Academician and Expert Workstations) (202505AF350081); Yunnan revitalization talent support program (XDYC-YLWS-2024-0071); Major Science and Technology Project Plan of Yunnan Science and Technology Department (202402AA310006); Key Laboratory of Yunnan Provincial Innovative Application of Traditional Chinese Medicine (202305AV340006); Cell Therapy Engineering Research Center for Cardiovascular Diseases in Yunnan Province; The Yunnan Provincial Department of Science and Technology Basic Research Special Project - Youth Project (202501AU070015); The First People’s Hospital of Yunnan Province Doctoral Research Fund(KHBS-2024-010); Yunnan Provincial First People’s Hospital High-level Talents Subsidy Program (2024-KHRCBZ-B12).

Tables.

Abbreviations

CK

Ginsenoside CK

NAFLD

Non-alcoholic Fatty Liver Disease

HFD

High-fat Diet

SREBP1c

Sterol Regulatory Element-Binding Protein 1c

FAS

Fatty Acid Synthase

ACC1

Acetyl-CoA Carboxylase 1

CPT

Carnitine palmitoyltransferase

SD

Sprague-Dawley

GO

Gene Ontology

KEGG

Kyoto Encyclopedia of Genes and Genomes

H&E

Hematoxylin and Eosin

TG

Triglycerides

TC

Total Cholesterol

FFA

Free Fatty Acids

LDL-C

Low-density Lipoprotein Cholesterol

ALT

Alanine Aminotransferase

AST

Aspartate Aminotransferase

LDH

Lactate Dehydrogenase

HOMA-IR

Homeostasis Model Assessment of Insulin Resistance

HDL-C

High-density Lipoprotein Cholesterol

NEFA

Non-esterified Fatty Acids

ROS

Reactive oxygen species

PPARγ

Peroxisome Proliferator-activated Receptor Gamma

PPARα

Peroxisome Proliferator-activated Receptor Alpha

PPARβ

Peroxisome Proliferator-activated Receptor Beta

JNK

C-Jun N-terminal Kinase

CPT1A

Carnitine Palmitoyltransferase 1 A

Authors' Contributions

B W, W Y and JY W writing-review & editing, DF L and GS S writing-original draft, methodology; X H, KL L, SW L, ZY D and RZ Z data curation. All authors drafted and revised the manuscript. The final manuscript was read and approved by all authors.

Data Availability

The authors confirm that the data supporting the finding of this study are available within the article.

Declarations

Ethics Approval and Consent to Participate

All animal experiments were reviewed and approved by the Animal Care and Use Committee of the Kunming Medical University (Kmmu20241849).

Consent to Participate

Not applicable.

Competing Interests

The authors declare no competing interests.