Epidemiological and genetic variation analysis of emerging porcine circovirus type 3 in Henan Province, 2023–2024

Abstract

Background

Porcine circovirus type 3 (PCV3) is an emerging pathogen with high genetic variability, posing a continuous challenge to swine health and disease control. Ongoing viral evolution highlights the need for molecular surveillance to monitor circulating PCV3 strains.

Results

From 2023 to 2024, 257 blood and tissue samples from pigs with reproductive and respiratory disorders were collected in Henan Province, China. PCV3 was detected in 21.79% (56/257) of samples by quantitative real-time PCR (qPCR). Genetic characterization of 15 new PCV3 strains showed 98.95–99.95% nucleotide (nt) identity among themselves and 98.70-99.85% identity with global reference strains. Phylogenetic analysis of the ORF2 genes identified PCV3a-1, PCV3a-2, PCV3a-IM, PCV3b, and PCV3c subtypes, with PCV3b predominating. Notably, a genetically divergent strain, HN240609, clustered within the PCV3c subgroup. Additionally, multiple unique amino acid (aa) mutations were observed in the predicted T-cell and B-cell epitope regions of the capsid (Cap) protein (R10K, A35V, T102A, T102S, F104Y, T170A, and V180I).

Conclusions

Genetically diverse PCV3 strains are co-circulating in Henan Province, and mutations in antigenic regions of the Cap protein may facilitate immune evasion. Continuous molecular surveillance is therefore essential for effective PCV3 prevention and control.

Background

Porcine circovirus (PCV), as a member of the family Circoviridae and genus Circovirus, is an envelope-less, single-stranded DNA virus, and it is one of the smallest known animal viruses because of its extremely small size [1]. Five PCV types have been identified (PCV1-PCV5) [2–5]. Among them, PCV1, first identified in 1974, is considered to be non-pathogenic to pigs and can proliferate in PK-15 cells [6]. PCV4 was reported in 2019 in a Chinese pig farm associated with severe clinical disease [4, 7]. Recently, a novel single circular DNA virus, tentatively named PCV5, was identified in pigs suffering from respiratory, diarrheal, and reproductive failure diseases in China [5]. PCV2 is the main pathogen of porcine circovirus associated disease (PCVAD), postweaning multisystemic wasting syndrome (PMWS) and porcine dermatitis and nephropathy syndrome (PDNS), which have resulted in substantial economic losses to the global swine industry [8–12]. PCV3 was initially discovered in 2015 and was first detected in China in 2017 [13, 14]. Accumulating evidence suggests that PCV3 had been circulating in swine populations for decades prior to its initial report, and since its discovery, it has been detected in multiple countries and regions, indicating a global distribution trend [13, 15–20]. Experimental infection studies and clinical investigations have demonstrated that PCV3 can induce clinical manifestations similar to those of PCV2 [21, 22]. Moreover, PCV3 is capable of infecting pigs of all ages and has been associated with PDNS, reproductive disorders, and multisystemic dysfunction [18, 22–24].

The PCV3 genome is small, with a total length of about 2000 bp and contains at least three open reading frames (ORFs), ORF1 to ORF3 [25]. ORF1 encodes the replication-associated (Rep) protein, which is the most conserved region in the genome, while ORF2 encodes the unique capsid (Cap) protein, which induces a protective immune response in the host, and the function of ORF3 is not yet known [26]. Currently, the global PCV3 isolates can so far be categorized into three subtypes (PCV3a, PCV3b, and PCV3c) based on the ORF2 sequences, where PCV3a can be further classified into PCV3a-1, PCV3a-2, and PCV3a-IM genotypes [27–30]. In addition, three B-cell epitopes (amino acid (aa) 57–61, aa 140–146, and aa 161–166) were identified on the Cap protein by antigenic localization analysis using monoclonal antibodies (MAbs) [31]. Recently, a potential linear epitope predicted in the nuclear localization signal (NLS) region of the Cap protein was reported [32]. Additionally, multiple predicted linear B-cell and ten T-cell antigenic epitopes on the Cap protein were also reported [33]. However, the full biological activity of these epitopes, as well as the functional and structural changes observed between isoforms, remain unknown.

Henan Province is one of China’s largest swine-farming regions. Most of Henan’s swine farming is concentrated in six cities: Nanyang, Zhumadian, Pingdingshan, Xinyang, Zhoukou, and Shangqiu. This study aims to investigate the prevalence of PCV3 in Henan Province during the period from 2023 to 2024. We collected samples from the six cities mentioned above and obtained full-length PCV3 genome sequences, which were subjected to homology and phylogenetic analysis against reference strains in GenBank. Comparative analysis was focused on the Cap protein sequences to provide valuable insights into the genetic variation of PCV3.

Methods

Sample collection, DNA extraction, and qPCR analysis

The sample size was determined based on recent epidemiological studies of PCV3 or PCV2, in which 200–400 samples are typically used. Considering the scale and distribution of pig production in Henan Province, six major swine-producing regions (Nanyang, Zhumadian, Pingdingshan, Xinyang, Zhoukou, and Shangqiu) were selected as sampling sites between 2023 and 2024. Using a systematic random sampling approach to maximize geographic representativeness, a total of 257 samples (including both blood and tissue specimens) were collected only from pigs exhibiting clinical signs of reproductive and respiratory disorders. All samples were obtained from commercial three-way crossbred pigs (Duroc boars × Landrace × Large White sows), the predominant production type in Henan Province. All samples were stored at -80 °C until further processing. Viral genomic DNA was extracted from 200 µL serum or tissue homogenate using a Simply P Virus DNA/RNA Extraction kit (Hangzhou BORI Technology, Hangzhou, China) following the manufacturer’s instructions. The quantitative real-time PCR (qPCR) kit of PCV3 (Hunan Guanmu Biotechnology Inc., Changsha, China) was used to test all the samples.

In each reaction well, 20 µL of PCR-Mix was added, followed by 5 µL of DNA extracted of the samples to be tested, negative control and positive control, respectively. The qPCR amplification procedure was as follows: activation of Taq enzyme at 95 °C for 2 min, followed by 40 cycles of denaturation at 95 °C for 15 s, annealing, extension and fluorescence acquisition at 60 °C for 30 s, and finally an instrument cooling step at 25 °C for 10 s. For any sample, a positive result was determined when the Ct ≤ 35. The 95% confidence interval (CI) of the sample positive rate was calculated using the normal approximation method of the GraphPad Prism software.

Whole genome amplification and sequencing of PCV3

Select samples with Ct ≤ 30 as templates for PCR amplification. PCV3-specific primer pairs were designed based on existing PCV3 full-genome sequences in GenBank (Table 1). The complete PCV3 genome was amplified using the overlapping fragment method. After purification, the PCR products were cloned into the pMD18-T vector (TaKaRa, Dalian, China), and the ligation products were transformed into E. coli TOP10 competent cells (Shanghai Sangon Biotechnology Co., Ltd.). Positive colonies were screened by colony PCR and sent to Sang Bioengineering (Shanghai) for Sanger sequencing. Sequencing data were assembled and analyzed using the SeqMan program within the DNASTAR software package (version 7.10, Madison, Wisconsin, USA), producing the complete viral genome sequence.

Table 1.

The whole-genome amplification primers of PCV3

Primer names	Primer sequences (5’-3’)	Fragment length (bp)	Annealing temperature (℃)
PCV3-1-F	ACCCGGCACCTCGGAACC	820	57
PCV3-1-R	ACCCTCCCCATTATAACCATC
PCV3-2-F	ATGTTTTTATTGGTCCTCCAGG	820	57
PCV3-2-R	ACAACCTCCGCTCACCCAG
PCV3-3-F	AGCAGTGCTCCCCATTGAACG	575	57
PCV3-3-R	AATACTAGCCCGGCACCAAAATG

Identification and phylogenetic analysis

To investigate the genomic nucleotide (nt) sequence characteristics of the newly acquired PCV3 strain and clarify its phylogenetic affiliation, its assembled sequence was compared with representative strain sequences of different genotypes from the GenBank database. Using the MegAlign module of the DNASTAR software package (version 7.10), the sequence similarity between the new strain and reference strains was further assessed. The HKY + G model of the Molecular Evolutionary Genetics Analysis (MEGA) software (Version 11.0) was used to construct the phylogenetic tree based on the ORF2 sequences [34]. A bootstrap value was calculated using 1,000 replicates.

Analysis of amino acid variability on the Cap protein

To identify the aa mutations and evaluate sequence variability, the Cap protein sequences from the newly obtained PCV3 strains and reference strains were comparatively analyzed. Multiple sequence alignment was performed using the MegAlign program within the DNASTAR software package (Version 7.10).

Results

Positive rate and regional distribution

qPCR testing was conducted on 257 suspected samples collected from different cities in Henan Province. Results showed an average positive rate of 21.79% (56/257), with a 95% CI ranging from 16.74% to 26.84%. Positive rates varied across regions, with the highest rate observed in Nanyang (33.87%, 21/62), followed by Pingdingshan (22.80%, 13/57), Xinyang (20.59%, 7/34), Zhumadian (19.35%, 6/31), Zhoukou (15.22%, 7/46) and Shangqiu (7.41%, 2/27) (Fig. 1). The 95% CIs for the positive rates of these areas were detailed in Table 2. Notably, the positive rates in Nanyang and Pingdingshan exceeded the overall positive rate.

Fig. 1.

Regional distribution of samples and PCV3 positive rates in Henan Province

Table 2.

The 95% CIs for the positive rates of the selected areas in Henan Province

Areas	Total samples (n)	Positive samples (k)	Positive rate (%)	95% CI (%)
Nanyang	62	21	33.87	22.09–45.65
Pingdingshan	57	13	22.81	11.92–33.70
Xinyang	34	7	20.59	7.00-34.18
Zhumadian	31	6	19.35	5.45–33.26
Zhoukou	46	7	15.22	4.84–25.60
Shangqiu	27	2	7.41	0.00-17.29
Total	257	56	21.79	16.74–26.84

Sequence identity analysis

Through the combined use of PCR amplification, sequencing, and assembly, we obtained the complete genome sequences of 15 PCV3-positive samples, all with a length of 2000 nt. Whole-genome sequence comparison revealed 98.95–99.95% sequence identity among the 15 novel PCV3 strains, while their identity with the 40 PCV3 reference genome sequences from GenBank ranged from 98.30% to 99.85% (Fig. 2). Specifically, the sequence identity between the new strains and the representative strains PCV3a-1 BR/RS/6 (MF079253), PCV3a-IM CHN/GD2016 (KY421347), PCV3a-2 US/MO2015 (KX778720), PCV3b US/SD201 (KX966193) and PCV3c US-2164 (KX458235) ranged from 98.85 to 99.6%, 98.80-99.45%, 98.7-99.35%, 99.10-99.55% and 98.95–99.60%, respectively (Table 3). Notably, the new strain HN240609 exhibited greater genetic variability, with sequence identities of only 98.75–99.15% compared to the five reference strains.

Fig. 2.

Heatmap illustrating the percentage identity between 15 new PCV3 isolates and 40 reference strains based on whole-genome sequences

Table 3.

Sequence identity between the 15 new PCV3 isolates and 5 representative strains (%)

New PCV3 strains	Accession nos.	PCV3a-1 BR/RS/6 (MF079253)	PCV3a-IM CHN/GD2016 (KY421347)	PCV3a-2 US/MO2015 (KX778720)	PCV3b US/SD201 (KX966193)	PCV3c US-2164 (KX458235)
HN230807	PX852042	99.20	99.10	99.10	99.50	99.25
HN230916	PX852043	99.10	99.00	99.10	99.50	99.15
HN231022	PX852044	99.10	99.00	99.00	99.50	99.15
HN231102	PX852045	99.20	99.30	99.20	99.20	99.35
HN231202	PX852046	99.15	99.35	99.15	99.25	99.60
HN240126	PX852047	98.90	98.80	98.70	99.10	98.95
HN240327	PX852048	99.05	98.95	98.95	99.45	99.10
HN240415	PX852049	99.60	99.00	99.00	99.10	99.05
HN240424	PX852050	99.15	99.05	99.10	99.55	99.20
HN240609	PX852051	98.85	98.85	98.75	99.15	98.90
HN240712	PX852052	99.10	98.90	98.90	99.40	99.05
HN240910	PX852053	99.10	99.00	98.90	99.30	99.15
HN240927	PX852054	99.40	99.20	99.20	99.30	99.25
HN241015	PX852055	99.40	99.20	99.10	99.10	99.25
HN241211	PX852056	99.35	99.45	99.35	99.35	99.50

Phylogenetic analysis

To investigate the genetic diversity of PCV3 in Henan Province during 2023–2024, a total of 55 ORF2 sequences, including 15 newly identified PCV3 strains from this study and 40 representative reference strains retrieved from GenBank, were included in the phylogenetic analysis. As shown in Fig. 3, the newly identified PCV3 strains were classified into four genotypes: PCV3a-1, PCV3a-IM, PCV3a-2, PCV3b, and PCV3c. Among the new strains, HN231202, HN240415 and HN241015 clustered with the PCV3a-1 reference strains, confirming their classification as a PCV3a-1 genotype. The new strain HN240927 clustered with the PCV3a-2 reference strains, confirming their classification as a PCV3a-2 genotype. Similarly, HN231102 and HN241211 clustered with the PCV3a-IM reference strains and HN240609 clustered with the PCV3c reference strains, indicating they belong to the PCV3a-IM genotype and PCV3c genotype, respectively. The remaining 8 new strains formed a larger cluster with the PCV3b reference strains. Within this cluster, the new strains HN240910 and HN240712 form a relatively distinct clade. HN240424 clusters with PCV3b KU-1603 (KY9963339) in a small clade, while the new strains HN231022, HN240126, and HN240327 form a separate small clade. Notably, the new strain HN240609, which emerged in 2024, is the only strain clustered with the PCV3c genotype, indicating significant genetic differentiation. Similarly, although HN230916 clusters with PCV3b reference strains, it is phylogenetically distant from them, suggesting the possible presence of genetic variation.

Fig. 3.

Maximum-likelihood phylogenetic tree constructed from ORF2 gene sequences of 15 new PCV3 isolates and 40 reference sequences. New PCV3 strains identified in this study are indicated with red

Amino acid sequence analysis of the Cap protein

To further investigate the molecular characteristics of the newly identified PCV3 strains, the Cap protein sequences of these strains with those of reference strains were compared (Fig. 4). The results revealed consistent aa mutations within the same PCV3 subtypes, which aids the identification of the new strains. Overall, the V24A and K27R mutations were present only in the PCV3a-1, PCV3a-IM, and PCV3a-2 genotypes, suggesting that they may serve as molecular markers for the PCV3a subtype strains. In addition, compared to other PCV3 strains, the PCV3a-1 genotype consistently carried the unique mutations of S77T and I150L, thus distinguishing them from other strains. Meanwhile, the new PCV3 strains exhibited some point mutations in the Cap protein, but no aa deletions or insertions. Compared with other strains, both the new strains HN231022 and HN240327 harbored the unique V180I mutation. The new strain HN230916 carried a T102A mutation, whereas HN240126 strain possessed a T102S mutation at the same position. The newly identified HN240609 strain also exhibited three unique mutations of R10K, A35V and T170A. In addition, the new strains HN240609 and HN240927 shared the F104Y mutation with the reference strain PCV3c 2021-GD (MZ667333).

Fig. 4.

Amino acid sequence analysis of the Cap protein comparing new PCV3 isolates with reference strains. The red sphere represents the newly identified strain

Discussion

Since its first discovery in 2015, PCV3 has spread widely across numerous countries [10, 13, 15–20]. In China, PCV3 is epidemic in multiple regions, posing a significant threat to the swine industry [13, 14]. The development trend of intensive farming production has provided a favorable environment for the spread of the virus, leading to the continuous spread of PCV3 in pig herds. Moreover, under such an environment, the genome sequence of the virus may change, leading to the emergence of new genetic variants, which poses a serious threat to the health of pig herds. Although studies have demonstrated that the Cap protein of PCV3 can be utilized to construct subunit vaccines, no commercially available PCV3 vaccines have yet been developed [35–37]. Due to the low codon usage preference, PCV3 has higher effective reproductive number value and evolutionary rate than other single-stranded DNA viruses [38]. Therefore, it is necessary to pay attention to the current status of PCV3 circulation and genetic variability. Henan, a major pig farming province in Central China, has its swine industry concentrated in Nanyang, Zhumadian, Pingdingshan, Xinyang, Zhoukou and Shangqiu. To assess the prevalence of PCV3 in Henan Province, we collected samples from 2023 to 2024 in these areas and performed qPCR on 257 suspected cases of infection. The results showed that the positive rate in the sample collection areas of Henan Province ranged from 7.41% to 33.87%. The overall PCV3 positive rate was 21.79% (56/257), with a 95% CI of 16.74–26.84%, indicating that PCV3 is widely circulating in Henan Province. A recent study reported that the PCV3 positive rate was only 9.25% in Henan Province from 2022 to 2024, which is lower than the results of the present study [39]. This difference might be related to the source of the samples.

In recent years, extensive research has been conducted on PCV3 variants, with different classification methods dividing PCV3 strains into multiple genotypes [27, 30]. With deepening understanding of PCV3 genetic variation, a typing method based on the A24V and R27K mutations of the Cap protein has been widely adopted, classifying PCV3 into three subtypes: PCV3a, PCV3b, and PCV3c [27, 30]. Based on the variations of the Cap protein, PCV3a is further subdivided into three sub-genotypes: PCV3a-1, PCV3a-2, and PCV3a-IM [27, 38, 40, 41]. This study incorporated ORF2 sequences from 15 newly identified PCV3 strains and 40 representative reference strains selected from the GenBank database into the analysis. A total of 55 ORF2 sequences were used for phylogenetic analysis, classifying the 55 PCV3 strains into three genotypes: PCV3a, PCV3b, and PCV3c. The PCV3a genotype was further divided into PCV3a-1, PCV3a-IM, and PCV3a-2 sub-genotypes. Among the 15 newly identified PCV3 strains, 8 strains belonged to the PCV3b, 3 strains classified as the PCV3a-IM, 2 strains assigned to the PCV3a-1, and 1 was classified as PCV3a-2.The remaining strain was identified as PCV3c. These findings indicate that PCV3 in Henan Province exhibits a complex epidemiological pattern, as characterized by the dominance of the PCV3b genotype alongside the co-circulation of multiple genotypes. This discovery aligns with prior research indicating that between 2020 and 2022, the PCV3b genotype was replacing PCV3a as the predominant circulating genotype in Central China [42]. This is also consistent with the results of a 2022–2024 epidemiological study on PCV3 in Henan, where the PCV3b subtype was identified as the predominant genotype in the region [39]. However, in the northeastern border regions of China, PCV3a is the predominant circulating genotype [43]. In addition, mixed infections with PCV3a and PCV3b have been observed in the upper northern regions of Thailand [44]. Interestingly, in Portugal, PCV3c is the dominant genotype in domestic pigs, whereas PCV3a predominates in wild boar populations [45]. In Vietnam, PCV3b is the major circulating genotype [46]. Taken together, these observations indicate that PCV3 exhibits distinct epidemiological patterns across different regions worldwide, which may be driven by variations in pig production systems, animal movement patterns, and immunization practices. Whether a globally dominant PCV3 genotype will eventually emerge remains to be determined through continuous and comprehensive surveillance.

The Cap protein encoded by the ORF2 gene is the primary mutation region of PCV3 [47, 48]. Studies indicate that aa140-146 on the Cap protein possess characteristics of a decoy epitope. Mutations in this region may enhance PCV3’s immune evasion capacity, increase viral infectivity, and even enable it to escape antibody neutralization [31–33, 49–51]. The new PCV3 strains identified in this study shows conservation in this region but harbors multiple unique mutations at other sites. The impact of these mutations on viral properties warrants further investigation. Moreover, previous studies have reported using two specific aa mutations on the Cap protein (V24A and K27R) as molecular markers for classifying PCV3 subtypes [27]. However, this study found that only PCV3a genotype strains carry these two mutations. Furthermore, the PCV3a-1 subtype strains possess two characteristic mutations (S77T and I149L), which can serve as identification markers for this genotype.

Previous studies confirmed that PCV3 infection can lead to increased numbers of weak piglets, stillborn, and mummified fetuses on farms [24]. In the present study, the new PCV3c strain HN240609 originated from a large-scale pig farm where sows exhibited severe reproductive disorders, including abortion, stillbirth, and fetal mummification. Laboratory testing has ruled out infection by other major reproductive pathogens, such as porcine reproductive and respiratory syndrome virus (PRRSV), pseudorabies virus (PRV), porcine parvovirus (PPV), and Japanese encephalitis virus (JEV), etc. PCV3 was the only pathogen detected in samples from this affected farm. However, whether this virus is a potential cause of the reproductive disorders requires verification using appropriate infection models [22]. From the perspectives of viral evolution and disease control, the continuous emergence of aa mutations in PCV3 strains has the potential to drive the formation of novel genotypes. Such genetic variations may increase the uncertainty of viral epidemiology and transmission dynamics, thereby complicating the comprehensive prevention and control of swine-associated diseases. In light of the ongoing evolutionary trends of PCV3 and the need to control reproductive disorders in pig herds, the development of new or improved vaccines targeting the continuously evolving PCV3 strains is of practical necessity and research urgency.

Conclusion

In summary, PCV3 was widely present among pigs with respiratory symptoms in Henan Province during 2023–2024, with PCV3b identified as the predominant genotype. The newly emerging PCV3c strain HN240609 contains multiple aa mutations in the envelope protein. Whether PCV3c will emerge as the dominant circulating genotype in Henan Province requires further epidemiological surveillance. Overall, these results emphasize the need for continuous PCV3 genomic monitoring to better understand viral evolution, evaluate potential effects on vaccine efficacy, and improve disease control strategies in the swine industry.

Abbreviations

PCV

Porcine circovirus

PCVAD

Porcine circovirus associated disease

PMWS

Postweaning multisystemic wasting syndrome

PDNS

Porcine dermatitis and nephropathy syndrome

ORFs

Open reading frames

Rep protein

Replication-associated protein

Cap protein

Capsid protein

aa

Amino acid

Mabs

Monoclonal antibodies

NLS

Nuclear localization signal

qPCR

Quantitative real-time PCR

nt

Nucleotide

Authors’ contributions

CL participated in sample collection, and the design of the study. JS drafted the main parts of the manuscript. JS, HZ, and JC participated in sample collection and PCR detection. MJ, JW, YZ, YuZ, LX, and TJ participated in sequencing and data analysis. NL, TZ, HS, DL, YK, LY, and ZT participated in the design of the study, drafted the main parts of the manuscript and revised the manuscript. All authors read and approved the final manuscrip.

Funding

The Scientific and Technological Project of Henan Province (Grant No. 252102111005), and the Natural Science Foundation of Henan Province, China (Grant No. 242300421335) supported this study.

Data availability

All data generated or analyzed during this study are included in this published article. Sequences obtained in the present study are deposited in GenBank under accession numbers: PX852042- PX852056.

Declarations

Ethics approval and consent to participate

Informed consent of the pig owner is provided in the study. The study was carried out in compliance with the ARRIVE guidelines. All methods were carried out in accordance with Chinese Law for the Care and Use of Animals. The research protocol was approved by the Animal Welfare and Ethics Committee of Nanyang Normal University (approval no. No 20019, year: 2020).

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.