Skip to main content
International Journal of Genomics logoLink to International Journal of Genomics
. 2026 Jul 13;2026:9351063. doi: 10.1155/ijog/9351063

Overexpression of lncRNA ATP11A‐AS1 in Colorectal Cancer and Its Association With H. pylori Infection

Nima Hagholshahri 1, Nashwah Jabbar Kadhim Muttwaqi 2, Reza Safaralizadeh 1,, Mohammadali Hosseinpour Feizi 1, Ali Rajabi 1,
Editor: Lin Qi
PMCID: PMC13365877  PMID: 42453602

Abstract

Background

Colorectal cancer (CRC), the third most common cancer globally, is a leading cause of cancer‐related mortality. Helicobacter pylori infection, a risk factor for CRC, promotes carcinogenesis via inflammation and microbiota disruption. Long noncoding RNAs (lncRNAs), such as ATP11A‐AS1, regulate key processes in CRC progression, including proliferation and invasion. However, the role of ATP11A‐AS1 in CRC and its association with H. pylori infection remain underexplored. This study quantified ATP11A‐AS1 expression in CRC tumors compared with adjacent nontumor tissues and investigated its relationship with H. pylori infection and clinicopathological features.

Methods

Total RNA was extracted from 100 paired tumor and adjacent nontumor tissues collected from CRC patients (53 males, 47 females, mean age: 56 ± 6.72). Following cDNA synthesis, ATP11A‐AS1 expression was measured via qRT‐PCR. Associations with clinicopathological factors (age, gender, tumor site, histology, stage, lymph node metastasis, H. pylori status, family history of CRC, alcohol consumption, and diabetes) were analyzed using Mann–Whitney tests. Multivariate binary logistic regression, adjusted for age, sex, and tumor site, was applied to clinicopathological outcomes.

Results

ATP11A-AS1 expression was significantly upregulated in tumor tissues compared with nontumor tissues (p < 0.0001). Among 59 H. pylori‐positive patients, expression was higher (p = 0.036). No significant associations were found with other features. Multivariate analysis confirmed no independent associations (all p > 0.05). ROC curve analysis yielded an AUC of 0.69, with sensitivity of 63% and specificity of 68%, indicating that ATP11A-AS1 is a weak biomarker for CRC detection.

Conclusion

ATP11A‐AS1 is overexpressed in CRC and associated with H. pylori infection, suggesting a potential role in CRC pathogenesis. Further studies are needed to elucidate its molecular mechanisms and clinical significance in H. pylori‐related CRC.

Keywords: ATP11A-AS1, colorectal cancer, Helicobacter pylori, long noncoding RNA, qRT-PCR

1. Introduction

Colorectal cancer (CRC), encompassing cancers of the colon and rectum, is the third most frequently diagnosed cancer globally, accounting for approximately 9.6% of cancer cases. It is also the second leading cause of cancer‐related deaths, responsible for 9.3% of mortalities worldwide. The incidence and mortality rates are notably higher in men than women, with rising early‐onset cases amplifying their global burden [1].

Despite advances in screening, particularly through colonoscopy, CRC remains a major global health challenge due to its often asymptomatic early stages, which delay diagnosis, lead to poorer prognosis, and limit effective treatment. The invasiveness and variable sensitivity of colonoscopy further hinder early detection, exacerbating CRC′s high mortality burden [2]. Although CRC incidence in individuals over 50 has stabilized in developed countries, the rising early‐onset CRC in younger populations highlights the need for deeper insights into its risk factors [3, 4]. Key risk factors for CRC include aging, male sex, dietary habits, genetic predisposition, and infections. For instance, Helicobacter pylori infection can alter the gut microbiota and impact gut immunity, thereby contributing to CRC incidence [5, 6]. In detail, H. pylori promote CRC through chronic inflammation via NF‐κB activation, cytokine release (e.g., IL‐6), as well as gut microbiota dysbiosis [7]. Diabetes is another established risk factor, both increasing incidence and affecting prognosis through various dysregulated pathways. [8] As for tumor features, tumor progression is staged from I to IV based on factors such as tumor size, lymph node involvement, and metastases, with later stages posing increasing treatment challenges [9]. Moreover, approximately 10%–20% of CRC patients exhibit a mucinous subtype, characterized by abundant extracellular mucin compared with conventional adenocarcinoma [10]. Tumor microenvironment (TME) can also vary from case to case and include a wide range of bacteria, since TME can influence both internal and external conditions these influences can be case specific [11, 12]. These clinicopathological characteristics underscore the complexity of CRC and the need for molecular insights that could improve disease management.

Among emerging areas of molecular oncology, noncoding RNAs (ncRNAs) have garnered significant attention for their regulatory roles in cellular processes, despite lacking protein‐coding potential. Long noncoding RNAs (lncRNAs), defined as transcripts exceeding 200 nucleotides, are pivotal in modulating transcription, cell cycle progression, apoptosis, and genomic stability [13, 14]. Distributed across the genome, lncRNAs are categorized as intronic, intergenic, sense, or antisense based on their genomic origin. Transcribed primarily by RNA Polymerase II, most lncRNAs undergo capping, polyadenylation, and splicing, mirroring mRNA biogenesis, and are predominantly localized in the nucleus, with limited cytoplasmic presence [15]. Characterized by cell‐specific expression and low abundance, lncRNAs exert precise regulatory control in normal physiology. However, aberrant lncRNA expression is increasingly implicated in carcinogenesis, particularly in CRC, where it disrupts critical signaling pathways such as Wnt/β‐catenin and PI3K/AKT, alters protein expression, and promotes oncogenic phenotypes, including enhanced proliferation, migration, and invasion [16, 17]. For instance, lncRNAs like HOTAIR and MALAT1 have been shown to interact with chromatin‐modifying complexes or act as molecular sponges for microRNAs, thereby driving CRC progression. These roles in tumor initiation and progression underscore lncRNAs as key contributors to CRC pathogenesis and potential therapeutic targets [18].

ATP11A‐AS1, a lncRNA located on Chromosome 13, is transcribed antisense to the ATP11A gene, which encodes a phospholipid‐transporting ATPase involved in membrane lipid asymmetry and affecting innate immune response [19, 20]. Moreover, ATP11A overexpression serves as a metachronous metastasis predictor in CRC [21]. Emerging evidence indicates that ATP11A‐AS1 is significantly upregulated in colon adenocarcinoma and acute lymphoblastic leukemia, suggesting its oncogenic role in tumorigenesis. Despite these findings, the specific role of ATP11A‐AS1 in CRC pathogenesis remains largely unexplored [22, 23].

This study is aimed at quantifying ATP11A‐AS1 expression in CRC tissues compared with adjacent noncancerous tissues and to elucidate its associations with clinicopathological features, thereby providing insights into its potential as a biomarker or therapeutic target in CRC.

2. Material and Methods

2.1. Samples

One hundred tumor and tumor‐adjacent tissue samples were collected from CRC patients admitted to Imam Reza Hospital of Tabriz. The study included adult patients with a confirmed diagnosis of CRC. Patients were excluded if they had a concurrent or recent history of other primary malignancies or significant comorbid conditions. Additionally, individuals who had undergone prior treatment for CRC were not eligible for inclusion. Tissues were immediately placed in RNAse‐free microtubes, flash‐frozen in liquid nitrogen, and stored at −80°C until RNA extraction. This study was approved by the medical ethics committee of the University of Tabriz (ID No. IR.TABRIZU.REC.1403.113) and adhered to the Declaration of Helsinki and Good Clinical Practice guidelines. Written informed consent was obtained from all participants. An experienced pathologist confirmed the histological diagnosis for all samples.

2.2. RNA Extraction, Complementary DNA (cDNA) Synthesis, and Quantitative Real‐Time Polymerase Chain Reaction (qRT‐PCR)

Total RNA was extracted from frozen CRC tumor and paired adjacent nontumor tissues using TRIzol Reagent (Invitrogen, Thermo Fisher Scientific, Waltham, Massachusetts, United States) following the manufacturer′s protocol. To eliminate genomic DNA contamination, RNA samples were treated with DNase I (GeneAll Biotechnology, Seoul, South Korea) according to the manufacturer′s instructions. RNA concentration and purity were quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, Delaware, United States), with A260/A280 ratios between 1.8 and 2.0 indicating acceptable purity. RNA integrity was assessed via 1% (w/v) agarose gel electrophoresis, confirming intact 28S and 18S rRNA bands.

cDNA was synthesized from 500 ng of total RNA using the PrimeScript RT Reagent Kit (TaKaRa Bio, Kusatsu, Japan) per the manufacturer′s protocol, with reactions performed in a 20 μL volume. qRT‐PCR was conducted using SYBR Green PCR Master Mix (Amplicon, Odense, Denmark) on a LightCycler 96 System (Roche Molecular Systems, Pleasanton, California, United States). Each 20 μL reaction contained 10 μL SYBR Green Master Mix, 0.3 μM of each forward and reverse primer, 1 μL cDNA (100 ng/μL) template, and nuclease‐free water. The primers for ATP11A‐AS1 were: forward, 5 ‐CCACAAGTGCAGCGTTCATC‐3 ; reverse, 5 ‐AAGTGGTACTGACGTGTGGC‐3 . β‐Actin, used as the reference gene for normalization, was amplified with: forward, 5 ‐AGAGCTACGAGCTGCCTGAC‐3 ; reverse, 5 ‐AGCACTGTCTTGGCGTACAG‐3 . The qRT‐PCR cycling conditions were as follows: initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s. Relative expression of ATP11A‐AS1 was calculated using the 2 − ΔΔCt method, normalized to β‐actin. And all experiments were conducted in triplicate.

2.3. Statistical Analysis

Cycle threshold (Ct) values for ATP11A‐AS1 and β‐actin were determined, with ΔCt calculated as their differences. Relative expression was then quantified using the 2ΔCt method for comparison between tumor and adjacent nontumor tissues. Moreover, GraphPad Prism 10 software was used to analyze the data and determine the sensitivity percentage, specificity percentage, and cutoff score, using the Index of Union (IU) method, for ATP11A‐AS1 as a potential biomarker in CRC patients by employing the receiver operating characteristic (ROC) curve test. Positive likelihood ratio (LR+) and negative likelihood ratio (LR−) were calculated using sensitivity/1‐specificity and 1‐sensitivity/specificity, respectively. Data normality was evaluated using both the Shapiro–Wilk and Kolmogorov–Smirnov tests. Continuous variables were summarized as mean ± standard deviation (SD). Associations between ATP11A‐AS1 expression level and the clinicopathological features were also evaluated using SPSS 20, employing the Mann–Whitney test for two‐group comparisons and multivariate analysis to assess the combined effects of multiple clinicopathological variables. A p value less than 0.05 was considered statistically significant.

3. Results

One hundred CRC patients (53 males, 47 females) with a mean age of 56 (±SD 6.72) were included. Sixteen patients were under 50, whereas 84 were 50 or older. Tumors were located in the rectum for 61 patients and in the colon for the remaining 39. Among the patients, 66 had adenocarcinoma, whereas 34 had mucinous adenocarcinoma. Tumor differentiation was poor in 42 cases, with the remaining exhibiting moderate or better differentiation. Early‐stage tumors (I/II) were observed in 52 cases, whereas 48 patients were diagnosed at advanced stages (III/IV). Lymph node metastasis was present in 59 cases, whereas 41 showed no metastasis. H. pylori was detected in 59 patients. A family history of CRC was reported in 46% of the patients. Additionally, 47 patients were diagnosed with diabetes, and 38 reported alcohol consumption.

3.1. Data Normality, Expression Levels, and Diagnostic Biomarker Potency

The Shapiro–Wilk test produced W values of 0.6507 and 0.6307 for tumoral and marginal samples, respectively, with p < 0.0001, indicating departure from a normal distribution. The Kolmogorov–Smirnov test yielded KS distances of 0.2406 and 0.2433 for tumor and marginal samples, also with p < 0.0001. Both tests showed that the datasets did not follow a normal distribution.

The expression of ATP11A‐AS1 lncRNA was significantly higher in the tumor tissue compared with the adjacent noncancer tissue (p < 0.0001) (Figure 1). In H. pylori‐positive samples, ATP11A‐AS1 expression was elevated (p = 0.036). Other clinicopathological features did not correlate with ATP11A‐AS1 expression (Table 1). Multivariate binary logistic regression models, adjusted for age, sex, and tumor site, were fitted for all binary clinicopathological outcomes to evaluate the independent association of ATP11A‐AS1 tumor expression with these features (Table 2). Across the 10 outcomes, ATP11A‐AS1 expression showed no independent associations (all p > 0.05). Odds ratios (ORs) per unit increase in expression spanned a wide range (0.008–55.0) but remained consistently noninformative, reflecting the low variability in expression (SD = 0.072). Model fit was generally poor (McFadden′s Pseudo R 2 = 0.010–0.038 for converged models; LLR p > 0.14), indicating limited predictive power. Quasi‐complete or perfect separation occurred in 30% of models (e.g., diabetes and tumor site), yielding unstable estimates with confidence intervals spanning orders of magnitude (e.g., 0.0002–0.302 for diabetes; 0.000–∞ for tumor site), attributable to sparse event rates (n = 21–24 for diabetes, mucinous histology). The sex (male) model failed to converge due to collinearity. Notable but nonrobust trends included a borderline positive association with H. pylori infection (OR = 55.0, p = 0.184) and apparent protective effects for diabetes (OR = 0.008, p = 0.185) and poor differentiation (OR = 0.172, p = 0.558). Sex emerged as a confounder in the poor differentiation model (OR = 0.401, p = 0.030), with males less likely to exhibit poor differentiation.

Figure 1.

Figure 1

Relative expression of ATP11A-AS1 in CRC tumor tissues compared with marginal nontumor tissues. Tumor tissues showed significantly higher ATP11A-AS1 expression than marginal tissues (p < 0.0001), indicating potential upregulation in CRC. Bars represent mean ± SD; ****p < 0.0001.

Table 1.

Association between ATP11A‐AS1 expression and clinicopathological features in patients with CRC.

Variable Expression means in tumoral tissue (m e a n ± S D) Expression means in marginal tissue (m e a n ± S D) p
Age 0.067
 < 50 0.096 ± 0.120 0.026 ± 0.031
 ≥ 50 0.048 ± 0.055 0.028 ± 0.039
Gender 0.111
 Male 0.047 ± 0.056 0.033 ± 0.047
 Female 0.066 ± 0.086 0.021 ± 0.023
Tumor site 0.677
 Rectum 0.051 ± 0.058 0.025 ± 0.032
 Colon 0.063 ± 0.089 0.031 ± 0.045
Tumor histology 0.483
 Adenocarcinoma 0.057 ± 0.071 0.026 ± 0.030
 Mucinous adenocarcinoma 0.054 ± 0.074 0.030 ± 0.049
Tumor differentiation 0.525
 Poor 0.053 ± 0.081 0.028 ± 0.046
 Moderate/well 0.057 ± 0.064 0.026 ± 0.031
TNM stages 0.738
 I/II 0.054 ± 0.064 0.023 ± 0.031
 III/IV 0.057 ± 0.080 0.031 ± 0.046
Lymph metastasis 0.866
No 0.055 ± 0.065 0.026 ± 0.040
Yes 0.057 ± 0.081 0.028 ± 0.036
H. pylori infection 0.036 
No 0.048 ± 0.062 0.028 ± 0.045
Yes 0.066 ± 0.083 0.026 ± 0.024
Family history of CRC 0.161
No 0.054 ± 0.079 0.058 ± 0.062
Yes 0.033 ± 0.048 0.020 ± 0.018
Diabetes 0.462
No 0.067 ± 0.087 0.027 ± 0.028
Yes 0.044 ± 0.047 0.028 ± 0.046
Alcohol consumption 0.840
No 0.052 ± 0.058 0.030 ± 0.045
Yes 0.063 ± 0.090 0.023 ± 0.023

*p < 0.05.

Table 2.

Summary of multivariate associations: tumor versus expression across all binary outcomes.

Outcome Yes (n) OR (95% CI) p Pseudo R 2 LLR p value
Tumor site (colon) 47 6.80 (0.000–∞) 1.000 1.000 1.000
Mucinous histology 21 0.410 (0.001–148.5) 0.773 0.012 0.190
Poor differentiation 28 0.172 (0.002–13.8) 0.558 0.037 0.711
Advanced TNM stage (III, IV) 48 2.16 (0.007–636.1) 0.791 0.010 0.158
Lymph metastasis 41 1.015 (0.006–173.4) 0.996 0.019 0.360
H. pylori infection 35 55.0 (0.150–20,200) 0.184 0.015 0.280
Family history of CRC 41 3.27 (0.011–972.5) 0.683 0.010 0.141
Diabetes 24 0.008 (0.0002–0.302) 0.185 0.038 0.738
Alcohol consumption 32 3.28 (0.011–980.5) 0.688 0.026 0.522

To determine the biomarker potency of ATP11A‐AS1, the sensitivity and specificity were evaluated using the ROC curve analysis. Using the cutoff value of 0.023, the sensitivity and specificity of ATP11A‐AS1 were 63% and 68%, respectively (Figure 2). The area under the curve (AUC) was equal to 0.6948, which implies ATP11A‐AS1 is a weak biomarker. As for likelihood ratios, LR+ was equal to 1.97 (< 2) and LR− was equal to 0.54 (> 0.5), both of which showed a limited predictive power.

Figure 2.

Figure 2

Receiver operating characteristic (ROC) curve illustrating the diagnostic performance of ATP11A-AS1 expression in distinguishing colorectal cancer tissues from adjacent nontumor tissues. AUC was 0.6948 (95% CI: 0.6223–0.7673), indicating moderate discriminative ability. At the optimal cutoff, determined sensitivity was 63% and specificity was 68%.

4. Discussion

CRC is the second most lethal type of cancer, demanding immediate research and clinical intervention. Its incidence is driven by an interplay of environmental and genetic factors [7]. Moreover, CRC is a heterogeneous disease that can be categorized into distinct subgroups based on tumor location (colon or rectum), stage (I–IV), histological features (mucinous or nonmucinous), and differing molecular profiles [2]. Given the asymptomatic nature of this cancer, it is commonly detected in its advanced stages. Late diagnosis complicates treatment and increases the risk of metastasis, which occurs in 30%–50% of patients [24]. Additionally, the primary diagnostic method, colonoscopy, is invasive and inaccurate [25]. As a result, there is a need for less invasive diagnostic markers and improved treatment strategies.

LncRNAs are a specific subgroup of ncRNAs that have significant roles in translation, apoptosis, and signaling, among other cellular functions [26]. Altered expression of lncRNAs can indicate various diseases such as cancer [27, 28]. For instance, the upregulation of PCAT‐1 [29] and MAFG‐AS1 [30] has been associated with CRC incidence. In addition to their correlation with cancer occurrence, lncRNAs may be linked to other cancer‐related characteristics, including cancer stage, metastasis probability, and histological features. As a result, expression patterns of lncRNAs can be used to distinguish various subtypes of a specific cancer.

Focusing on ATP11A‐AS1, a lncRNA with relatively limited prior research, our study confirmed its significant upregulation in CRC tumor tissue compared with adjacent noncancerous tissue (p < 0.0001), echoing observations in other malignancies such as lymphoblastic leukemia and adenocarcinoma [22, 23]. This result suggests a potential role for ATP11A‐AS1 in tumor progression. However, its diagnostic utility as a standalone biomarker is limited: ATP11A‐AS1 demonstrates an AUC of 0.69. These metrics indicate suboptimal performance in distinguishing CRC tissues from noncancerous ones.

Additionally, our investigation into clinicopathological factors revealed that among the variables examined, only H. pylori infection was significantly associated with elevated ATP11A‐AS1 expression (p = 0.036). This finding is consistent with the growing evidence linking gut microbiome imbalances, particularly bacterial infections, to CRC risk [31, 32]. Deeper understanding of the microbiome can help us use it as an early indicator of cancer [33]. In addition, bacterial characteristics of both TME and organ microbiome can influence cancer on many levels, including progression, metastasis, and treatment response [11, 34]. Due to their effects on cancer progression, these microbiome signatures can be utilized as biomarkers to predict cancer behavior [35]. Among the involved bacteria, H. pylori infection leads to higher CRC rate and mortality [5]. In particular, it has been implicated in CRC pathogenesis by altering the local immune environment and inflammatory response [6, 36]. Another mechanism, through which H. pylori makes the host vulnerable to CRC incidence and progression, is via altering the microbiota. These changes occur both in the gastric microbiota, the site of infection, and in the large intestine [37]. Thus, its eradication is associated with a reduced long‐term cancer risk despite a high annual incidence rate [38].

The present study did not investigate the molecular pathways through which ATP11A-AS1 may contribute to CRC progression. Its interactions with other established biomarkers also remain unexplored, leaving uncertainty about whether ATP11A-AS1 could serve as part of a biomarker panel despite its limited standalone diagnostic potency. In addition, the analysis was restricted to H. pylori infection, without considering the broader gut microbiota. Studying other bacterial communities could provide deeper insight into how H. pylori interacts with the microbial environment to influence ATP11A-AS1 expression.

5. Conclusion

Overall, our findings underline the multifaceted nature of CRC and the complexities involved in its molecular diagnosis. Our study demonstrates a significant upregulation of ATP11A‐AS1 in CRC tissues compared with adjacent nontumor samples. We also observed a significant association between ATP11A‐AS1 expression levels and H. pylori infection. Although ATP11A‐AS1 is associated with CRC progression, its modest diagnostic performance suggests that it may be more valuable as part of a multibiomarker panel rather than as an individual indicator. Future research should focus on elucidating the molecular functions of ATP11A‐AS1 and its interactions with other RNAs, which could pave the way for integrated diagnostic strategies that enhance overall accuracy and improve patient outcomes.

Author Contributions

Nima Hagholshahri: writing – original draft, visualization, software, methodology, conceptualization. Nashwah Jabbar Kadhim Muttwaqi: conceptualization, visualization, methodology, writing – original draft, software. Reza Safaralizadeh: writing – review & editing, visualization, supervision, conceptualization. Mohammadali Hosseinpour Feizi: writing – review & editing, and methodology. Ali Rajabi: conceptualization, methodology, formal analysis, writing – review & editing.

Funding

No funding was received for this manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

Acknowledgments

The authors have nothing to report.

Hagholshahri, Nima , Muttwaqi, Nashwah Jabbar Kadhim , Safaralizadeh, Reza , Hosseinpour Feizi, Mohammadali , Rajabi, Ali , Overexpression of lncRNA ATP11A‐AS1 in Colorectal Cancer and Its Association With H. pylori Infection, International Journal of Genomics, 2026, 9351063, 7 pages, 2026. 10.1155/ijog/9351063

Academic Editor: Lin Qi

Contributor Information

Reza Safaralizadeh, Email: safaralizadeh@tabrizu.ac.ir.

Ali Rajabi, Email: a.rajabi@tabrizu.ac.ir, Email: a.rajabi118@gmail.com.

Lin Qi, Email: qi.lin@csu.edu.cn.

Data Availability Statement

The data that support the findings of this study are available from the corresponding authors upon reasonable request.

References

  • 1. Bray F., Laversanne M., Sung H., Ferlay J., Siegel R. L., Soerjomataram I., and Jemal A., Global Cancer Statistics 2022: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries, CA: A Cancer Journal for Clinicians. (2024) 74, no. 3, 229–263, 10.3322/caac.21834, 38572751. [DOI] [PubMed] [Google Scholar]
  • 2. Dekker E., Tanis P. J., Vleugels J. L. A., Kasi P. M., and Wallace M. B., Colorectal Cancer, Lancet. (2019) 394, no. 10207, 1467–1480, 10.1016/S0140-6736(19)32319-0. [DOI] [PubMed] [Google Scholar]
  • 3. Siegel R. L., Miller K. D., Fedewa S. A., Ahnen D. J., Meester R. G. S., Barzi A., and Jemal A., Colorectal Cancer Statistics, 2017, CA: A Cancer Journal for Clinicians. (2017) 67, no. 3, 177–193, 10.3322/caac.21395, 28248415. [DOI] [PubMed] [Google Scholar]
  • 4. Patel S. G., Karlitz J. J., Yen T., Lieu C. H., and Boland C. R., The Rising Tide of Early-Onset Colorectal Cancer: A Comprehensive Review of Epidemiology, Clinical Features, Biology, Risk Factors, Prevention, and Early Detection, Lancet Gastroenterology & Hepatology. (2022) 7, no. 3, 262–274, 10.1016/S2468-1253(21)00426-X, 35090605. [DOI] [PubMed] [Google Scholar]
  • 5. Shah S. C., Camargo M. C., Lamm M., Bustamante R., Roumie C. L., Wilson O., Halvorson A. E., Greevy R., Liu L., Gupta S., and Demb J., Impact of Helicobacter pylori Infection and Treatment on Colorectal Cancer in a Large, Nationwide Cohort, Journal of Clinical Oncology. (2024) 42, no. 16, 1881–1889, 10.1200/JCO.23.00703, 38427927. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Ralser A., Dietl A., Jarosch S., Engelsberger V., Wanisch A., Janssen K. P., Middelhoff M., Vieth M., Quante M., Haller D., Busch D. H., Deng L., Mejías-Luque R., and Gerhard M., Helicobacter pylori Promotes Colorectal Carcinogenesis by Deregulating Intestinal Immunity and Inducing a Mucus-Degrading Microbiota Signature, Gut. (2023) 72, no. 7, 1258–1270, 10.1136/gutjnl-2022-328075, 37015754. [DOI] [PubMed] [Google Scholar]
  • 7. Sninsky J. A., Shore B. M., Lupu G. V., and Crockett S. D., Risk Factors for Colorectal Polyps and Cancer, Gastrointestinal endoscopy clinics of North America. (2022) 32, no. 2, 195–213, 10.1016/j.giec.2021.12.008. [DOI] [PubMed] [Google Scholar]
  • 8. Yu G. H., Li S. F., Wei R., and Jiang Z., Diabetes and Colorectal Cancer Risk: Clinical and Therapeutic Implications, Journal of Diabetes Research. (2022) 2022, 1747326, 10.1155/2022/1747326. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Mahmoud N. N., Colorectal Cancer: Preoperative Evaluation and Staging, Surgical Oncology Clinics. (2022) 31, no. 2, 127–141, 10.1016/j.soc.2021.12.001, 35351269. [DOI] [PubMed] [Google Scholar]
  • 10. Luo C., Cen S., Ding G., and Wu W., Mucinous Colorectal Adenocarcinoma: Clinical Pathology and Treatment Options, Cancer Communications. (2019) 39, no. 1, 10.1186/s40880-019-0361-0, 30922401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Gao Z., Jiang A., Li Z., Zhu L., Mou W., Shen W., Luo P., Tang B., Zhang J., and Lin A., Heterogeneity of Intratumoral Microbiota Within the Tumor Microenvironment and Relationship to Tumor Development, Medical Research. (2025) 1, no. 1, 32–61, 10.1002/mdr2.70006. [DOI] [Google Scholar]
  • 12. Li X., Wang Q., Yuan Q., and Wang L., The Intratumoral Microbiome in Colorectal Cancer: Origins, Microenvironmental Interactions, and New Horizons in Precision Medicine, Frontiers in Immunology. (2026) 17, 1795736, 10.3389/fimmu.2026.1795736, 41836398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Hombach S. and Kretz M., Non-Coding RNAs: Classification, Biology and Functioning, Non-coding RNAs in Colorectal Cancer. (2016) 3–17, 10.1007/978-3-319-42059-2_1. [DOI] [PubMed] [Google Scholar]
  • 14. Tsagakis I., Douka K., Birds I., and Aspden J. L., Long Non-Coding RNAs in Development and Disease: Conservation to Mechanisms, Journal of Pathology. (2020) 250, no. 5, 480–495, 10.1002/path.5405, 32100288. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Bridges M. C., Daulagala A. C., and Kourtidis A., LNCcation: lncRNA localization and Function, Journal of Cell Biology. (2021) 220, no. 2, e202009045, 10.1083/jcb.202009045, 33464299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Karlsson O. and Baccarelli A. A., Environmental Health and Long Non-Coding RNAs, Current Environmental Health Reports. (2016) 3, no. 3, 178–187, 10.1007/s40572-016-0092-1, 27234044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Ghafouri-Fard S., Hussen B. M., Gharebaghi A., Eghtedarian R., and Taheri M., LncRNA Signature in Colorectal Cancer, Pathology-Research and Practice. (2021) 222, 153432, 10.1016/j.prp.2021.153432. [DOI] [PubMed] [Google Scholar]
  • 18. Tang R., Chen J., Tang M., Liao Z., Zhou L., Jiang J., Hu Y., Liao Q. J., Xiong W., Tang Y., and Nie S., LncRNA SLCO4A1-AS1 Predicts Poor Prognosis and Promotes Proliferation and Metastasis via the EGFR/MAPK Pathway in Colorectal Cancer, International Journal of Biological Sciences. (2019) 15, no. 13, 2885–2896, 10.7150/ijbs.38041, 31853225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Ota T., Suzuki Y., Nishikawa T., Otsuki T., Sugiyama T., Irie R., Wakamatsu A., Hayashi K., Sato H., Nagai K., Kimura K., Makita H., Sekine M., Obayashi M., Nishi T., Shibahara T., Tanaka T., Ishii S., Yamamoto J. I., Saito K., Kawai Y., Isono Y., Nakamura Y., Nagahari K., Murakami K., Yasuda T., Iwayanagi T., Wagatsuma M., Shiratori A., Sudo H., Hosoiri T., Kaku Y., Kodaira H., Kondo H., Sugawara M., Takahashi M., Kanda K., Yokoi T., Furuya T., Kikkawa E., Omura Y., Abe K., Kamihara K., Katsuta N., Sato K., Tanikawa M., Yamazaki M., Ninomiya K., Ishibashi T., Yamashita H., Murakawa K., Fujimori K., Tanai H., Kimata M., Watanabe M., Hiraoka S., Chiba Y., Ishida S., Ono Y., Takiguchi S., Watanabe S., Yosida M., Hotuta T., Kusano J., Kanehori K., Takahashi-Fujii A., Hara H., Tanase T. O., Nomura Y., Togiya S., Komai F., Hara R., Takeuchi K., Arita M., Imose N., Musashino K., Yuuki H., Oshima A., Sasaki N., Aotsuka S., Yoshikawa Y., Matsunawa H., Ichihara T., Shiohata N., Sano S., Moriya S., Momiyama H., Satoh N., Takami S., Terashima Y., Suzuki O., Nakagawa S., Senoh A., Mizoguchi H., Goto Y., Shimizu F., Wakebe H., Hishigaki H., Watanabe T., Sugiyama A., Takemoto M., Kawakami B., Yamazaki M., Watanabe K., Kumagai A., Itakura S., Fukuzumi Y., Fujimori Y., Komiyama M., Tashiro H., Tanigami A., Fujiwara T., Ono T., Yamada K., Fujii Y., Ozaki K., Hirao M., Ohmori Y., Kawabata A., Hikiji T., Kobatake N., Inagaki H., Ikema Y., Okamoto S., Okitani R., Kawakami T., Noguchi S., Itoh T., Shigeta K., Senba T., Matsumura K., Nakajima Y., Mizuno T., Morinaga M., Sasaki M., Togashi T., Oyama M., Hata H., Watanabe M., Komatsu T., Mizushima-Sugano J., Satoh T., Shirai Y., Takahashi Y., Nakagawa K., Okumura K., Nagase T., Nomura N., Kikuchi H., Masuho Y., Yamashita R., Nakai K., Yada T., Nakamura Y., Ohara O., Isogai T., and Sugano S., Complete Sequencing and Characterization of 21, 243 Full-Length Human cDNAs, Nature Genetics. (2004) 36, no. 1, 40–45, 10.1038/ng1285, 14702039. [DOI] [PubMed] [Google Scholar]
  • 20. van der Mark V. A., Ghiboub M., Marsman C., Zhao J., van Dijk R., Hiralall J. K., Ho-Mok K. S., Castricum Z., de Jonge W. J., Oude Elferink R. P. J., and Paulusma C. C., Phospholipid Flippases Attenuate LPS-Induced TLR4 Signaling by Mediating Endocytic Retrieval of Toll-Like Receptor 4, Cellular and Molecular Life Sciences. (2017) 74, no. 4, 715–730, 10.1007/s00018-016-2360-5, 27628304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Miyoshi N., Ishii H., Mimori K., Tanaka F., Nagai K., Uemura M., Sekimoto M., Doki Y., and Mori M., ATP11A Is a Novel Predictive Marker for Metachronous Metastasis of Colorectal Cancer, Oncology Reports. (2010) 23, no. 2, 505–510, 20043114. [PubMed] [Google Scholar]
  • 22. Wang W., Lyu C., Wang F., Wang C., Wu F., Li X., and Gan S., Identification of Potential Signatures and Their Functions for Acute Lymphoblastic Leukemia: A Study Based on the Cancer Genome Atlas, Frontiers in Genetics. (2021) 12, 656042, 10.3389/fgene.2021.656042, 34295352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Wang W. J., Li H. T., Yu J. P., Han X. P., Xu Z. P., Li Y. M., Jiao Z. Y., and Liu H. B., A Competing Endogenous RNA Network Reveals Novel Potential lncRNA, miRNA, and mRNA Biomarkers in the Prognosis of Human Colon Adenocarcinoma, Journal of Surgical Research. (2019) 235, 22–33, 10.1016/j.jss.2018.09.053, 30691798. [DOI] [PubMed] [Google Scholar]
  • 24. Chen K., Collins G., Wang H., and Toh J. W. T., Pathological Features and Prognostication in Colorectal Cancer, Current Oncology. (2021) 28, no. 6, 5356–5383, 10.3390/curroncol28060447, 34940086. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Rutter M. D., Beintaris I., Valori R., Chiu H. M., Corley D. A., Cuatrecasas M., Dekker E., Forsberg A., Gore-Booth J., Haug U., Kaminski M. F., Matsuda T., Meijer G. A., Morris E., Plumb A. A., Rabeneck L., Robertson D. J., Schoen R. E., Singh H., Tinmouth J., Young G. P., and Sanduleanu S., World Endoscopy Organization Consensus Statements on Post-Colonoscopy and Post-Imaging Colorectal Cancer, Gastroenterology. (2018) 155, no. 3, 909–925.e3, 10.1053/j.gastro.2018.05.038, 29958856. [DOI] [PubMed] [Google Scholar]
  • 26. Yan H. and Bu P., Non-Coding RNA in Cancer, Essays In Biochemistry. (2021) 65, no. 4, 625–639, 10.1042/EBC20200032, 33860799. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Mattick J. S., Amaral P. P., Carninci P., Carpenter S., Chang H. Y., Chen L. L., Chen R., Dean C., Dinger M. E., Fitzgerald K. A., Gingeras T. R., Guttman M., Hirose T., Huarte M., Johnson R., Kanduri C., Kapranov P., Lawrence J. B., Lee J. T., Mendell J. T., Mercer T. R., Moore K. J., Nakagawa S., Rinn J. L., Spector D. L., Ulitsky I., Wan Y., Wilusz J. E., and Wu M., Long Non-Coding RNAs: Definitions, Functions, Challenges and Recommendations, Nature Reviews Molecular Cell Biology. (2023) 24, no. 6, 430–447, 10.1038/s41580-022-00566-8, 36596869. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Ghasemzadeh T., Rajabi A., Malek Abbaslou E., Najari P., Akbarzadeh S., Tayefeh-Gholami S., Teimourian S., Hosseinpourfeizi M., and Safaralizadeh R., Evaluation of the Expression of the Long Non-Coding RNAs, LOWEG and MINCR, and Their Clinical Significance in Human Gastric Cancer, Egyptian Journal of Medical Human Genetics. (2023) 24, no. 1, 10.1186/s43042-023-00466-2. [DOI] [Google Scholar]
  • 29. Sadi Khosroshahi N., Koulaeizadeh S., Abdi A., Akbarzadeh S., Hashemi Aghdam S. M., Rajabi A., and Safaralizadeh R., Upregulation of Long Noncoding RNA PCAT1 in Iranian Patients With Colorectal Cancer and Its Performance as a Potential Diagnostic Biomarker, Genetic Testing and Molecular Biomarkers. (2024) 28, no. 2, 65–69, 10.1089/gtmb.2023.0676, 38416663. [DOI] [PubMed] [Google Scholar]
  • 30. Cui W., Wang Y., Shen X., Wu X., Liu H., and Xu X., High-Expression of Lnc RNA MAFG-AS1 Is Associated With the Prognostic of Patients With Colorectal Cancer, Revista da Associação Médica Brasileira. (2020) 66, no. 11, 1530–1535. [DOI] [PubMed] [Google Scholar]
  • 31. Collins D., Hogan A. M., and Winter D. C., Microbial and Viral Pathogens in Colorectal Cancer, Lancet Oncology. (2011) 12, no. 5, 504–512. [DOI] [PubMed] [Google Scholar]
  • 32. Guo C.-G., Zhang F., Jiang F., Wang L., Chen Y., Zhang W., Zhou A., Zhang S., and Leung W. K., Long-Term Effect of Helicobacter pylori Eradication on Colorectal Cancer Incidences, Therapeutic Advances in Gastroenterology. (2023) 16, 17562848231170943, 10.1177/17562848231170943, 37168403. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Rebersek M., Gut Microbiome and Its Role in Colorectal Cancer, BMC Cancer. (2021) 21, no. 1, 10.1186/s12885-021-09054-2, 34895176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Lin A., Xiong M., Jiang A., Huang L., Wong H. Z. H., Feng S., Zhang C., Li Y., Chen L., Chi H., Zhang P., Ye B., Zhang H., Zhang N., Zhu L., Mou W., Shen J., Li K., Xu W., Ying H., Zhang C., Zeng D., Xie J., Deng X., Wang Q., Xu J., Shi W., Qi C., Qu C., Huang X., Hajdu A., Li C., Peng C., Cao X., Pei G., Zhang L., Huo Y., Xu J., Glaviano A., Szöllősi A. G., Bian S., Li Z., Tang H., Tang B., Liu Z., Zhang J., Miao K., Cheng Q., Wei T., Yuan S., and Luo P., The Microbiome in Cancer, iMeta. (2025) 4, no. 5, e70070, 10.1002/imt2.70070, 41112042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Herlo L.-F., Salcudean A., Sirli R., Iurciuc S., Herlo A., Nelson-Twakor A., Alexandrescu L., and Dumache R., Gut Microbiota Signatures in Colorectal Cancer as a Potential Diagnostic Biomarker in the Future: A Systematic Review, International Journal of Molecular Sciences. (2024) 25, no. 14, 10.3390/ijms25147937, 39063179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Liu Y., Yang D. Q., Jiang J. N., and Jiao Y., Relationship Between Helicobacter pylori Infection and Colorectal Polyp/Colorectal Cancer, World Journal of Gastrointestinal Surgery. (2024) 16, no. 4, 1008–1016, 10.4240/wjgs.v16.i4.1008, 38690050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Engelsberger V., Gerhard M., and Mejías-Luque R., Effects of Helicobacter pylori Infection on Intestinal Microbiota, Immunity and Colorectal Cancer Risk, Frontiers in Cellular and Infection Microbiology. (2024) 14, 1339750, 10.3389/fcimb.2024.1339750, 38343887. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Kuo Y.-C., Ko H.-J., Yu L.-Y., Shih S.-C., Wang H.-Y., Lin Y.-C., and Hu K.-C., Kill Two Birds With One Stone? The Effect of Helicobacter pylori Eradication in Decreased Prevalence of Gastric Cancer and Colorectal Cancer, Cancers. (2024) 16, no. 22, 10.3390/cancers16223881, 39594836. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available from the corresponding authors upon reasonable request.


Articles from International Journal of Genomics are provided here courtesy of Wiley

RESOURCES