The coexistence of Lactiplantibacillus and Wickerhamomyces in sugarcane top silage drives potential pathogen suppression and aerobic stability through enhanced lactic acid and acetic acid production

Abstract

To identify the key coexisting bacteria and yeast in sugarcane top silage that determine fermentation quality and improve feed safety, we manipulated the epiphytic microbiota of sugarcane tops by selectively inhibiting yeasts (AF) or lactic acid bacteria (AB) before re-ensiling, using untreated (CK) and γ‑ray sterilized silages (NA) as controls. The results shows that high-yield production of lactic acid and acetic acid (p < 0.05), better aerobic stability, and high Lactiplantibacillus abundance (p < 0.05) can be achieved in both AF and CK groups. Particularly, compared to CK and NA groups, the re-establishment of Wickerhamomyces and its coexistence with the Lactiplantibacillus in AF group not only further promotes the accumulation of lactic acid and acetic acid (p < 0.05), but reduces the BugBase-predicted potentially pathogens abundance during ensiling. Notably, Wickerhamomyces is associate with lactic and acetic acid production and BugBase-predicted potentially pathogens abundance reduction in both AF and CK groups. Conversely, sole Wickerhamomyces presence in AB group, leads to ethanol accumulation (p < 0.05), decreased aerobic stability, and increased BugBase-predicted potentially pathogens abundance after aerobic exposure. Moreover, the γ-hemolytic and metabolically versatile strains Wickerhamomyces anomalus G32-15 and Lactiplantibacillus plantarum G35, isolated from the well-preserved sugarcane top silage, increased the yield of lactic acid and acetic acid by co-fermenting orange peel, dragon fruit peel, and mango peel waste, respectively (p < 0.05). This study identified and isolated key coexisting microorganisms associated with improved fermentation quality and safety of sugarcane top silage, and provides an innovative strategy for developing microbial agents to regulate silage quality.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12866-026-05159-5.

Introduction

Silage is the most prevalent feed in animal husbandry, primarily for ruminants such as cattle and sheep. Fermentation quality and aerobic stability of silage directly affect the nutritional value of the feed and animal performance [1, 2]. Notably, these key parameters of silage are governed by the microbial community structure and the biochemical processes driven by its metabolic activities during ensiling (such as the generation of organic acids) [3, 4]. However, despite years of development in silage, challenges remain, particularly in the management of microbial contamination [1, 5]. Among them, potential pathogens in silage, such as Enterobacteriaceae, not only lead to nutrient losses of silage, but produce toxins that threaten animal safety [4, 6]. While, when silage is exposed to aerobic conditions, it is more susceptible to microbial contamination, including the rapid resurgence and activity of aerobic microorganisms (such as yeast and mold), which can lead to aerobic deterioration, resulting in decreased nutritional value and accumulation of mycotoxins [3]. Studies have shown that the accumulation of organic acids such as lactic acid (LA) and acetic acid (AA) in silage can improve fermentation quality, inhibit pathogenic bacteria, and promote aerobic stability [5, 7].

Lactic acid bacteria (LAB) as core initiators, mainly fermenting sugar substrates to produce LA and AA in silage [8]. Yeasts, in contrast, are often considered undesirable under aerobic or poorly sealed conditions, where they consume organic acids, increase pH, and cause spoilage [2]. However, under strictly anaerobic and well-managed ensiling conditions, certain yeast species can exert beneficial effects. For example, some yeasts (e.g., Saccharomyces and Wickerhamomyces) can produce various antimicrobial compounds, including killer toxins (proteinaceous toxins active against spoilage fungi and bacteria), siderophores (which chelate iron and limit pathogen growth), and organic acids (e.g., succinic and malic acid) that directly lower pH and inhibit pathogens such as Aspergillus [9–12]. Others, when certain yeasts (e.g., Saccharomyces cerevisiae, Pichia anomala) are co‑inoculated with LAB (e.g., Lactobacillus spp., Leuconostoc citreum), these yeasts enhance LA and AA accumulation by promoting LAB growth through synergistic effects (e.g., supplying amino acids and vitamins) [13–16], reduce the mold counts [13], and extend the aerobic preservation time of silage [17]. This suggests that the accumulation of organic acids, improved aerobic stability, and inhibition of pathogenic microorganisms in silage can be achieved through the colonization and coexistence of LAB and yeast.

As a major byproduct accounting for about 20% of sugarcane's total output, sugarcane tops have an estimated annual production of around 20 million tons in China, primarily concentrated in Guangxi, China [18]. While the high-WSC content of sugarcane tops promotes LAB enrichment (e.g., Lactiplantibacillus), the concomitant proliferation of yeasts compromises silage quality (e.g., butyric acid accumulation) and aerobic stability (e.g., proliferation of undesirable aerobic microorganisms such as Enterobacter) [19]. Previous studies have also shown that the LAB and yeast were also consistently present in well-preserved or poor sugarcane top silage under all tested conditions, including ensiling time [20], nitrogen application levels and varieties [21]. However, the key coexisting yeasts and LAB that determine the quality of sugarcane top silage have not yet been identified. Specifically, two key knowledge gaps still exist: (i) which specific species of LAB and yeasts coexist as the core functional microbiota in sugarcane top silage? and (ii) whether these yeasts mainly play a spoilage role or can positively contribute to fermentation quality and pathogen inhibition? So, the present study aimed to reveal and isolate the key coexisting LAB and yeasts that determine the fermentation quality and safety of sugarcane top silage, and offering innovative microbial agent strategies for developing next-generation silage additives.

Materials and methods

Raw materials and ensiling

Sugarcane tops (Sugarcane variety: Zhongzhe Funong No. 48) were collected from the forage breeding ground of Fusui Experimental Base of Guangxi University. The collection of sugarcane tops was authorized by the College of Life Sciences and Technology, Guangxi University. The chemical compositions of the fresh sugarcane tops are listed in Table S1. Fresh sugarcane tops were chopped to a length of approximately 2 cm with a forage cutter (model zfd5570, Zheng Feng Machinery Company, Jining, China).

According to the methods of Mogodiniyai Kasmaei et al. [22], 30 kg fresh sugarcane tops was added to 120 L of Ringer’s solution, mixing and standing for 30 min at room temperature; Then, after thorough stirring, the mixture was filtered through four layers of gauze to obtain a microbial suspension; Microbial suspension was centrifuged at 15 500 × g for 90 min (AVANTIJ-E, Beckman, USA); Discard the supernatant, resuspension in physiological saline to 90 mL, divide into two equal portions, and store at 4 °C for later use.

The treatment in this study were as is shown in the Table 1. Specifically, following the method described by Malek et al. [23], fresh sugarcane tops were sterilized at a total dose of 30 kGy (exposure time: 210 min) from a ⁶⁰Co source at Guangxi Nanxiang Environmental Protection Co., Ltd., Nanning, China. For the antimicrobial treatment, 45 mL of the resuspended epiphytic suspension was mixed with 6.75 g of antifungal agent or antibacterial agent, homogenized and allowed to stand for 5 min, after which the mixture was evenly sprayed onto the γ‑sterilized sugarcane tops at an application rate of 15 mL per kg of fresh weight.

Table 1.

The treatment groups in this study

Treatment	Abbreviation	Description
Untreated silage	CK	Fresh sugarcane tops ensiled directly (natural epiphytic microbiota)
γ-ray sterilized control	NA	γ‑sterilized sugarcane tops without reinoculation
Antifungal treatment	AF	γ-sterilized sugarcane tops + reinoculated with antifungal-pretreated suspension (15 mL/kg)
Antibacterial treatment	AB	γ-sterilized + reinoculated with antibacterial-pretreated suspension (15 mL/kg)

The antibacterial agent mainly consists of penicillin streptomycin, penicillin G sodium salt, cefotaxime, tetracycline hydrochloride, and ciprofloxacin in a 1:1:1:1 ratio, all purchased from Solarbio Lifesciences, Beijing, China. The antifungal agent mainly consists of natamycin, fluconazole, itraconazole, and voriconazole in a 1:1:1:1 ratio, all purchased from Solarbio Lifesciences, Beijing, China. The selection of antibiotics and antifungal agents was based on their known selective inhibitory effects: penicillin and streptomycin inhibit bacterial cell wall synthesis and protein synthesis, respectively [24, 25]; cefotaxime, tetracycline and ciprofloxacin provide broad‑spectrum coverage against Gram‑negative bacteria and potential resistant strains [25]; natamycin inhibits fungal growth via ergosterol‑dependent inhibition of membrane transport proteins [26]; fluconazole, itraconazole and voriconazole inhibit ergosterol biosynthesis via 14α‑sterol demethylase [27]. Preliminary experiments indicated that adding the antibacterial agent and antifungal agent to the microbial suspension at the provided dosage resulted in not detected epiphytic lactic acid bacteria (LAB) and yeast using typical microbial culture, respectively. Also, no countable microorganisms were detected after γ-irradiation. After mixing, 200 g of fresh material was packaged in polyethylene bags (200 mm × 250 mm; Shijiazhuang Xilong Packaging Co., Ltd., Shijiazhuang, China) and vacuum-sealed using a vacuum sealer (Model 680; Fujian Anxi Anshengke Machinery Co., Ltd., Quanzhou, China). Each treatment was prepared in triplicate. The bags were then stored at ambient temperature (10–35 °C, which reflects the actual natural conditions of Guangxi, China) for 3, 7, 12, 30, and 60 days. Ambient temperature was continuously monitored using a data logger (RC-5 +, Jingchuang Co., Ltd. Shanghai, China). After the ensiling period, the bags were opened and samples were collected for analysis of aerobic stability, fermentation quality, microbial counts, and microbial community structure.

Aerobic stability test

The aerobic stability of sugarcane top silage was determined following the method described by Nishino and Touno [28], with some modifications. Briefly, a 100-g silage sample from each treatment was taken and placed into a 500-mL plastic bottle. Simultaneously, a temperature data logger (RC-5 +, Jingchuang Co., Ltd. Shanghai, China) programmed to record every 2 h, was inserted. The plastic bottle was then covered with a layer of gauze (To reduce cross-contamination of the silage and ensure air circulation) and stored at ambient temperature (10–35 °C) for 8 days. After 8 days of aerobic exposure, 20 g of silage sample were taken for the determination of fermentation parameters, microbial counts, and microbial community structure.

Chemical composition, fermentation profile, and microbial population analysis

A 20-g fresh silage sample was combined with 180 mL of Ringer's solution and mixed thoroughly. After standing for 30 min at 4 °C, the mixture was filtered through a double-layer gauze. The collected filtrate was then used for the determination of fermentation parameters and microbial counts. The pH of the filtrate was measured directly using a pH meter (Mettler-Toledo Delta 320; Mettler-Toledo, Greifensee, Switzerland). A 10 mL of filtrate were centrifuged (12 000 × g, 15 min, 4 °C), and the supernatant was used to determine ethanol, organic acids [lactic acid (LA), acetic acid (AA), propionic acid (PA), butyric acid (BA)], and ammonia nitrogen (AN). LA and AN content were determined according to Zhang et al. [20], using the p-hydroxybiphenyl and phenol–hypochlorite reaction methods, respectively. The contents of AA, PA, BA, and ethanol were determined by gas chromatography (GC) according to Erwin et al. [29]. Analysis was performed on an Agilent 7890 A system (Agilent Technologies, CA, USA) equipped with a flame ionization detector and an HP-INNOWax column (19091N-213; 30.0 m × 320 μm × 0.5 μm). The injection volume was 1 μL with a split ratio of 10:1.

For microbial counts, filtrates (1 mL) were serially diluted (10^–1 to 10^–6) according to Gu et al. [19]. LAB were quantified on De Man, Rogosa, and Sharpe agar (MRS, Beijing Land Bridge Technology, Beijing, China) under anaerobic incubation at 35 °C for 48 h. Yeasts and molds were grown on potato dextrose agar (PDA, Beijing Land Bridge Technology, Beijing, China) at 25 °C for 72 h, and Enterobacteriaceae (EB) on violet red bile agar (Beijing Land Bridge Technology, Beijing, China) at 37 °C for 48 h.

DNA extraction and PCR amplification

Microbial DNA was extracted from silage samples using the E.Z.N.A.® Soil DNA Kit (Omega Bio-tek, Norcross, USA) according to manufacturer’s protocols. The extracted microbial DNA was sent to Shanghai Biozeron Biological Technology Co., Ltd. (Shanghai, China) for 16S RNA and ITS1 gene amplicon sequencing on a NovaSeq 6000 platform. Amplification sequencing of bacterial 16S RNA was performed using primers 341 F (5′-CCTAYGGGRBGCASCAG-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′). Amplification of fungal ITS1 was performed using primers ITS5-1737F (5′-GGAAGTAAAAGTCGTAACAAGG-3′) and ITS2-2043R (5′-GCTGCGTTCTTCATCGATGC-3′). Amplicons were extracted from 2% agarose gels and purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, USA) according to the manufacturer’s instructions. Purified polymerase chain reaction (PCR) products were quantified by Qubit®3.0 (Life Technologies Corporation, Carlsbad, USA) and every twenty-four amplicons whose barcodes were different were mixed equally. The pooled DNA product was used to construct Illumina Pair-End library following Illumina’s genomic DNA library preparation procedure.

Raw FASTQ files were demultiplexed using Trimmomatic [30] and custom Perl scripts based on barcode sequences with the following criteria: (i) 300 bp reads were trimmed using a 10 bp sliding window (average quality < 20); reads < 50 bp were discarded. (ii) Exact barcode matches and ≤ 2 mismatches in primers were allowed; reads with ambiguous bases were removed. (iii) Reads with > 10 bp overlap were assembled; unassembled reads were discarded. The sequencing depth have shown in Table S2. OTUs were clustered with 97% similarity cutoff using UPARSE (version 10, http://drive5.com/uparse/) [31] and chimeric sequences were identified and removed using UCHIME. OTU clustering at 97% similarity was chosen to maintain comparability with our previous studies on sugarcane top silage, and because our research focuses on genus level community shifts and BugBase phenotypes, where OTU and ASV results are highly consistent [32–34]. Analysis of the alpha diversity (Shannon index) for bacterial and fungal communities was performed with QIIME 2 (v2024.10) based on the sequencing data. The SILVA database (http://www.arb-silva.de/) and the UNITE database (https://unite.ut.ee/) were used to annotate bacterial and fungal sequencing data, respectively, with a confidence threshold of 0.8 [35], thereby obtaining taxonomic information and calculating the community composition of each sample at each taxonomic level. BugBase algorithm (https://bugbase.cs.umn.edu/index.html) was used to predict the phenotypes of bacterial communities.

LAB and yeast isolation, identification

After microbial counting, LAB and yeast were screened in sugarcane top silage of CK and AF groups based on colony size, color, and shape respectively. Continuous subculturing was performed on MRS and PDA plates until pure colonies were established. Then, Gram staining and methylene blue staining were used to examine the macroscopic colony morphology and microscopic cellular characteristics of the obtained pure LAB and yeast, respectively. For molecular identification, LAB and yeast DNA extraction was performed using bacterial DNA kit (Tiangen Biotech Co. Ltd., Beijing, China) and yeast genome extraction kit (Solarbio Lifesciences, Beijing, China), according to the manufacturer’s instructions, respectively. Subsequently, the 16S rDNA of LAB was amplified by the PCR with primers were 27 F (5’AGAGTTTGATCCTGGCTCAG3′) and 1492R (5’GTTTACCTTGTTACGACTT 3′). The ITS region of yeast was amplified using the primer pair ITS1-(5′ TCCGTAGGTGAACCTGCGG 3′) and ITS4-(5′ TCCTCCGCTTATTGATATGC 3′). The 16S rRNA and ITS sequences were aligned with those in the GenBank database for species identification via the NCBI BLAST analysis [36]. Phylogenetic trees were constructed using the neighbor-joining method in MEGA 12 software (V12.1.1) to perform molecular evolutionary analysis on the identified LAB and yeast strains.

Haemolytic activity of the LAB and yeast isolates was evaluated according to Mangia et al. [37] and made some modification. Specifically, the isolated bacteria and yeast were passaged three times in MRS (Beijing Land Bridge Technology, Beijing, China) and PDB (Potato Dextrose Broth, Beijing Land Bridge Technology, Beijing, China) liquid media, respectively. The third-generation cultures were centrifuged at 4000 rpm for 10 min, the supernatant was discarded, while the cells precipitation was washed three times with sterile physiological saline, and centrifuge again. Then, the LAB and yeast suspension were prepared by adding sterile physiological saline and normalized to 1.0 McFarland (570 nm; 3 × 10⁸ CFU/mL), respectively. 10 μL of the LAB and yeast suspension was spotted onto blood agar plates containing 5% (v/v) sheep blood (Solarbio Lifesciences, Beijing, China). The LAB were anaerobically cultured at 37 °C for 48 h, and the yeast was cultured at 30 °C for 72 h. Hemolysis was then observed on the plates to determine whether complete hemolysis, β-hemolysis (a clear halo around each colony), α-hemolysis (a green halo around each colony), or γ-hemolysis (no halo around each colony) occurred. The utilization of carbon sources such as glucose, lactose, maltose, mannitol, sucrose, arabinose, xylose, sorbitol, rhamnose, salicin, aescin, muscarin, raffinose, fructose, melibiose, cellobiose, starch, and galactose by the yeast and LAB strains was determined using microbial chemical reaction tubes (Hangzhou Binhe Microbial Reagent Co., Ltd., Hangzhou, China).

To evaluate the organic acid‑producing ability and metabolic flexibility of the isolated LAB (Lactiplantibacillus) and yeast (Wickerhamomyces) strains on diverse carbon sources, a co‑fermentation experiment was conducted using three fruit peels (orange, dragon fruit, mango). For each substrate, 36 g of crushed peel waste was placed in a 250 mL Erlenmeyer flask with 12 mL molasses and 120 mL sterile water. Then, 1% sterile saline and a 1:1 compound microbial agent consisting of the isolated LAB Lactiplantibacillus and the yeast Wickerhamomyces (based on fresh weight) was added. The mixture was incubated anaerobically at 25 °C for 7 days (four replicates per treatment), after which 2 mL samples were taken to measure LA and AA content. Efficient LA/AA production from these three distinct carbon sources confirmed the robustness of the strains, directly supporting their application in sugarcane top silage for improved fermentation quality.

Statistical analysis

Statistical analyses were performed using SPSS 19.0 (SPSS, Chicago, Illinois, USA). A general linear model (GLM) was used for two-way analysis of variance on ensiling times, additives, and their interaction on microbial counts and fermentation quality of the sugarcane tops silage. One-way analysis of variance (ANOVA) was performed on the microbial population and fermentation quality of the sugarcane tops silage after aerobic exposure and the LA and AA content in fruit peel waste fermentation substrate.

Due to the small sample size (n = 3 per treatment) and the non-normal distribution of microbial relative abundance data, non-parametric tests were used: the Wilcoxon rank-sum test for pairwise comparisons, and LEfSe (Linear discriminant analysis Effect Size) with the Kruskal‑Wallis test followed by Linear Discriminant Analysis (LDA) for differential abundance analysis. LEfSe analyses were performed using LEfSe software (version 1.0). The Spearman’s correlation coefficients were assessed to determine the relationships between biomarker microorganisms and fermentation parameters and predictive function in silage in the R (v4.0.3). Statistical significance was set at P < 0.05.

Results and discussion

Microbial counts and fermentation quality of sugarcane tops silage

The dynamic changes of countable microorganisms during sugarcane tops silage fermentation are shown in Fig. 1A-C (Table S3). LAB produce LA under anaerobic conditions by using WSC, which lowers the pH and thus effectively inhibits the growth of harmful microorganisms [8]. In AB group, the LAB counts were lower than 5 log CFU/g of FM during 3–60 days of ensiling (Fig. 1A). However, when LAB counts were below 5 log CFU/g of FM, silage is likely to fail (e.g., the proliferation of harmful microorganisms) [38, 39]. So, during the 3–60 days of ensiling, the yeasts and molds counts remained the highest in AB group (P < 0.05, Fig. 1B, C). Moreover, during 3–60 days of ensiling, the LAB counts in both the CK and AF groups reached its maximum on day 30 (Fig. 1A). Based on this observation, we hypothesize that inhibiting yeasts in the epiphytic microbiota may not delay the time required for LAB to reach a stable growth stage in sugarcane top silage under the conditions tested. Further experiments are needed to test this hypothesis. But, on 30 and 60 days of ensiling, the LAB counts were significantly highest in AF group (P ≤ 0.01, Fig. 1A). A possible reason is that in the later stages of silage, the number of microorganisms competing with LAB for sugar substrates decreases. Our study confirmed this result, the fungi (yeasts and mold) counts were significantly lowest in AF group during 30–60 days of ensiling (P < 0.05, Fig. 1C, D).

Fig. 1.

Fermentation quality of sugarcane tops silage. Typical plate count method for counting LAB (A), yeast (B), and molds (C); The content of pH (D), LA (E), AN (F), AA (G), BA (H), and ethanol (I) in silage during ensiling; Temperature in 60-days silage was continuously recorded for 192 h during 8 days of aerobic exposure (J); The counts of LAB, EB, yeast, and molds in silage on day 8 of aerobic exposure (K); The fermentation parameters (including pH, LA and AN) of silage on day 8 of aerobic exposure (L); The contents of volatile organic compounds (including AA, PA, and BA) and ethanol in silage on day 8 of aerobic exposure (M). LAB, lactic acid bacteria; LA, lactic acid; AA, acetic acid; BA, butyric acid; AN ammonia nitrogen. CK, untreated silage; AB, silage with epiphytic microorganisms after addition of antibacterial agent; AF, silage with epiphytic microorganisms after addition of antifungal agent; NA, silage withγ-sterilized. Statistical significance (P < 0.05) among the treatments according to two-way ANOVA and HSD test at the 5% level (n = 3, biologically independent samples). ^a−cDifferent lowercase letters between groups indicate significant differences

The dynamic changes of fermentation parameter during sugarcane tops silage fermentation are shown in the Fig. 1D-I (Table S4). Silage pH is a key indicator of silage quality, and when the pH value reaches 4.5 or below, the fermentation quality of silage is considered good [40]. In this study, only found in AF and CK groups, the pH was significantly decreased to below 4.5 during 3–60 days of ensiling (P < 0.05, Fig. 1D). This result is also reported in previous study on sugarcane top silage [41]. This is because abundant LAB present in silage dominate the fermentation process (Fig. 1A). Meanwhile, the LA content was significantly increased in AF and CK groups during 3–60 days of ensiling (P < 0.05, Fig. 1E). This is mainly related to the continuous reproduction of LAB during ensiling (Fig. 1A). Similarly, the AF group had a higher number of LAB after 30 and 60 days of ensiling (Fig. 1A), resulting in the highest LA content at these time points (P < 0.05, Fig. 1E). AN reflects protein decomposition during ensiling, driven by plant proteases (early) and proteolytic microorganisms (e.g., clostridia) under suboptimal conditions [42]. LAB can indirectly affect AN by influencing pH decline and suppressing proteolytic bacteria [43]. In the AF group, slower pH decline due to yeast inhibition prolonged plant protease activity and allowed limited clostridial activity, leading to the highest AN content (P < 0.05, Fig. 1F). This is mainly due to that some LAB strain can use AA as the main fermentation product and overcome the inhibitory effect of low pH by producing AN through the arginine deiminase pathway [44]. Exactly, the AA content was highest in AF group during 3–60 days of ensiling (P < 0.05, Fig. 1G). The increase in AA content over ensiling days may be attributed to the proliferation of heterofermentative LAB (e.g., Lactobacillus buchneri), which convert LA and/or sugars into AA [45, 46]. In addition, BA content is only affected by ensiling time, and BA content decreases significantly over time (P < 0.05, Fig. 1H). This is mainly attributed to the fact that BA-producing bacteria have difficulty adapting to the acidic environment as silage is processed [47]. Furthermore, ethanol content was highest in AB group during 3–60 days of ensiling (P < 0.05, Fig. 1I). This is mainly due to that yeast becomes most dominant in silage by inhabiting epiphytic LAB (Fig. 1B), and produces a large amount of ethanol by decomposing sugar substrates [40].

The temperature changes during 8 days of aerobic exposure of 60-day silage are shown in Fig. 1J. Previous study has point out that when the temperature of silage is more than 2 °C higher than the ambient temperature, it is considered to be spoiled [48]. In this study, the AB and NA groups exceeded the ambient temperature by 2 °C after 4 h and 36 h, respectively. This is mainly attributed to the highest pH and lowest LA content in silage (Fig. 1D, E), which makes it difficult to effectively inhibit the growth of microorganisms that cause aerobic deterioration. This is likely because even after aerobic exposure, the LA still accumulates in the silage, which reduces energy conversion efficiency by inhibiting the metabolic activity of other aerobic microorganisms, thereby reducing heat production [49]. Therefore, the CK and AF groups have better aerobic stability. The lowest mold count in AF groups was confirmed this result (P < 0.05, Fig. 1K). Moreover, the LAB and EB counts were highest in CK and AF groups (P < 0.05, Fig. 1K). The presence of LAB is associated with the acidic environment created by LA, while pH > 5.0 is a suitable environment for the reproduction of EB. However, in CK and AF groups, the yeasts count was also highest (P < 0.05, Fig. 1K). The reason may be that residual LA can serve as a nutrient substrate for yeast growth and reproduction under air condition [50]. This may be also due to the higher residual LA content in AF and CK groups (Fig. 1L), the silage pH in the AF and CK groups was significantly lower than that in the other two groups after aerobic exposure (Fig. 1L). Additionally, in our study, the AN content was no more than 0.50 g/kg DM in all sugarcane tops silage on 8 days of aerobic exposure (Fig. 1L). This is mainly related to sugarcane tops, which are low-protein forages. Notably, the AA content was highest in AF group (P < 0.05, Fig. 2F). This is may be due to the yeast can convert organic matter into ethanol, while acetic acid bacteria can oxidize ethanol into AA under air condition [51]. This may also explain why the aerobic retention time was longer in the AF group (Fig. 1J). In contrast, due to the highest yeasts and mold counts under air condition, the highest ethanol content was only found in CK group (P < 0.05, Fig. 1M). A study has shown that under aerobic conditions, molds convert macromolecules such as starch and protein into glucose and amino acids, providing substrates for subsequent alcoholic fermentation by yeast [52].

Fig. 2.

Bacterial community succession with different treatments. Silage bacterial community composition in phylum (A) and genus (B) level; Biomarker bacteria in CK and AB groups after 3 (C), 7 (D), 12 (E), 30 (F), and 60 (G) days of ensiling and 8-day of aerobic exposure (H); Biomarker bacteria in AF and AB groups after 3 (C), 7 (D), 12 (E), 30 (F), and 60 (G) days of ensiling and 8-day of aerobic exposure (H). CK, untreated silage; AB, silage with epiphytic microorganisms after addition of antibacterial agent; AF, silage with epiphytic microorganisms after addition of antifungal agent; NA, silage withγ-sterilized

Bacterial community of sugarcane tops silage

Changes in bacterial communities at the phyla level in sugarcane tops silage, before and after aerobic exposure, are shown in Fig. 2A. In this study, Bacillota and Pseudomonadota were the top 2 bacterial phyla in all sugarcane tops silage whether before or after aerobic exposure. Gu et al. [19] has also reported that Bacillota and Pseudomonadota were the dominant bacterial phyla in sugarcane top silage. Bacillota (especially Lactobacillus) are ideal for dominance in silage because they are major producers of LA; however, Pseudomonadota are a main source of putrefaction-related pathogens and opportunistic pathogens [53]. In this study, Bacillota was first dominant in CK and AF groups, Pseudomonadota was first dominant in AB group. This result also indicates that inhibiting epiphytic LAB, numerous yeasts cannot exert a strong inhibitory effect on the reproduction of harmful bacteria [13–15]. In addition, Bacteroidota primarily function to hydrolyze complex macromolecules (such as plant cell walls) and release enzymes that degrade polysaccharides, thereby improving the digestibility of silage. But, Bacteroidota were the top 3 bacterial phyla in all sugarcane tops silage whether before or after aerobic exposure.

Changes in bacterial communities at the genus level in sugarcane tops silage, before and after aerobic exposure, are shown in Fig. 2B. In this study, Weissella was the first dominant bacteria in CK and AF groups on 3 days and 7 days of ensiling. Weissella was the first dominant bacteria also reported in Italian ryegrass silage after 3 days of ensiling [54]. A species from Weissella (e.g., Weissella cibaria) can undergo heterofermentation to produce AA [55]. In the early stages of ensiling, the high concentration of AA produced in CK and AF groups also confirms this result (Fig. 1G). Same as the results of CK and AF groups in this study, Niu et al. [56] also reported that with pH reduction, acid-tolerant Lactiplantibacillus replaced Weissella during ensiling. It is possible that the inhibition of some epiphytic yeasts reduced substrate competition, thus leading to a faster occurrence of this phenomenon in the AF group compared to the CK group. However, Vibrionimonas was dominant in AB and NA group whether before or after aerobic exposure. Previous study has shown that some strain of Vibrionimonas was isolated during the aerobic spoilage process of tilapia fillets [57]. This might explain why aerobic deterioration was more likely to occur in AB and NA groups (Fig. 1J). In addition, in this study, unlike the CK group where Lactiplantibacillus was the first dominant bacteria, in AF group, Lactiplantibacillus was the second dominant bacteria, accompanied by high abundance of Enterobacter (> 50%) after aerobic exposure. Enterobacter is considered a commonly undesirable bacteria that easily causes spoilage of silage. While, previous study has shown that under aerobic conditions, when high numbers of Enterobacter in silage, it will ferment sugars to produce AA, which inhibits the growth of other aerobic and harmful microorganisms (e.g., mold), thereby improving the aerobic stability of silage [39, 58]. Another possibly reason is that Enterobacter can directly converted LA produced by Lactiplantibacillus to AA [59]. The fact that the AF group had better aerobic stability, higher AA content, and the lowest mold count after aerobic exposure also confirms this result (Fig. 1J, K and M). Enterobacter is traditionally classified as opportunistic pathogens, which can cause infection in animals under certain conditions. But, most members of the Enterobacter genus are non-pathogenic bacteria [60].

To identify the key bacteria in well fermented sugarcane top silage, LEfSe was used to analyze the differences in bacterial taxa of AB and CK (Fig. 2C-H) or AF (Fig. 2I-N) groups before and after aerobic exposure (linear discrimination analysis [LDA] > 4.0). The many undesirable bacteria belong to Enterobacteriaceae (e.g., Enterobacter) were significantly enriched in AB group during ensiling and after aerobic exposure (Fig. 2C-H and I-N). The possible reason is that some strains from the Enterobacteriaceae are not only ethanol-resistant but can also produce high levels of ethanol under certain specific conditions [61]. However, during the 3–60 days of ensiling, the Lactobacillaceae were significantly enriched in CK and AF group (Fig. 2C-G and I-M). The Lactobacillaceae typically predominant in well-fermented silage [62]. The fact that LA fermentation was the dominant process in both CK and AF groups confirms this result during ensiling (Fig. 1D). Moreover, during the 3–60 days of ensiling, the Lactobacillaceae species Lactiplantibacillus and Weissella were also significantly enriched in CK and AF group. Lactiplantibacillus, as a homofermentative LAB, is considered a key species for LA-producing in the later stages of silage [59]. In contrast, as a typical heterofermentative LAB, Weissella is the main microorganism that inhibits harmful microorganisms in the early stages of silage by producing LA. Similarly, the Lactiplantibacillus was significantly enriched in CK and AF group after aerobic exposure. Studies have shown that the accumulation of Lactiplantibacillus spp. (e.g., Lactiplantibacillus plantarum) in silage can effectively extend the aerobic storage time of silage [63, 64]. This is mainly related to the LA produced by their metabolism, which can inhibit the growth of aerobic putrefactive microorganisms by creating an acidic environment. The wilcoxon test was used to further analyze the differences in common LAB between the CK and AF groups before and after aerobic exposure (Fig. 3A-F). Compared with the CK group, Lactobacillaceae and Lactiplantibacillus abundance were significantly higher in the AF group only at 30 and 60 days of ensiling (P < 0.05). This result explain why the AF group accumulated more LA after 30 and 60 days of ensiling (Fig. 2E). However, Lactobacillaceae and Lactiplantibacillus abundance were lower in the AF group compared with CK group after aerobic exposure. This may be the reason for the massive proliferation of its competitor, Enterobacter [65]. Su et al. [59] also found that the proliferation of Enterobacter in mulberry silage during ensiling under aerobic conditions led to a reduction in Lactiplantibacillus. This may because Enterobacter converted the LA produced by Lactiplantibacillus into AA, which increased the silage pH and thus disrupted the acidic growth environment preferred by Lactiplantibacillus [63].

Fig. 3.

Differences in relative abundance of LABs in normally fermented sugarcane top silage. The differences in common LABs between the CK and AF groups at 3 (A), 7 (B), 12 (C), 30 (D), and 60 (E) days of ensiling and 8-day of aerobic exposure (F) were compared. CK, untreated silage; AF, silage with epiphytic microorganisms after addition of antifungal agent. Statistical significance (P < 0.05) among the treatments according to wilcoxon test at the 5% level (n = 3, biologically independent samples). NS, not significantly; *, 0.01 ≤ P < 0.05; **, 0.001 ≤ P < 0.01

Fungal community of sugarcane tops silage

Changes in fungal communities at the phyla level in sugarcane tops silage, before and after aerobic exposure, are shown in Fig. 4A. In this study, Ascomycota and Basidiomycota were the top 2 dominant fungal phyla in all groups before aerobic exposure. Zhang et al. [20] also reported that Ascomycota and Basidiomycota were the most abundant phyla in sugarcane tops silage during 2–60 days of ensiling. While, after aerobic exposure, Ascomycota were the most dominant fungal phyla in all groups. This result also reported by Gu et al. [21], who found that the Ascomycota was the first dominant fungal phyla after 2–14 days of aerobic exposure. Ascomycetes and Basidiomycetes are the main groups involved in cellulolysis, and both are most diverse and species-rich group in the fungal kingdom. These results indicated that inhibiting either epiphytic LAB or yeast does not affect the high abundance of fungi in silage at phyla level.

Fig. 4.

Fungal community succession with different treatments. Silage bacterial community composition in phylum (A) and genus (B) level; Biomarker bacteria in CK and AB groups after 3 (C), 7 (D), 12 (E), 30 (F), and 60 (G) days of ensiling and 8-day of aerobic exposure (H); Biomarker fungi in CK and AF groups after 3 (C), 7 (D), 12 (E), 30 (F), and 60 (G) days of ensiling and 8-day of aerobic exposure (H). CK, untreated silage; AB, silage with epiphytic microorganisms after addition of antibacterial agent; AF, silage with epiphytic microorganisms after addition of antifungal agent; NA, silage withγ-sterilized

Changes in fungal communities at the genera level in sugarcane tops silage, before and after aerobic exposure, are shown in Fig. 4B. In this study, Fusarium was the most dominant fungal genera in both CK and AF groups during 3–60 days of ensiling. Fusarium is common mold types in corn silage, bean silage and forage silage [66], and produces mycotoxins (e.g., zearalenone, deoxynivalenol, fumonisins) that pose health risks to livestock, including reduced feed intake, immune suppression, and reproductive disorders [4, 67]. However, under the low‑pH, anaerobic conditions of well‑fermented silage, Fusarium activity and mycotoxin production are minimal [68]; thus, DNA detection does not confirm toxin accumulation. Direct quantification of these mycotoxins is needed in future studies. Furthermore, in this study, Wickerhamomyces was the most dominant fungal genera in AB group during 3–60 days of ensiling. Wickerhamomyces was the dominant genera also reported in oat silages [69]. Our data revealed that the AB group had the lowest LA content and highest pH (Fig. 1D, E), conditions that are less inhibitory to Wickerhamomyces. This observation may directly explain the dominance of this genus in the AB group. Additionally, it has been reported that Wickerhamomyces species can secrete mycotoxins to inhibit competing fungi such as Fusarium [9, 70], suppress other fungi (e.g., Saccharomymycopsis) by resource competition [71], and tolerate high ethanol concentrations [59, 72]. Furthermore, Shimizu et al. [72] have reported that Wickerhamomyces has a strong tolerance to low pH. This may explain why it persists during the 3–60 days of ensiling in both the CK and AF groups, especially reaching its highest abundance at 30 days of ensiling under conditions of high LA concentrations. While, after aerobic exposure, the Wickerhamomyces was the first dominant genera in AB (70.33%) and AF group (48.87%) and that was the second dominant genera (17.50%) in CK group. The similar result was also reported in wilted king grass silage, untreated sainfoin silage, whole crop corn silage, and mulberry silage after aerobic exposure [59, 73–75]. However, Wickerhamomyces enrichment in the poorly-fermented silages are more triggered aerobic putrefaction, while in well-fermented silage, it promotes aerobic stability [59, 73, 74]. The high abundance of this Wickerhamomyces in AB group may be because have the ability of antimicrobial and the significant competitive edge of Wickerhamomyces after aerobic exposure. While, the high abundance of this yeast in the AF and CK group is most likely due to that the abundant LA and AA in AF and CK groups can serve as a nutrient substrate for Wickerhamomyces to enhances ester production at low ethanol concentrations [59, 76]. Wickerhamomyces can also metabolize AA through glycolysis and the tricarboxylic acid cycle [71, 75], a product that ensures the stability of silage. However, in the presence of abundant Wickerhamomyces, the aerobic stability in AB group was inferior to that in CK and AF groups (Fig. 1J). This indicates that only Wickerhamomyces enriched in well fermented silage will have AA as its main metabolite, thus extending the aerobic exposure time of silage. The differences in fungal taxa between the CK and AF groups during 3–60 days of ensiling and after 8 days of aerobic exposure were analyzed using LEfSe to identify the key fungi that coexist with LAB in well fermented silage (Fig. 4C-H, LDA > 4.0). Wickerhamomyces was consistently significantly enriched in the AF group during ensiling and after aerobic exposure. This indicates that Wickerhamomyces plays a positive role in acidic anaerobic environments, especially in the later stages of ensiling when its abundance increases and it coexists with high abundance of Lactiplantibacillus to achieve high production of organic acids (LA and AA). While, after aerobic exposure, its abundance increases dramatically and increases the yield of AA in silage.

Changes in bacterial phenotypes

To identify the sources of bacterial contamination risk in sugarcane top silage, we used the bugbase algorithm to predict bacterial potential pathogenic phenotypes in the silage (Fig. 5A). The BugBase-predicted potential pathogenic abundance were always down-regulated only in AF group during ensiling and after aerobic exposure. This is mainly related to the downregulation of Gram-negative bacteria in sugarcane top silage (Fig. 5A). Gram-negative bacteria can cause serious systemic infections, so their reduction is beneficial to fermentation quality [77]. The reason may be the decrease in the abundance of Gram-negative bacteria Raoultella belong to Enterobacteriaceae [78]. While, the BugBase-predicted potential pathogenic abundance in CK group changed from up-regulated to down-regulated as the ensiling time prolonged. Also, the BugBase-predicted potential pathogenic abundance were down-regulated in CK group after aerobic exposure. This change in CK group was mainly related to the downregulation of Gram-positive bacteria. Weissella, as gram-positive bacteria, is usually classified as opportunistic pathogens [79]. Therefore, the downregulation of BugBase-predicted potential pathogenic abundance in CK group may be related to the decline in the abundance of Weissella during ensiling and after aerobic exposure. Similar result also found in AB group during ensiling. This change in AB group was mainly related to the downregulation of Gram-negative bacteria. This also possibly due to the decline in the relative abundance of Gram-negative bacteria Enterobacter in sugarcane top silage during ensiling. However, the BugBase-predicted potential pathogenic abundance were up-regulated in AB group after aerobic exposure. This change in AB group was mainly related to the upregulation of Gram-negative bacteria. This could be attributed to high abundance of the Gram-negative bacteria Vibrionimonas in sugarcane top silage after aerobic exposure. Studies have shown that Vibrionimonas is a Gram-negative bacterium with potential pathogenicity [80, 81]. These results indicates that in well-preserved sugarcane top silage with abundant coexistence of Wickerhamomyces and Lactiplantibacillus, can reduce the source of potential pathogenic bacteria whether before or after aerobic exposure.

Fig. 5.

Bugbase bacterial phenotype prediction. CK, untreated silage; AB, silage with epiphytic microorganisms after addition of antibacterial agent; AF, silage with epiphytic microorganisms after addition of antifungal agent; NA, silage withγ-sterilized

Correlation analysis between the microbiome, environmental factors and predictive function

Spearman’s rank correlation coefficient was used to reveal the correlation between fermentation parameters, predictive function, and key LAB and yeast from the CK and AF groups (Fig. 6). Positive correlations were observed between LA and AA content and Lactiplantibacillus (P < 0.05). Lactiplantibacillus is an important source of organic acids such as LA and AA in silage due to its metabolic flexibility in silage, which allows it to adapt to changes in the fermentation process. Positive correlations were also found between LA and AA content and Wickerhamomyces (P < 0.05). Some studies have indicated that certain strains from the non-Saccharomyces genus Wickerhamomyces (e.g., Wickerhamomyces anomalus) can directly produce LA [82] and AA [71, 75] by utilizing sugar substrates. Moreover, a positive correlation was detected between Lactiplantibacillus and Wickerhamomyces (P < 0.05). Sudun et al. [83] have pointed that some yeasts can provide a nutrient substrate (e.g., vitamins and growth factors) for LAB growth. LA and AA produced by LAB can serve as substrates for yeast esterification [59, 76]. In contrast, the LA, AA content, Wickerhamomyces and Lactiplantibacillus were all showed negative correlations with BugBase-predicted potential pathogenic abundance (P < 0.05). One possible explanation is that the coexistence of these two microbes may promote LA or AA production, which inhibits potentially pathogenic bacteria both during ensiling and after aerobic exposure, as evidenced by the decrease in Enterobacter and Vibrionimonas, respectively. The reduction in potentially pathogenic aerobic deteriorating bacteria such as Vibrionimonas may explain the better aerobic stability in CK and AF groups.

Fig. 6.

Correlation between biomarker microorganisms and fermentation parameters (including LA and AA) and bacterial phenotypes in well-preserved sugarcane top silage. LA, lactic acid; AA, acetic acid. *, 0.01 ≤ P < 0.05; **, 0.001 ≤ P < 0.01; ***, P < 0.001

Isolation and identification of LAB and yeast from the sugarcane tops silage

Based on the above results, and to further clarify the impact of the coexistence of Lactiplantibacillus and Wickerhamomyces on fermentation quality, this study used isolation and culture methods to isolate common Lactiplantibacillus and Wickerhamomyces 's yeast strains from well-preserved sugarcane top silage (CK and AF groups) and carried out co-fermentation in fruit pomace. The colony morphology (color, surface, edge, and elevation) of the isolated yeast and LAB was macroscopically observed by staining (Fig. 7A, B). A phylogenetic tree was then constructed to show the phylogenetic relationships between the isolated LAB (G35) and yeast (G32-15) strains and various yeast and LAB groups in the GenBank database, respectively, and the G35 was identified as Lactiplantibacillus plantarum with 100% similarity (Fig. 7C), the G32-15 was identified Wickerhamomyces anomalus with 98% similarity (Fig. 7D). Hemolysis tests revealed that both the isolated Lactiplantibacillus plantarum G35 and Wickerhamomyces anomalus G32-15 exhibited γ-hemolysis (Fig. 7E, F), indicating no hemolytic activity on blood agar. As shown in Table S5, among the tested carbon sources, Lactiplantibacillus plantarum G35 could not utilize mannitol, rhamnose, raffinose, or starch, while Wickerhamomyces anomalus G32-15 failed to utilize only aescin and starch. To evaluate the organic acid‑producing ability and metabolic flexibility of the isolated Lactiplantibacillus plantarum G35 and Wickerhamomyces anomalus G32-15 on diverse carbon sources, a co‑fermentation experiment was conducted using three fruit peels (orange, dragon fruit, mango). After 7 days of fermentation with the compound inoculant (G35 and G32-15), the content of both LA (Fig. 7G) and AA (Fig. 7H) increased, especially in mango peel and dragon fruit peel.

Fig. 7.

Microscopic examination and morphological observation of isolated Lactiplantibacillus (A) and Wickerhamomyces (B). Phylogenetic trees of isolated Lactiplantibacillus (C) and Wickerhamomyces (D). Hemolysis test for isolating Lactiplantibacillus (E) and Wickerhamomyces (F). Screened Lactiplantibacillus and Wickerhamomyces co-fermented fruit peel waste to produce LA (G) and AA (H). OPWCK, orange peel waste treated with 1% sterile saline; OPWT, orange peel waste treated with 1% compound microbial agent; DFPWCK, dragon fruit peel waste treated with 1% sterile saline; DFPWT, dragon fruit peel waste treated with 1% compound microbial agent; MPWCK, mango peel waste treated with 1% sterile saline; MPWT, mango peel waste treated with 1% compound microbial agent. The compound microbial agent consisted of the isolated Lactiplantibacillus spp. and Wickerhamomyces spp. in a 1:1 ratio

Conclusion

The results of the present study revealed that in well-preserved sugarcane top silage, the coexistence of Lactiplantibacillus, the core bacterium of silage, and Wickerhamomyces, a key fungus, can lead to the accumulation of LA and AA in the silage, inhibiting aerobic spoilage and reducing the occurrence of pathogens. However, the absence of Lactiplantibacillus in sugarcane top silage, where only Wickerhamomyces is abundant, not only leads to excessive ethanol production and increases BugBase-predicted potential pathogenic abundance after aerobic exposure, but makes it more susceptible to aerobic spoilage. Accordingly, Lactiplantibacillus plantarum G35 and Wickerhamomyces anomalus G32-15 with both safety and broad carbon source assimilation were isolated from the well-preserved silage. Moreover, The LA and AA contents increases after co-fermentation of fruit peel waste by Wickerhamomyces anomalus G32-15 and Lactiplantibacillus plantarum G35. This study identified and isolated the key coexisting microorganisms in sugarcane top silage that correlate with fermentation quality and safety, and provided an innovative strategy for developing microbial agents to target and regulate silage quality. Nevertheless, the observed associations are based on correlational analyses; further mechanistic investigations are required to establish causal relationships.

Abbreviations

DM

Dry matter

FM

Fresh matter

CFU

Colony forming units

LAB

Lactic acid bacteria

EB

Enterobacteria

LA

Lactic acid

AA

Acetic acid

PA

Propionic acid

BA

Butyric acid

DNA

Deoxyribonucleic acid

RNA

Ribonucleic acid

OTU

Operational taxonomic units

LEfSe

Linear discriminant analysis effect size

LDA

Linear discriminant analysis

SEM

Standard error of the mean

Authors’ contributions

Qichao Gu: Writing – original draft, Writing – review & editing, Methodology, Investigation, Data curation, Conceptualization. Qiuxiang Ye: Writing – original draft, Methodology, Investigation, Data curation, Conceptualization. Jia Wang: Methodology, Investigation. Zhilin Yan: Methodology, Investigation. Xiaohua Huang: Investigation. Chenghuan Qin: Investigation. Caixiang Wei: Investigation. Qi Yan: Investigation. Xing Gao: Investigation. Yongqi Tan: Investigation. Xinghua Cai: Investigation. Bo Lin: Investigation. Caixia Zou: Writing – review & editing, Supervision, Resources, Project administration, Methodology, Investigation, Data curation, Conceptualization.

Funding

This work was supported by the National Key Research and Development Program of China [grant number 2022YFD1300602], the National Natural Science Foundation of China [grant numbers 312360851], and the Innovation Project of Guangxi Graduate Education [grant number YCBZ2023050].

Data availability

The datasets generated or analyzed during the current study are available from the corresponding author upon reasonable request (zou.cx@gxu.edu.cn). Bacterial and fungal raw sequence data were deposited in the sequence read archive at NCBI (https://www.ncbi.nlm.nih.gov/) under the accession numbers PRJNA1290004 and PRJNA1290002, respectively.

Declarations

Ethics approval and consent to participate

The collection of sugarcane tops was authorized by the College of Life Sciences and Technology, Guangxi University.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.