Provision of porcine milk oligosaccharides to support the weaning transition in nursery pigs fed diets including bovine milk co-products

Abstract

Milk oligosaccharides (MO) support intestinal, microbial, and immune development in young pigs. However, modern production practices wean pigs at an early age, removing them from their source of MO prior to intestinal and immune maturation. The purpose of this study was to investigate the effects of dietary supplementation of galacto-oligosaccharides (GOS) and 2′-fucosyllactose (FL) on the jejunal mucosa-associated microbiota, intestinal immune signaling, morphology, and growth performance of nursery pigs. Forty-eight pigs (6.8 ± 0.2 kg body weight) weaned at 3-weeks-of-age were allotted into six dietary treatments, using a randomized complete block design, with sex and initial body weight as blocks. Dietary treatments were (1) basal diet; (2) basal diet, with supplemental GOS at 1.5% of the diet; (3) basal diet, with supplemental FL at 0.2% of the diet; (4) basal diet, with GOS and FL at 1.5 and 0.2% of the diet, respectively; (5) basal diet, with GOS at 2.3% of the diet; and (6) basal diet, with FL at 0.3% of the diet. These MO were provided alone or in combination at levels mimicking intake at the end of the suckling period, and at 1.5-fold higher, to observe potential dose-dependent responses. Pigs were fed for 21 days in two phases. On d 21, pigs were euthanized for sampling of jejunal mucosa and jejunal tissue. Data were analyzed using the PROC MIXED of SAS 9.4 and contrasts were used to determine the effects of GOS, FL, and their combination (interaction), in addition to the linear effects of increasing dietary GOS or FL. Increasing levels of GOS and FL linearly decreased (P < 0.05) Shannon and Simpson alpha diversity of the jejunal mucosa-associated microbiota. Supplementation with FL increased (P < 0.05) the absolute abundance of Helicobacter in the jejunal mucosa-associated microbiota, although no dose response was observed. Increasing levels of GOS and FL tended to linearly decrease (P = 0.051 and 0.076, respectively) the gene expression of TLR4. Increasing levels of GOS tended to increase (P = 0.054) and increasing supplementation of FL increased (P < 0.05) the number of Ki-67 proliferative cells in the crypt of the jejunum. Increasing levels of GOS increased (P < 0.05) body weight and average daily gain in the early post-weaning period and tended to increase (P = 0.093) body weight by the end of the experimental period. Notably, increasing levels of GOS, and GOS in combination with FL, improved growth performance, whereas FL alone did not.

The supplemental use of milk oligosaccharides, galacto-oligosaccharides, and 2′-fucosyllactose, provided starting at levels meant to mimic intake at the end of the suckling period, modestly influenced the jejunal mucosa-associated microbiota, reduced expression of genes related to inflammatory signaling, and improved growth performance of nursery pigs.

Introduction

Modern pig production systems wean pigs an average of 8 weeks earlier than they would naturally be weaned (Moeser et al. 2017). The only nutrient source for suckling pigs is sow colostrum and milk, which contains highly digestible nutrients and milk oligosaccharides (MO) (Kim 2013; Wei et al. 2018). At weaning, pigs are transitioned to predominantly plant-based diets, but this sudden change in dietary composition can have a negative impact on the underdeveloped intestine (Hu et al. 2013). Common plant feedstuffs, like corn and soybean meal, contain anti-nutritional compounds that can interfere with digestibility and induce intestinal inflammation and tissue damage (Dunsford et al. 1989; Li et al. 1990). To ease this transition, diets for nursery pigs include animal products like fish meal, poultry meal, and blood plasma because they are highly digestible protein sources with balanced amino acid profiles and no anti-nutritional compounds (Kim and Easter 2001; Almeida et al. 2013). Bovine milk co-products, like whey permeate, are also commonly used in nursery pig diets to provide lactose, as is present in porcine milk (Mahan 1992; Nessmith et al. 1997; Jang et al. 2021).

MO are a carbohydrate source but are indigestible by mammalian enzymes due to the nature of their linkages, and therefore are considered prebiotics (Bode 2006; Gibson et al. 2017; Durham et al. 2023). The quantity and composition of MO is highly variable across mammalian species and the composition and quantity of MO in bovine milk is vastly different than that of MO in porcine milk (Albrecht et al. 2014; Dinleyici et al. 2023). The approximate MO content in bovine milk is 2 g/L whereas the MO content of porcine milk is 12 g/L (Gormley et al. 2024a). Furthermore, the approximate composition differs, with neutral and nitrogen-containing MO representing 26% of the overall MO content in bovine milk, whereas representing 51% of the overall MO content in porcine milk (Gormley et al. 2024a). MO directly support intestinal health by enhancing the growth of potentially beneficial members of the intestinal microbiota and preventing colonization by harmful microbial populations through competitive exclusion (James et al. 2016; Xu 2004). In humans, significant research emphasis has been placed on the benefits of MO naturally occurring in breast milk on infant health and development, particularly related to the beneficial effects on the intestinal microbiome contributing to a reduced incidence of disease (Ruiz-Palacios et al. 2003; Bode 2015). As a result of this research, synthetic MO are now commonly found in infant formulas (Euler et al. 2005; Knol et al. 2005) and have even been investigated as prebiotics in human adults (Elison et al. 2016). Considering the benefits that have been observed in humans, it would be reasonable to assume that MO may have a similar effect in the intestinal environment of young pigs.

Whey permeate is one of the major carbohydrate sources and is included at between 10 to 24% in the diets of newly weaned pigs (Cromwell et al. 2008; Jang and Kim 2022). Considering their prebiotic effects, providing supplemental MO during the nursery phase could support intestinal health and growth of nursery pigs. Galacto-oligosaccharides (GOS) and 2′-fucosyllactose (FL) are candidates as supplemental MO due to their natural occurrence in porcine milk (Bunesova et al. 2016; Salcedo et al. 2016). Specifically, GOS prevents colonization of pathogenic bacteria through steric hinderance (Coppa et al. 2006), whereas FL prevents it via competitive binding (Ruiz-Palacios et al. 2003). Both MO act as substrates supporting the proliferation of beneficial populations of the microbiota throughout the gastrointestinal tract of pigs (Schokker et al. 2018; Lee et al. 2023). Previous studies have investigated the use of these prebiotics independently during the suckling (Tian et al. 2018; Wang et al. 2020; Boston et al. 2024) and nursery periods (Xing et al. 2020). Furthermore, their combined use has been investigated in suckling pigs (Fan et al. 2025), but the provision of supplemental MO to nursery pigs would be arguably more important, as they no longer have access to sow’s milk. To date, translational models using suckling piglets have been widely used to evaluate a range of MO derived from multiple species, including FL, with consistent evidence supporting effects on immune development, microbial ecology, and growth performance (Wang et al. 2021; Monaco et al. 2023; Daniels et al. 2024). Investigating their use in nursery pigs is therefore warranted to determine whether these MO can mitigate the negative impacts of weaning on the intestinal microbiota and intestinal health during a period of increased stress.

The use of GOS and FL, alone or in combination, may support the mucosa-associated microbiota of nursery pigs through the weaning transition, improving intestinal health and growth performance. Therefore, it was hypothesized that the use of GOS and FL at physiologically relevant levels mimicking intake at the end of the suckling period could positively influence intestinal health and growth of nursery pigs, and that their use in combination may exhibit additive effects. Furthermore, it was hypothesized that the use of GOS or FL independently, but at levels greater than those found in porcine milk, may further improve intestinal health and growth of pigs. The objective of this study was to investigate the effects of GOS and FL, alone or in combination, and increasing levels of GOS and FL, on the jejunal mucosa-associated microbiota, immune response, stress status, and morphology of the jejunum, and growth performance of nursery pigs.

Materials and methods

The procedure of this study was reviewed and approved (25-371) by the North Carolina State University Institutional Animal Care and Use Committee (Raleigh, NC, USA). This experiment was conducted at the Metabolism Education Unit of North Carolina State University (Raleigh, NC, USA).

Experimental design, animals, and diets

Forty-eight newly weaned pigs (24 barrows and 24 gilts) at 6.8 ± 0.2 kg body weight (BW) were weaned at d 21 of age and were allotted into six dietary treatments using a randomized complete block design with initial BW (light and heavy) and sex serving as blocks. Each pig was housed individually in a pen with dimensions of 1.73 × 0.83 m with approximately 1.13 m² of usable floor space, considering the feeder. Each pig was also given ad libitum access to feed and water throughout the duration of the experimental period. Within each treatment, there were eight replicates and pigs were allotted into six dietary treatments. Dietary treatments were (1) basal diet; (2) basal diet, including supplemental GOS at 1.5% of the diet; (3) basal diet, including supplemental FL at 0.2% of the diet; (4) basal diet, including GOS and FL at 1.5 and 0.2% of the diet, respectively; (5) basal diet, including GOS at 2.3% of the diet; and (6) basal diet, including FL at 0.3% of the diet. The levels of GOS and FL were determined based on estimated intake during late lactation and were subsequently provided at 1.0 and 1.5 times those levels to identify a potential dose response. Basal diets were formulated to meet or exceed the recommendations outlined in the NRC (2012). In the experimental diets, glucose and lactose were balanced across the treatments to avoid any confounding effects. Pigs were fed their respective dietary treatments for 21 days in two phases: phase 1 for 6 days (weaning to 7 kg BW) and phase 2 for 15 days (7 kg to the conclusion of the study). Dietary composition for all experimental diets from both phases are shown in Table 1. The experimental diets were produced at the Feed Mill Educational Unit at North Carolina State University (Raleigh, NC, USA). From each diet, samples were taken from several locations within the treatment batch, and the pooled representative sample was sent to the North Carolina Department of Agriculture and Consumer Services (Raleigh, NC, USA) for proximate analysis of nutrient composition.

Table 1.

Composition of experimental diets (as-fed basis) supplemented with different concentrations of galacto-oligosaccharide (GOS) or 2′-fucosyllactose (FL).

	Phase 1 (wean to 7 kg)						Phase 2 (7–11 kg)
GOS, %	0.0	1.5	0.0	1.5	2.3	0.0	0.0	1.5	0.0	1.5	2.3	0.0
FL, %	0.0	0.0	0.2	0.2	0.0	0.3	0.0	0.0	0.2	0.2	0.0	0.3
Feedstuff, %
Basal 95%
Corn	37.80	37.80	37.80	37.80	37.80	37.80	47.37	47.37	47.37	47.37	47.37	47.37
Soybean meal	17.50	17.50	17.50	17.50	17.50	17.50	23.00	23.00	23.00	23.00	23.00	23.00
Whey permeate	18.00	18.00	18.00	18.00	18.00	18.00	10.00	10.00	10.00	10.00	10.00	10.00
Blood plasma	3.00	3.00	3.00	3.00	3.00	3.00	1.50	1.50	1.50	1.50	1.50	1.50
Fish meal	5.00	5.00	5.00	5.00	5.00	5.00	3.00	3.00	3.00	3.00	3.00	3.00
Poultry meal	10.00	10.00	10.00	10.00	10.00	10.00	5.00	5.00	5.00	5.00	5.00	5.00
Poultry fat	1.82	1.82	1.82	1.82	1.82	1.82	2.75	2.75	2.75	2.75	2.75	2.75
L-Lysine HCl	0.45	0.45	0.45	0.45	0.45	0.45	0.42	0.42	0.42	0.42	0.42	0.42
L-Methionine	0.24	0.24	0.24	0.24	0.24	0.24	0.20	0.20	0.20	0.20	0.20	0.20
L-Threonine	0.20	0.20	0.20	0.20	0.20	0.20	0.17	0.17	0.17	0.17	0.17	0.17
L-Tryptophan	0.02	0.02	0.02	0.02	0.02	0.02	0.00	0.00	0.00	0.00	0.00	0.00
Dicalcium phosphate	0.00	0.00	0.00	0.00	0.00	0.00	0.34	0.34	0.34	0.34	0.34	0.34
Limestone	0.57	0.57	0.57	0.57	0.57	0.57	0.85	0.85	0.85	0.85	0.85	0.85
Vitamin premix1	0.03	0.03	0.03	0.03	0.03	0.03	0.03	0.03	0.03	0.03	0.03	0.03
Mineral premix2	0.15	0.15	0.15	0.15	0.15	0.15	0.15	0.15	0.15	0.15	0.15	0.15
Salt	0.22	0.22	0.22	0.22	0.22	0.22	0.22	0.22	0.22	0.22	0.22	0.22
Supplemental 5%
Whey permeate	1.70	0.57	1.70	0.57	0.00	1.70	1.70	0.57	1.70	0.57	0.00	1.70
GOS syrup3	0.00	3.35	0.00	3.35	5.00	0.00	0.00	3.35	0.00	3.35	5.00	0.00
2-FL4	0.00	0.00	0.20	0.20	0.00	0.30	0.00	0.00	0.20	0.20	0.00	0.30
Dextrose	1.05	0.33	1.05	0.33	0.00	1.05	1.05	0.33	1.05	0.33	0.00	1.05
Miscanthus powder	2.25	0.75	2.05	0.55	0.00	1.95	2.25	0.75	2.05	0.55	0.00	1.95
Calculated composition, as-fed basis
Metabolizable energy, kcal/kg	3,482	3,481	3,482	3,481	3,481	3,482	3,482	3,481	3,482	3,481	3,481	3,482
Crude protein, %	24.6	24.5	24.6	24.5	24.5	24.6	22.1	22.0	22.1	22.0	22.0	22.1
SID lysine, %5	1.50	1.50	1.50	1.50	1.49	1.50	1.35	1.35	1.35	1.35	1.35	1.35
SID methionine + cysteine, %	0.82	0.82	0.82	0.82	0.82	0.82	0.75	0.75	0.75	0.75	0.75	0.75
SID threonine, %	0.88	0.88	0.88	0.88	0.88	0.88	0.79	0.79	0.79	0.79	0.79	0.79
SID tryptophan, %	0.20	0.20	0.20	0.20	0.20	0.20	0.20	0.20	0.20	0.20	0.20	0.20
Calcium, %	0.86	0.85	0.86	0.85	0.85	0.86	0.80	0.79	0.80	0.79	0.79	0.80
STTD phosphorus, %6	0.49	0.49	0.49	0.49	0.48	0.49	0.39	0.39	0.39	0.39	0.38	0.39
GOS, %	0.02	1.52	0.02	1.52	2.27	0.02	0.01	1.51	0.01	1.51	2.26	0.01
Glucose, %	1.08	1.08	1.08	1.08	1.08	1.08	1.08	1.08	1.08	1.08	1.08	1.08
FL, %	0.01	0.01	0.19	0.19	0.01	0.29	0.00	0.00	0.19	0.19	0.00	0.29
Lactose, %	15.76	15.76	15.76	15.76	15.75	15.76	9.36	9.36	9.36	9.36	9.35	9.36

¹The vitamin premix provided the following per kilogram of complete diet: 6,613.8 IU of vitamin A as vitamin A acetate, 992.0 IU of vitamin D₃, 19.8 IU of vitamin E, 2.64 mg of vitamin K as menadione sodium bisulfate, 0.03 mg of vitamin B₁₂, 4.63 mg of riboflavin, 18.52 mg of D-pantothenic acid as calcium pantothenate, 24.96 mg of niacin, and 0.07 mg of biotin.

²The trace mineral premix provided the following per kilogram of complete diet: 4.0 mg of Mn as manganous oxide, 165 mg of Fe as ferrous sulfate, 165 mg of Zn as zinc sulfate, 16.5 mg of Cu as copper sulfate, 0.30 mg of I as ethylenediamine di-hydroiodide, and 0.30 mg of Se as sodium selenite.

³GOS syrup contained approximately 45% GOS.

⁴FL powder contained approximately 94% FL.

⁵SID = standardized ileal digestible.

⁶STTD = standardized total tract digestible.

Experimental procedures and sample collection

On d 0, 6, 13, and 21, individual BW and feed intake were recorded to calculate average daily gain (ADG), average daily feed intake (ADFI), and gain: feed (G: F). Once a day, fecal score was recorded by the same trained individual throughout the duration of the experimental period. Fecal score was evaluated using a visual 1–5 scale: (1) very hard and dry feces, (2) firm stool, (3) normal stool, (4) loose stool, and (5) watery stool with no shape.

On d 21 of the study, all pigs were incapacitated by a captive bolt gun to the head and were then humanely euthanized via exsanguination. After euthanasia was complete, the digestive tract was removed for sample collection. The mid-jejunum was identified as beginning at 3 m after the pyloric duodenal junction. A 5-cm long subsection of the mid-jejunum sample was cut lengthwise and laid flat with the luminal surface facing up. Mucosa samples were obtained using a microscope slide to gently scrape the mucosa from the luminal surface, taking care not to damage the tissue. The scraped mucosa was then put into Eppendorf tubes (2 mL) before being placed in liquid nitrogen. The tubes were then transferred to a storage container and stored at −80°C for further analysis of oxidative damage and immune markers, and relative and absolute abundance and diversity of members of the mucosa-associated microbiota. A second segment 3 cm in length was obtained from the mid-jejunum and was rinsed with a sterile saline solution before being transferred to a 5 mL tube. The tube was immediately placed into liquid nitrogen and then transferred to a storage container and stored at −80°C for further analysis related to gene expression within jejunal tissue. A third segment (5 cm) of the mid-jejunum was similarly removed and rinsed with sterile saline. The rinsed segment was placed into a 50 mL Falcon tube containing 10% buffered formaldehyde and stored for further evaluation of histology of jejunal tissue.

Absolute and relative abundance and diversity of jejunal mucosa-associated microbiota

The scraped mucosa samples that were collected from the mid-jejunum were used for further evaluation of the absolute and relative abundance and diversity of the mucosa-associated microbiota. The scraped mucosa samples were prepared according to the protocol provided by Zymo Research (Irvine, CA, USA). The prepared samples were sent to Zymo Research for the 16S rRNA microbiome sequencing analysis as previously described (Gormley et al. 2024b; Garavito-Duarte et al. 2025). Raw sequencing reads were processed using the DADA2 pipeline (Callahan et al. 2016), which included the removal of chimeric sequences and inference of unique amplicon sequence variants (ASVs). Sequencing depth exceeded 20,000 times per sample. Taxonomic classification was conducted using reference data from the Greengenes and SILVA databases. Afterwards, alpha and beta diversity, relative abundance, and absolute abundance of the jejunal mucosa-associated microbiota were calculated (Deng et al. 2023a; Sung et al. 2026). Any ASV data representing less than 0.5% of the total relative abundance at each level were combined together as “others.” Alpha and beta diversity were evaluated using MicrobiomeAnalyst (QC, Canada) with beta diversity visualized using Bray-Curtis distances (Bray and Curtis 1957; Chong et al. 2020). Absolute abundance was determined using a spike-in based approach in which a known quantity of foreign bacterial cells were added prior to DNA extraction to account for differences in extraction efficiency and sequencing depth among samples (Sung et al. 2026). Beta diversity was evaluated and visualized using the Bray–Curtis distance following previously described procedures (Choi et al. 2025).

Relative mRNA expression of genes in jejunal tissue

Frozen samples of tissue taken from the mid-jejunum were weighed (50–100 mg) and placed into 2 mL tubes before the addition of 1 mL of TRIzol reagent (15-596-026, Invitrogen, Waltham, MA, USA). The tubes were then placed onto a tissue homogenizer (Bead Mill 24 Homogenizer, ThermoFisher Scientific Inc.) and the samples were homogenized three times at a velocity of 4.5 m/s for 30 s and were placed on ice for 1 min between each cycle. Once the tissue had been thoroughly homogenized, the samples were transferred and centrifuged at 12,000 × g at 4°C for 10 min, as previously described (Deng et al. 2023a). The resulting supernatant was removed and transferred into new 1.5 mL centrifuge tubes. Then, 200 µL of chloroform (ThermoFisher Scientific Inc.) were added to the supernatant and the tubes were gently vortexed for 1 min until well combined. The tubes were allowed to incubate for 10 min prior to centrifugation for 15 min 12,000 × g at 4°C. The tubes were carefully removed from the centrifuge to not disrupt the aqueous phase, which was removed and transferred into a new 1.5 mL centrifuge tube that contained 200 µL of isopropanol. The tubes were again gently vortexed for 1 min until thoroughly mixed and allowed to incubate for 10 min before the final centrifugation for 15 min at 12,000 × g at 4 °C. The resulting supernatant was carefully poured off to retain the pellet at the bottom of the tube. Tubes were left opened and allowed to dry in a sterilized fume hood for approximately 20 min until all of the supernatant had evaporated. Using the RevertAid First Strand cDNA Synthesis kit (no. 01299151, ThermoFisher Scientific Inc.), cDNA was obtained from the extracted RNA, following the instructions associated with the kit. Quantitative real-time polymerase chain reaction (RT-qPCR) was conducted using the CFX Connect Real-Time PCR Detection System (BioRad, Hercules, CA, USA) and the Maxima SYBR Green/ROX qPCR Master Mix (no. 01292815, ThermoFisher Scientific Inc.). The sequence of the primers used are described in Table 2 and were synthesized by Millipore Sigma (Burlington, MA, USA) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was chosen as the housekeeping gene. The delta-delta Ct values were calculated to determine the relative gene expression of each gene of interest.

Table 2.

Sequence of primers for immune response and barrier function in the jejunum of pigs.

Item1	Primer	Sequence	Accession number
GAPDH	Forward	TCGGAGTGAACGGATTTGGC	NM_001206359.1
	Reverse	TGCCGTGGGGTGGAATCATAC
NOD1	Forward	AACACCGATCCAGTGAGCAG	NM_001114277.1
	Reverse	AAATGGTCTCGCCCTCCTTG
NOD2	Forward	GTGCTTCCCCTCTAGACTCA	NM_001105295.1
	Reverse	ACGAACCAGGAAGCCAAGAG
TLR2	Forward	GGGCTGCGTTCATTCATCAG	XM_005653576.3
	Reverse	CTGCAGAGGATGGATGGCAA
TLR4	Forward	CGTGCAGGTGGTTCCTAACA	NM_001113039.2
	Reverse	GGTTTGTCTCAACGGCAACC
CD14	Forward	CCCTGCCAAATAGACGACGA	NM_001097445.2
	Reverse	TCGAGCGTCAGTTCCTTGAG
IFN-γ	Forward	GGCCATTCAAAGGAGCATGG	HQ026021.1
	Reverse	AAGCTCATCTCACCGGAATTT
NF-κB	Forward	GTGTGTAAAGAAGCGGGACCT	NM_001048232.1
	Reverse	CACTGTCACCTGGAAGCAGAG
mTOR	Forward	TCTCTATCAAGTTGCTGGCCG	XM_003127584.6
	Reverse	CTAGCGCTGCCTTTCGAGAT
CLDN1	Forward	AAACCGTGTGGGAACAACCA	NM_001244539.1
	Reverse	CACATGAAAATGGCTTCCCTC
OCLN	Forward	TCAGGTGCACCCTCCAGATT	XP_005672579.1
	Reverse	AGGAGGTGGACTTTCAAGAGG
ZO-1	Forward	CAGAGACCAAGAGCCGTCC	XM_003480423.4
	Reverse	TGCTTCAAGACATGGTTGGC

¹GAPDH, glyceraldehyde-3-phosphate dehydrogenase; NOD, nod-like receptor; TLR, toll-like receptor; CD14, cluster of differentiation 14; IFN-γ, interferon-γ; NF-κB, nuclear factor-κB; mTOR, mechanistic target of rapamycin; CLDN1, claudin-1; OCLN, occludin; ZO-1, zonula occludens-1.

Inflammatory cytokines, immunoglobulins, and oxidative damage products

Scraped mucosa taken from segments of the mid-jejunum were weighed (500–600 mg) and suspended in 1 mL of phosphate-buffered saline (PBS). The mucosa was then homogenized 2 times at a velocity of 4.5 m/s for 30 s using a tissue homogenizer (Bead Mill 24 Homogenizer, ThermoFisher Scientific Inc.). Between cycles, the samples were placed on ice. After complete homogenization, the samples were centrifuged at 12,000 × g for 15 min as previously described (Jang et al. 2021). The resulting supernatant was removed and allocated into 5 separate aliquots and stored at −80°C for further analysis.

The concentration of total protein, malondialdehyde (MDA), protein carbonyl, immunoglobulin G (IgG), immunoglobulin A (IgA), tumor necrosis factor alpha (TNF-α), interleukin 6 (IL-6), and interleukin 8 (IL-8) were measured using commercial kits following the procedures provided within each respective kit. For each assay, an optical density (OD) value was obtained using a plate reader (Synergy HT, BioTek Instruments, Winooski, VT, USA) and compatible software (Gen5 Data Analysis Software, BioTek Instruments). The supernatant obtained from processing the scraped mucosa samples was further diluted (1:32) in PBS to obtain the appropriate working range before measuring the total protein concentration using the Pierce BCA Protein Assay Kit (no. 23225, ThermoFisher Scientific Inc.). The concentrations of MDA, protein carbonyl, IgG, IgA, TNF-α, IL-6, and IL-8 obtained from their respective assays were normalized to the total protein content of the extracted mucosa of the corresponding sample. Results were expressed as concentration per milligram of total protein. The MDA and protein carbonyl content were measured using commercial kits (Cell Biolabs, Inc., San Diego, CA, USA) as previously described (Holanda and Kim 2021). Using the ELISA kits (E101-102 and E101-104, Bethyl Laboratories, Inc., Montgomery, TX, USA), the concentration of IgA and IgG were measured, respectively. The previously prepared supernatant from the mucosal samples were diluted with PBS to 1:1,000 and 1:1,600 to measure IgA and IgG, respectively. The concentration of TNF-α, IL-6, and IL-8 were measured using the corresponding ELISA kits (R&D Systems, Minneapolis, MN, USA) as previously described (Deng et al. 2023b). All assays were conducted and validated according to the manufacturers’ instructions using porcine-specific kits or kits previously validated for use with porcine intestinal tissue (Weaver et al. 2013; Shen et al. 2014; Weaver et al. 2014; Holanda and Kim 2021; Deng et al. 2023b).

Intestinal morphology and Ki-67 in crypt cells

Upon sampling, sections of the mid-jejunum were taken and placed into 10% formalin and stored for 3 days. The 10% formalin was removed, and the samples were transferred into a 70% ethanol solution for storage. The samples were then cut transversely into two thin sections and placed into a plastic cassette. The cassettes were also stored in the 70% ethanol storage solution until they could be delivered to the University of North Carolina School of Medicine Lineberger Comprehensive Cancer Center (Chapel Hill, NC, USA) for dehydration, embedment, staining and immunohistochemistry of Ki-67 proteins using their internal protocol as previously described (Baker et al. 2024). The tissue samples were mounted on slides and evaluated for histology parameters using an Olympus CX31 microscope (Lumenera Corporation, Ottowa, Canada) and the Infinity 2-2 digital CCD software. For each sample, 10 images were taken from various locations along the tissue at 4× magnification, where the entire length of the villus and the associated crypt were easily visible. Another 10 images were taken of the previously described crypts at 10× magnification to capture an entire crypt and the associated cells with increased resolution. The 10 images of each slide at each respective magnification were imported into the Teledyne Lumenera Infinity Analyze 7 software to analyze intestinal morphology and determine the number of Ki-67 positive cells. Villus height was measured from the top of the villus to the villus-crypt junction and the crypt depth was measured from the top of the villus-crypt junction to the bottom of the crypt. Villus height to crypt depth ratio (VH:CD) was obtained by dividing the measured villus height by the measured crypt depth. To obtain the number of Ki-67 positive cells, a manual count was conducted. The same images were used to determine the percentage of Ki-67 positive cells out of the total cells found in the crypt. Images of the crypts were cropped to contain only a single crypt and were then imported into the QuPath software and a ratio of Ki-67 positive cells to total crypt cells were reported as a ratio (%). All procedures related to intestinal morphology analysis were carried out by the same trained individual and the 10 measurements per sample were averaged and represented a single value per pig.

Statistical analysis

To determine the minimum number of replications needed detect biologically relevant treatment differences at P < 0.05, an initial power test was conducted using data from previous studies performed at the same research facility with pigs of a similar genetic background (Gormley et al. 2024b; Garavito-Duarte et al. 2025). The analysis assumed an expected treatment difference of 13%–14% in growth performance responses with an estimated coefficient of variation of 7.5%. Based on these assumptions, a power of test (1 − beta) of 80% indicated that the minimum number of replications for each treatment was eight (Martin et al. 1987).

Data were analyzed using the MIXED procedure in SAS 9.4 (SAS Inc., Cary, NC, USA). Contrasts were used to determine the main effect of GOS supplementation (0.0% and 1.5%), main effect of FL supplementation (0.0% and 0.2%), and the interaction between main effects of GOS (0.0% and 1.5%) and FL (0.0% and 0.2%). Therefore, reported P values for GOS and FL reflect overall main effects across a factorial structure rather than direct pairwise comparisons between individual treatment means. Additional contrasts were used to determine the linear effects of GOS (0.0%, 1.5%, and 2.3%) or FL (0%, 0.2%, and 0.3%) using coefficients generated by the IML procedure of SAS. The dietary treatment was considered the fixed effect, and the initial BW and sex blocks were considered the random effects. The experimental unit was the individually housed pig. Results were considered statistically significant when the P value was less than 0.05 and were considered a tendency when the P value was between 0.05 and 0.10.

Results

Alpha and beta diversity of jejunal mucosa-associated microbiota

At the species level, the supplementation of FL alone reduced the Shannon and Simpson alpha diversity, whereas they were unaffected by FL with GOS (interaction; P < 0.05; Table 3). Increasing levels of GOS tended to linearly decrease (P = 0.066) Chao1 alpha diversity of the jejunal mucosa-associated microbiota. Increasing levels of either GOS or FL linearly decreased (P < 0.05) the Shannon and Simpson alpha diversity indices of the jejunal mucosa-associated microbiota. The microbial communities at the genus level were visualized using PCoA based on Bray–Curtis distance and pair-wise comparisons (Figure 1). Based on the Bray–Curtis distance there were differences in beta diversity between the control treatment and the 0.2% FL treatment (P < 0.05) and a tendency for difference in beta diversity between the 0.3% FL treatment and the 1.5% GOS + 0.2% FL treatment and between the control treatment and the 0.3% FL treatment (P = 0.050 and 0.057, respectively).

Table 3.

Alpha diversity of mucosa-associated microbiota in the jejunum, at the genus level, of nursery pigs fed diets supplemented with different concentrations of galacto-oligosaccharide (GOS) or 2′-fucosyllactose (FL).¹

GOS, %	0.0	1.5	0.0	1.5	2.3	0.0	SEM2	P value3
FL, %	0.0	0.0	0.2	0.2	0.0	0.3		GOS	FL	GOS×FL	Con versus GOS+FL	Linear GOS	Linear FL
Chao1	477.2	448.1	408.3	468.3	362.3	491.1	39.8	0.700	0.545	0.270	0.875	0.066	0.960
Shannon	6.8a	5.9a,b,c	5.1c	6.4a,b	5.6	6.1	0.3	0.457	0.082	0.001	0.468	0.009	0.045
Simpson	0.97a	0.92b,c	0.87c	0.96a,b	0.92	0.92	0.02	0.331	0.109	<0.001	0.645	0.041	0.012

^a,b,cLeast squares means within a row without a common superscript differ (P < 0.05).

¹Each least squares mean represents eight observations.

²Standard error of the mean.

³GOS, effect of GOS supplementation (0.0% and 1.5%); FL, effect of FL supplementation (0.0% and 0.2%); GOS×FL, interaction between GOS and FL supplementation (1.5% and 0.2%, respectively); Con versus GOS+FL, contrast between Con (0.0% and 0.0% GOS and FL, respectively) and GOS+FL (1.5% and 0.2% GOS and FL, respectively); Linear GOS, linear effect of GOS (0.0%, 1.5%, and 2.3%); Linear FL, linear effect of FL (0.0%, 0.2%, and 0.3%).

Figure 1.

Principal component analysis (PCoA) plot of the jejunal mucosa-associated microbiota at the genus level in nursery pigs fed diets supplemented with different concentrations of galacto-oligosaccharide (GOS) or 2′-fucosyllactose (FL). The X-axis and Y-axis represent the principal component axes, with the percentages indicating the proportion of variation explained by each component. Points of different colors respond to samples of different treatments, and the closer two points are, the more similar the points are in species composition as evaluated by a pair-wise comparison. The P value for the Bray–Cutris between 0.0% GOS, 0.0% FL, and 0.0% GOS, 0.2% FL was 0.039, between 1.5% GOS, 0.2% FL, and 0.0% GOS, 0.3% FL was 0.050, and between 0.0% GOS, 0.0% FL and 0.0% GOS, 0.3% FL was 0.057. All other P values were not significant.

Absolute and relative abundance of jejunal mucosa-associated microbiota

At the phylum level, the supplementation of FL alone increased the absolute abundance of Pseudomonadota, whereas it was unaffected by FL with GOS (interaction; P < 0.05; Table 4). The supplementation of FL alone increased the relative abundance of Pseudomonadota, whereas it was unaffected by FL with GOS (interaction; P < 0.05). Increasing levels of FL linearly increased (P < 0.05) the relative abundance of Pseudomonadota.

Table 4.

Absolute and relative abundance of mucosa-associated microbiota in the jejunum, at the phylum level, of nursery pigs fed diets supplemented with different concentrations of galacto-oligosaccharide (GOS) or 2′-fucosyllactose (FL).¹

GOS, %	0.0	1.5	0.0	1.5	2.3	0.0	SEM2	P value3
FL, %	0.0	0.0	0.2	0.2	0.0	0.3		GOS	FL	GOS×FL	Con versus GOS+FL	Linear GOS	Linear FL
Absolute abundance, cells × 106
Bacillota	14.76	7.66	14.14	12.28	20.39	9.15	5.52	0.359	0.681	0.590	0.720	0.626	0.465
Pseudomonadota	1.10b	2.12b	9.06a	1.27b	1.75	2.92	2.03	0.080	0.066	0.024	0.948	0.768	0.218
Bacteroidota	4.11	1.67	2.06	2.56	3.04	2.21	1.21	0.410	0.621	0.215	0.351	0.380	0.209
Actinomycetota	2.44	0.84	1.76	1.35	2.61	2.08	0.77	0.196	0.914	0.441	0.319	0.851	0.670
Others	0.87	0.58	0.66	0.62	0.52	0.58	0.14	0.264	0.550	0.387	0.222	0.075	0.152
Total	23.28	12.87	27.69	18.08	28.30	16.95	7.35	0.142	0.476	0.953	0.586	0.824	0.632
Relative abundance, %
Bacillota	59.6	63.8	52.4	66.5	62.2	48.2	7.3	0.096	0.675	0.360	0.370	0.680	0.135
Pseudomonadota	6.4b	13.8a,b	26.9a	8.3b	12.9	24.4	6.6	0.289	0.157	0.016	0.797	0.329	0.009
Bacteroidota	15.3A	11.2A,B	7.2B	11.2A,B	10.3	12.7	2.1	0.990	0.065	0.064	0.183	0.087	0.188
Actinomycetota	12.2	6.3	9.7	9.3	11.2	9.9	2.6	0.204	0.916	0.264	0.406	0.533	0.463
Others	6.4	4.8	3.8	4.6	3.4	4.8	1.4	0.781	0.297	0.371	0.351	0.131	0.296

^a,bLeast squares means within a row without a common superscript differ (P < 0.05).

^A,BLeast squares means within a row without a common superscript tend to differ (0.05 < P < 0.10).

¹Each least squares mean represents eight observations.

²Standard error of the mean.

³GOS, effect of GOS supplementation (0.0% and 1.5%); FL, effect of FL supplementation (0.0% and 0.2%); GOS × FL, interaction between GOS and FL supplementation (1.5% and 0.2%, respectively); Con vs GOS + FL, contrast between Con (0.0% and 0.0% GOS and FL, respectively) and GOS+FL (1.5% and 0.2% GOS and FL, respectively); Linear GOS, linear effect of GOS (0.0%, 1.5%, and 2.3%); Linear FL, linear effect of FL (0.0%, 0.2%, and 0.3%).

At the family level, the supplementation of FL alone increased the absolute abundance of Helicobacteraceae, whereas it was unaffected by FL with GOS (interaction; P < 0.05; Table 5). Furthermore, the supplementation of FL increased (P < 0.05) the absolute abundance of Succinivibrionaceae. The supplementation of FL alone increased the relative abundance of Helicobacteraceae, whereas it was unaffected by FL with GOS (interaction; P < 0.05). The increasing inclusion of FL also increased (P < 0.05) the relative abundance of Helicobacteraceae. The supplementation of FL alone decreased the relative abundance of Lachnospiraceae, whereas it was unaffected by FL with GOS (interaction; P < 0.05). The supplementation of GOS or FL alone did not affect the relative abundance of Leuconostocaceae, whereas the relative abundance was increased by FL with GOS (interaction; P < 0.05). Furthermore, the supplementation of FL with GOS increased (P < 0.05) the relative abundance of Leuconostocaeae compared with the control. The supplementation of FL increased (P < 0.05) the relative abundance of Staphylococcaeae.

Table 5.

Absolute and relative abundance of mucosa-associated microbiota in the jejunum, at the family level, of nursery pigs fed diets supplemented with different concentrations of galacto-oligosaccharide (GOS) or 2′-fucosyllactose (FL).¹

GOS, %	0.0	1.5	0.0	1.5	2.3	0.0	SEM2	P value3
FL, %	0.0	0.0	0.2	0.2	0.0	0.3		GOS	FL	GOS×FL	Con versus GOS+FL	Linear GOS	Linear FL
Absolute abundance, cells × 106
Lactobacillaceae	5.47	3.26	4.94	4.39	6.34	3.46	1.45	0.335	0.835	0.561	0.591	0.888	0.356
Helicobacteraceae	0.79b	0.95b	8.32a	0.92b	1.43	2.67	1.86	0.052	0.044	0.043	0.960	0.818	0.206
Lachnospiraceae	3.15	1.31	1.95	2.58	2.26	1.84	0.95	0.482	0.973	0.156	0.636	0.333	0.251
Prevotellaceae	3.67	1.51	1.71	2.17	2.81	2.00	1.06	0.417	0.533	0.217	0.312	0.410	0.206
Veillonellaceae	2.61	1.07	1.43	1.44	1.99	1.66	0.68	0.264	0.554	0.260	0.228	0.367	0.265
Bifidobacteriaceae	1.74	0.60	1.42	1.00	2.20	1.45	0.61	0.199	0.947	0.546	0.386	0.857	0.707
Ruminococcaceae	2.18	0.99	1.21	1.69	1.43	1.17	0.67	0.537	0.816	0.155	0.548	0.269	0.187
Peptostreptococcaceae	0.20	0.45	3.88	0.07	6.91	0.06	3.01	0.537	0.566	0.481	0.975	0.151	0.868
Streptococcaceae	0.31	0.30	0.22	0.51	0.46	0.52	0.17	0.405	0.715	0.352	0.398	0.585	0.500
Coriobacteriaceae	0.72	0.25	0.36	0.32	0.43	0.64	0.22	0.240	0.515	0.316	0.198	0.247	0.628
Leuconostocaceae	0.09	0.01	0.02	0.62	0.46	0.02	0.24	0.280	0.272	0.167	0.126	0.361	0.823
Erysipelotrichaceae	0.39	0.16	0.24	0.18	0.31	0.24	0.12	0.208	0.586	0.431	0.204	0.431	0.302
Campylobacteraceae	0.16	1.12	0.12	0.14	0.14	0.11	0.43	0.264	0.241	0.285	0.968	0.762	0.929
Succinivibrionaceae	0.05	0.05	0.62	0.11	0.14	0.13	0.18	0.104	0.043	0.101	0.765	0.691	0.355
Acidaminococcaceae	0.18	0.07	0.14	0.14	0.12	0.12	0.05	0.209	0.756	0.262	0.499	0.241	0.329
Staphylococcaceae	0.02	0.01	0.01	0.49	0.00	0.02	0.18	0.192	0.190	0.167	0.067	0.945	0.986
Others	1.74	0.96	1.31	1.52	1.04	1.03	0.37	0.447	0.859	0.189	0.679	0.142	0.180
Relative abundance, %
Lactobacillaceae	22.2	24.7	25.7	25.6	25.5	16.6	5.1	0.812	0.660	0.803	0.618	0.627	0.555
Helicobacteraceae	5.2c	9.3b,c	24.9a	6.4c	11.7	22.9	7.2	0.169	0.111	0.034	0.872	0.372	0.010
Lachnospiraceae	12.2a	8.3a,b	7.1b	10.8a,b	8.7	9.9	1.8	0.965	0.490	0.040	0.586	0.132	0.237
Prevotellaceae	12.9A	9.2A,B	5.4B	9.0A,B	8.7	10.5	2.0	0.968	0.058	0.077	0.159	0.116	0.192
Veillonellaceae	9.5	7.7	5.6	7.5	6.4	8.4	1.2	0.956	0.093	0.125	0.239	0.076	0.290
Bifidobacteriaceae	9.2	4.4	7.6	7.0	9.8	6.7	2.3	0.192	0.822	0.307	0.447	0.847	0.382
Ruminococcaceae	8.1A	5.9A,B	4.1B	6.8A,B	5.8	6.6	1.3	0.838	0.228	0.055	0.461	0.164	0.222
Peptostreptococcaceae	0.7	10.1	5.8	0.3	10.2	0.3	6.3	0.728	0.670	0.179	0.956	0.191	0.925
Streptococcaceae	2.3	2.9	1.1	3.5	1.6	2.7	1.0	0.093	0.742	0.330	0.336	0.756	0.938
Coriobacteriaceae	2.9	1.9	2.1	2.0	1.4	3.2	0.7	0.403	0.626	0.464	0.347	0.097	0.929
Leuconostocaceae	0.5b	0.1b	0.1b	5.5a	0.8	0.1	1.3	0.047	0.047	0.024	0.006	0.900	0.830
Erysipelotrichaceae	1.3	1.1	0.9	1.0	1.2	1.2	0.2	0.752	0.251	0.385	0.299	0.504	0.392
Campylobacteraceae	0.6	4.1	0.5	0.5	0.4	0.5	1.4	0.242	0.214	0.232	0.955	0.779	0.962
Succinivibrionaceae	0.9	1.3	0.7	0.9	0.8	0.8	0.3	0.227	0.197	0.817	0.306	0.887	0.660
Acidaminococcaceae	0.9	0.9	0.6	0.9	0.6	0.9	0.1	0.303	0.418	0.548	0.485	0.543	0.856
Staphylococcaceae	0.2	0.3	1.3	0.6	0.6	0.7	0.9	0.244	0.012	0.185	0.054	0.393	0.083
Others	0.7A,B	0.5B	0.5B	0.6A,B	0.5	0.6	1.5	0.645	0.616	0.052	0.553	0.043	0.327

^a,b,cLeast squares means within a row without a common superscript differ (P < 0.05).

^A,BLeast squares means within a row without a common superscript tend to differ (0.05 < P < 0.10).

¹Each least squares mean represents eight observations.

²Standard error of the mean.

³GOS, effect of GOS supplementation (0.0% and 1.5%); FL, effect of FL supplementation (0.0% and 0.2%); GOS×FL, interaction between GOS and FL supplementation (1.5% and 0.2%, respectively); Con versus GOS+FL, contrast between Con (0.0% and 0.0% GOS and FL, respectively) and GOS+FL (1.5% and 0.2% GOS and FL, respectively); Linear GOS, linear effect of GOS (0.0%, 1.5%, and 2.3%); Linear FL, linear effect of FL (0.0%, 0.2%, and 0.3%).

At the genus level, the supplementation of FL alone increased the absolute abundance of Helicobacter, whereas it was unaffected by FL with GOS (interaction; P < 0.05; Table 6). The supplementation of GOS alone decreased the absolute abundance of Roseburia, whereas it was not affected by GOS with FL (interaction; P < 0.05). The supplementation of FL increased (P < 0.05) the absolute abundance of Anaerovibrio.

Table 6.

Absolute abundance of mucosa-associated microbiota in the jejunum, at the genus level, of nursery pigs fed diets supplemented with different concentrations of galacto-oligosaccharide (GOS) or 2′-fucosyllactose (FL).¹

GOS, %	0.0	1.5	0.0	1.5	2.3	0.0	SEM2	P value3
FL, %	0.0	0.0	0.2	0.2	0.0	0.3		GOS	FL	GOS × FL	Con versus GOS + FL	Linear GOS	Linear FL
Unit, cells × 106
Lactobacillus	5.46	3.26	4.94	4.39	6.34	3.46	1.45	0.336	0.833	0.563	0.594	0.885	0.358
Helicobacter	0.79b	0.95b	8.32a	0.92b	1.43	2.67	1.86	0.052	0.044	0.043	0.960	0.818	0.206
Bifidobacterium	1.74	0.60	1.42	1.00	2.20	1.45	0.61	0.199	0.947	0.546	0.386	0.857	0.707
Romboutsia	0.17	0.44	3.85	0.02	6.89	0.04	3.01	0.536	0.570	0.478	0.971	0.150	0.866
Prevotella	1.43	0.57	0.61	0.85	0.84	0.73	0.44	0.414	0.482	0.159	0.284	0.198	0.151
Blautia	0.87	0.52	0.63	0.85	0.70	0.51	0.33	0.822	0.868	0.315	0.967	0.578	0.373
Megasphaera	0.87	0.50	0.44	0.55	0.99	0.61	0.27	0.631	0.488	0.379	0.407	0.949	0.410
Streptococcus	0.31	0.30	0.22	0.51	0.46	0.52	0.17	0.404	0.713	0.354	0.396	0.582	0.497
Olsenella	0.56	0.16	0.30	0.23	0.34	0.53	0.18	0.197	0.591	0.360	0.198	0.281	0.729
Mitsuokella	0.65	0.23	0.16	0.21	0.34	0.48	0.16	0.260	0.127	0.160	0.063	0.126	0.271
Faecalibacterium	0.43	0.18	0.29	0.30	0.26	0.30	0.13	0.343	0.917	0.281	0.456	0.252	0.414
Weissella	0.09	0.01	0.02	0.62	0.46	0.02	0.24	0.279	0.272	0.167	0.126	0.361	0.824
Campylobacter	0.16	1.12	0.12	0.14	0.14	0.11	0.43	0.264	0.241	0.285	0.968	0.762	0.929
Roseburia	0.47a	0.08b	0.16a,b	0.37a,b	0.21	0.19	0.16	0.497	0.966	0.034	0.610	0.113	0.110
Eubacterium	0.40	0.09	0.19	0.19	0.18	0.23	0.11	0.151	0.579	0.159	0.160	0.095	0.200
Selenomonas	0.60A	0.10B	0.11B	0.21A,B	0.19	0.20	0.18	0.250	0.282	0.097	0.118	0.065	0.073
Subdoligranulum	0.31	0.18	0.15	0.17	0.19	0.15	0.08	0.492	0.287	0.309	0.217	0.239	0.114
Dialister	0.23	0.10	0.05	0.09	0.21	0.15	0.07	0.531	0.171	0.238	0.160	0.672	0.261
Anaerovibrio	0.07	0.07	0.35	0.17	0.14	0.11	0.11	0.334	0.048	0.322	0.456	0.644	0.463
Syntrophococcus	0.07	0.06	0.13	0.07	0.15	0.13	0.04	0.322	0.438	0.574	0.878	0.272	0.278
Dorea	0.14	0.09	0.16	0.09	0.13	0.13	0.06	0.293	0.845	0.884	0.542	0.817	0.945
Staphylococcus	0.02	0.00	0.01	0.49	0.00	0.02	0.18	0.192	0.190	0.167	0.067	0.944	0.986
Others	7.62	3.47	5.28	5.86	5.67	4.41	2.08	0.371	0.990	0.240	0.532	0.357	0.244

^a,bLeast squares means within a row without a common superscript differ (P < 0.05).

^A,BLeast squares means within a row without a common superscript tend to differ (0.05 < P < 0.10).

¹Each least squares mean represents 8 observations.

²Standard error of the mean.

³GOS, effect of GOS supplementation (0.0% and 1.5%); FL, effect of FL supplementation (0.0% and 0.2%); GOS × FL, interaction between GOS and FL supplementation (1.5% and 0.2%, respectively); Con versus GOS+FL, contrast between Con (0.0% and 0.0% GOS and FL, respectively) and GOS + FL (1.5% and 0.2% GOS and FL, respectively); Linear GOS, linear effect of GOS (0.0%, 1.5%, and 2.3%); Linear FL, linear effect of FL (0.0%, 0.2%, and 0.3%).

Increasing levels of GOS linearly increased (P < 0.05) the absolute abundance of Lactobacillus galliarum (Table 7). The supplementation of GOS alone decreased (P < 0.05) the absolute abundance of Lactobacillus johnsonii, whereas it was not affected by GOS with FL (interaction; P < 0.05). The supplementation of GOS alone decreased the absolute abundance of Roseburia faecis, whereas it was not affected by GOS with FL (interaction; P < 0.05). The supplementation of GOS decreased the absolute abundance of Lactobacillus amylovorus (P < 0.05).

Table 7.

Absolute abundance of mucosa-associated microbiota in the jejunum, at the species level, of nursery pigs fed diets supplemented with different concentrations of galacto-oligosaccharide (GOS) or 2′-fucosyllactose (FL).¹

GOS, %	0.0	1.5	0.0	1.5	2.3	0.0	SEM2	P value3
FL, %	0.0	0.0	0.2	0.2	0.0	0.3		GOS	FL	GOS × FL	Con versus GOS+FL	Linear GOS	Linear FL
Unit, cells × 106
Helicobacter rappini	0.67B	0.89B	7.80A	0.77B	1.40	2.35	1.86	0.065	0.059	0.050	0.971	0.789	0.242
Lactobacillus delbrueckii	0.99	0.49	0.62	1.03	1.67	1.39	0.57	0.937	0.880	0.423	0.959	0.540	0.729
Romboutsia ilealis	0.17	0.44	3.85	0.02	6.89	0.04	3.01	0.536	0.570	0.478	0.971	0.150	0.866
Bifidobacterium thermacidophilum-thermophilum	0.89	0.30	0.81	0.62	0.82	0.89	0.33	0.194	0.676	0.496	0.528	0.652	0.967
Limosilactobacillus mucosae	0.89	0.50	0.63	0.48	0.84	0.40	0.23	0.243	0.532	0.615	0.207	0.692	0.143
Prevotella copri	1.24	0.54	0.55	0.75	0.76	0.69	0.39	0.458	0.476	0.186	0.305	0.231	0.188
Blautia wexlerae	0.59	0.38	0.42	0.66	0.55	0.35	0.25	0.932	0.822	0.320	0.826	0.792	0.441
Bifidobacterium boum	0.70	0.18	0.27	0.30	0.47	0.30	0.17	0.167	0.378	0.118	0.112	0.204	0.074
Lactobacillus gallinarum	0.01	0.65	0.03	0.24	1.38	0.03	0.44	0.273	0.614	0.582	0.672	0.018	0.968
Lactobacillus johnsonii	0.39a,b	0.17b	0.12b	0.95a	0.42	0.17	0.27	0.191	0.286	0.030	0.096	0.944	0.454
Bifidobacterium dentium	0.15	0.12	0.33	0.08	0.91	0.27	0.35	0.684	0.843	0.738	0.882	0.187	0.770
Olsenella profusa	0.49	0.10	0.22	0.15	0.26	0.47	0.16	0.146	0.478	0.328	0.128	0.210	0.757
Mitsuokella multacida	0.49	0.20	0.11	0.16	0.22	0.39	0.14	0.413	0.142	0.251	0.108	0.155	0.407
Faecalibacterium prausnitzii	0.41	0.18	0.26	0.29	0.26	0.29	0.13	0.398	0.887	0.271	0.485	0.269	0.422
Helicobacter equorum	0.10	0.05	0.51	0.05	0.02	0.32	0.23	0.290	0.379	0.386	0.898	0.828	0.395
Weissella thailandensis	0.06	0.01	0.01	0.37	0.46	0.02	0.19	0.436	0.432	0.301	0.270	0.226	0.853
Eubacterium rectale	0.37	0.09	0.18	0.18	0.18	0.22	0.10	0.163	0.634	0.168	0.186	0.111	0.223
Roseburia faecis	0.38a	0.06b	0.12a,b	0.34a,b	0.18	0.15	0.14	0.675	0.938	0.029	0.809	0.163	0.137
Campylobacter hyointestinalis	0.04	1.06	0.02	0.03	0.03	0.02	0.43	0.231	0.223	0.244	0.987	0.722	0.970
Dialister succinatiphilus	0.23	0.10	0.05	0.09	0.21	0.15	0.07	0.531	0.171	0.238	0.160	0.672	0.261
Selenomonas bovis	0.37	0.08	0.06	0.19	0.04	0.10	0.14	0.537	0.466	0.130	0.342	0.070	0.116
Lactobacillus amylovorus	0.21	0.02	0.38	0.05	0.00	0.03	0.09	0.010	0.303	0.465	0.244	0.110	0.390
Others	13.65	6.44	10.54	10.49	10.52	8.12	3.46	0.286	0.889	0.294	0.510	0.370	0.253

^a,bLeast squares means within a row without a common superscript differ (P < 0.05).

^A,BLeast squares means within a row without a common superscript tend to differ (0.05 < P < 0.10).

¹Each least squares mean represents eight observations.

²Standard error of the mean.

³GOS, effect of GOS supplementation (0.0% and 1.5%); FL, effect of FL supplementation (0.0% and 0.2%); GOS×FL, interaction between GOS and FL supplementation (1.5% and 0.2%, respectively); Con versus GOS+FL, contrast between Con (0.0% and 0.0% GOS and FL, respectively) and GOS+FL (1.5% and 0.2% GOS and FL, respectively); Linear GOS, linear effect of GOS (0.0%, 1.5%, and 2.3%); Linear FL, linear effect of FL (0.0%, 0.2%, and 0.3%).

mRNA expression of genes in jejunal tissue

The supplementation of GOS tended to increase (P = 0.098) the gene expression of TLR2, whereas the supplementation of FL decreased (P < 0.05) the gene expression of TLR2 (Table 8). The supplementation FL increased (P < 0.05) the gene expression of TLR4. Similarly, the supplementation of GOS with FL tended to reduce (P = 0.053) the expression of TLR4 compared with the control. Increasing levels of either GOS or FL tended to linearly decrease (P = 0.051 or 0.076, respectively) the gene expression of TLR4. The supplementation of GOS increased (P < 0.05) the gene expression of NOD1. The increasing levels of GOS tended to decrease (P = 0.082) the gene expression of CD14, whereas the increasing levels of FL decreased (P < 0.05) the gene expression of CD14. Finally, increasing levels of GOS tended to linearly decrease (P = 0.099) the gene expression of mTOR.

Table 8.

Relative gene expression in jejunal tissue of nursery pigs fed diets supplemented with different concentrations of galacto-oligosaccharide (GOS) or 2′-fucosyllactose (FL).¹

GOS, %	0.0	1.5	0.0	1.5	2.3	0.0	SEM2	P value3
FL, %	0.0	0.0	0.2	0.2	0.0	0.3		GOS	FL	GOS × FL	Con versus GOS + FL	Linear GOS	Linear FL
Toll-like receptor 2	1.00	1.19	0.74	0.95	0.90	0.89	0.11	0.098	0.037	0.969	0.727	0.782	0.344
Toll-like receptor 4	1.01	0.70	0.39	0.50	0.50	0.62	0.21	0.565	0.021	0.226	0.053	0.051	0.076
NOD14	1.00	1.42	0.76	1.26	1.06	0.81	0.15	0.002	0.162	0.762	0.182	0.489	0.261
NOD2	1.00	1.28	1.10	1.26	1.13	0.88	0.12	0.165	0.942	0.356	0.348	0.285	0.629
CD145	1.00	0.99	0.74	0.88	0.68	0.60	0.14	0.541	0.132	0.893	0.135	0.082	0.017
Interferon-γ	0.99	0.92	0.79	0.68	0.66	0.89	0.16	0.184	0.843	0.180	0.411	0.169	0.524
NF-κB6	1.00	1.10	0.94	0.95	0.96	1.03	0.09	0.262	0.371	0.468	0.874	0.884	0.922
mTOR7	1.00	1.00	0.90	1.07	0.83	0.98	0.08	0.272	0.184	0.264	0.863	0.099	0.645
Occludin	1.00	1.20	0.98	1.03	0.98	1.00	0.11	0.383	0.285	0.386	0.189	0.872	0.980
Claudin	1.00	1.01	1.72	1.07	1.30	1.28	0.28	0.502	0.164	0.527	0.625	0.512	0.322
Zonula occludens-1	1.00	1.00	1.02	1.17	0.96	1.09	0.09	0.563	0.113	0.532	0.475	0.776	0.499

¹Each least squares mean represents 8 observations.

²Standard error of the mean.

³GOS, effect of GOS supplementation (0.0 and 1.5%); FL, effect of FL supplementation (0.0 and 0.2%); GOS×FL, interaction between GOS and FL supplementation (1.5 and 0.2%, respectively); Con vs. GOS+FL, contrast between Con (0.0 and 0.0% GOS and FL, respectively) and GOS+FL (1.5 and 0.2% GOS and FL, respectively); Linear GOS, linear effect of GOS (0.0, 1.5, and 2.3%); Linear FL, linear effect of FL (0.0, 0.2, and 0.3%).

⁴Nucleotide binding oligomerization domain containing.

⁵Cluster of differentiation.

⁶Nuclear factor-κB.

⁷Mammalian target of rapamycin.

Oxidative stress status, humoral immune status, and intestinal inflammatory status

Dietary treatments had no effect on the products of oxidative damage or immune responses in the jejunum of nursery pigs (Table 9).

Table 9.

Products of oxidative damage and immune response of nursery pigs fed diets supplemented with different concentrations of galacto-oligosaccharide (GOS) or 2′-fucosyllactose (FL).¹

GOS, %	0.0	1.5	0.0	1.5	2.3	0.0	SEM2	P value3
FL, %	0.0	0.0	0.2	0.2	0.0	0.3		GOS	FL	GOS×FL	Con versus GOS+FL	Linear GOS	Linear FL
Unit/mg protein
MDA4, nmol 4	0.30	0.62	0.40	0.32	0.40	0.30	0.14	0.328	0.432	0.120	0.882	0.385	0.892
PC5, nmol 5	3.16	2.92	3.42	2.89	2.72	3.35	0.39	0.295	0.751	0.689	0.817	0.407	0.657
IgA, µg	1.22	1.57	1.42	1.29	1.55	1.84	0.32	0.736	0.896	0.465	0.805	0.426	0.233
IgG, µg	0.99	0.94	1.06	0.92	0.72	1.15	0.22	0.661	0.911	0.842	0.602	0.407	0.605
TNF-α, pg	2.48	3.91	3.39	3.00	3.97	3.53	0.70	0.440	1.000	0.181	0.893	0.112	0.255
IL-6, pg	12.3	19.5	19.7	14.2	19.4	18.6	5.5	0.877	0.851	0.266	0.603	0.351	0.367
IL-8, pg	0.49	0.43	0.52	0.45	0.48	0.49	0.06	0.267	0.704	0.914	0.591	0.762	0.927

¹Each least squares mean represents eight observations.

²Standard error of the mean.

³GOS, effect of GOS supplementation (0.0% and 1.5%); FL, effect of FL supplementation (0.0% and 0.2%); GOS×FL, interaction between GOS and FL supplementation (1.5% and 0.2%, respectively); Con versus GOS+FL, contrast between Con (0.0% and 0.0% GOS and FL, respectively) and GOS+FL (1.5% and 0.2% GOS and FL, respectively); Linear GOS, linear effect of GOS (0.0%, 1.5%, and 2.3%); Linear FL, linear effect of FL (0.0%, 0.2%, and 0.3%).

⁴Malondialdehyde.

⁵Protein carbonyl.

Intestinal morphology and crypt cell proliferation

The supplementation of GOS alone decreased the villus height in the jejunum, whereas it was not affected by GOS with FL (interaction; P < 0.05; Table 10). The supplementation of FL increased the crypt depth in the jejunum (P < 0.05). The supplementation of GOS or FL tended to decrease the VH: CD, whereas it was not affected by GOS with FL (interaction; P = 0.054). Increasing levels of GOS tended to linearly increase (P = 0.054) and increasing levels of FL linearly increased (P < 0.05) the Ki-67 proliferative cell count in the crypt of the jejunum.

Table 10.

Intestinal morphology in jejunal tissue of nursery pigs fed diets supplemented with different concentrations of galacto-oligosaccharide (GOS) or 2′-fucosyllactose (FL).¹

GOS, %	0.0	1.5	0.0	1.5	2.3	0.0	SEM2	P value3
FL, %	0.0	0.0	0.2	0.2	0.0	0.3		GOS	FL	GOS × FL	Con versus GOS + FL	Linear GOS	Linear FL
Villus height, µm	558a	475b	522a,b	570a	544	526	20	0.356	0.121	0.001	0.642	0.275	0.173
Crypt depth, µm	220	205	227	233	217	223	7	0.503	0.011	0.127	0.157	0.579	0.656
VH: CD4	2.6A	2.3B	2.3B	2.5A,B	2.5	2.4	0.1	0.431	0.466	0.054	0.278	0.300	0.105
Ki-67+,5 count	65	76	76	77	78	80	4	0.211	0.159	0.266	0.865	0.054	0.018
Ki-67+,5 %	61	58	54	62	51	60	4	0.621	0.792	0.228	0.865	0.136	0.768

^a,bLeast squares means within a row without a common superscript differ (P < 0.05).

^A,BLeast squares means within a row without a common superscript tend to differ (0.05 < P < 0.10).

¹Each least squares mean represents eight observations.

²Standard error of the mean.

³GOS, effect of GOS supplementation (0.0% and 1.5%); FL, effect of FL supplementation (0.0% and 0.2%); GOS×FL, interaction between GOS and FL supplementation (1.5% and 0.2%, respectively); Con versus GOS+FL, contrast between Con (0.0% and 0.0% GOS and FL, respectively) and GOS+FL (1.5% and 0.2% GOS and FL, respectively); Linear GOS, linear effect of GOS (0.0%, 1.5%, and 2.3%); Linear FL, linear effect of FL (0.0%, 0.2%, and 0.3%).

⁴Villus height to crypt depth ratio.

⁵Number of Ki-67 positive cells in the crypt.

⁶Number of Ki-67 positive cells to total cells in the crypt, as a percentage.

Growth performance and fecal score

The supplementation of GOS tended to increase (P = 0.079) and increased (P < 0.05) the BW of pigs on d 13 and d 21 of the experimental period, respectively (Table 11). The supplementation of GOS with FL tended to increase (P = 0.090) the BW of pigs on d 6, and increased (P < 0.05) BW on d 13 and 21, when compared with the control. Increasing levels of GOS linearly increased (P < 0.05) the BW of pigs on d 6 and 13 and tended to linearly increase (P = 0.093) the BW of pigs on d 21 of the experimental period. Supplementation of GOS alone did not affect ADG of pigs from d 6 to 21, whereas GOS with FL tended to increase ADG (interaction; P = 0.099). Supplementation of GOS with FL tended to increase ADG from d 0 to 6 and d 6 to 21 (P = 0.092 and 0.074, respectively) and increased (P < 0.05) the ADG of pigs in the overall experimental period, when compared to the control. Increasing levels of GOS linearly increased (P < 0.05) the ADG of pigs from d 0 to 6 and tended to linearly increase (P = 0.098) the ADG of pigs in the overall experimental period. The supplementation of GOS tended to increase (P = 0.050) the ADFI of pigs from d 0 to 6. The supplementation of GOS alone did not affect ADFI of pigs from d 6 to 21 and the overall experimental period compared with FL alone, whereas it was increased by GOS with FL (interaction; P < 0.05). The supplementation of GOS with FL tended to increase (P = 0.053) ADFI from d 0 to 6 when compared with the control. Similarly, the supplementation of GOS with FL increased (P < 0.05) the ADFI of pigs from d 6 to 21 and in the overall experimental period, when compared with the control. Increasing levels of GOS tended to linearly increase (P = 0.067) ADFI from d 0 to 6. The supplementation of GOS tended to improve (P = 0.077) G:F. The supplementation of GOS without FL had no effect on fecal score, whereas fecal score was decreased with GOS and FL from d 0 to 6 compared to FL alone (interaction; P < 0.05). The increasing levels of FL tended to decrease (P = 0.077) fecal score in the overall experimental period.

Table 11.

Growth performance and fecal score of nursery pigs fed diets supplemented with different concentrations of galacto-oligosaccharide (GOS) or 2′-fucosyllactose (FL).¹

GOS, %	0.0	1.5	0.0	1.5	2.3	0.0	SEM2	P value3
FL, %	0.0	0.0	0.2	0.2	0.0	0.3		GOS	FL	GOS×FL	Con versus GOS+FL	Linear GOS	Linear FL
BW, kg
d 0	6.8	6.8	6.8	6.8	6.8	6.8	0.2	0.963	0.988	0.938	0.983	0.864	0.812
d 6	7.0	7.2	7.0	7.3	7.6	7.2	0.2	0.115	0.401	0.766	0.090	0.009	0.232
d 13	7.9	8.3	8.1	8.8	9.1	8.3	0.3	0.079	0.222	0.594	0.038	0.012	0.321
d 21	11.5	11.7	11.3	12.9	12.7	11.9	0.4	0.042	0.325	0.129	0.035	0.093	0.685
ADG, g/d
d 0 to 6 (P1)	34	66	47	97	137	76	27	0.12	0.396	0.735	0.092	0.011	0.282
d 6 to 21 (P2)	303A,B	306A,B	281B	368A	338	308	25	0.082	0.422	0.099	0.074	0.386	0.981
d 0 to 21 (overall)	226	237	214	290	280	241	21	0.042	0.322	0.124	0.034	0.098	0.716
ADFI, g/d
d 0 to 6 (P1)	94	123	100	148	145	129	19	0.050	0.425	0.622	0.053	0.067	0.246
d 6 to 21 (P2)	431b,c	419b,c	394c	534a	500	452	31	0.043	0.211	0.017	0.023	0.192	0.814
d 0 to 21 (overall)	335b,c	334b,c	310c	423a	398	360	25	0.028	0.204	0.027	0.016	0.123	0.645
G: F
d 0 to 6 (P1)	0.29	0.73	−0.07	0.61	0.92	0.55	0.31	0.077	0.439	0.693	0.469	0.148	0.746
d 6 to 21 (P2)	0.70	0.73	0.71	0.70	0.67	0.69	0.04	0.811	0.718	0.602	0.931	0.690	0.829
d 0 to 21 (overall)	0.67	0.71	0.68	0.69	0.70	0.68	0.04	0.533	0.822	0.644	0.778	0.505	0.888
Fecal score
d 0 to 6 (P1)	3.3a,b	3.1b	3.7a	3.2b	3.4	3.1	0.2	0.423	0.204	0.022	0.145	0.889	0.249
d 6 to 21 (P2)	3.6	3.5	3.7	3.5	3.5	3.4	0.1	0.954	0.811	0.234	0.833	0.210	0.118
d 0 to 21 (overall)	3.6	3.5	3.7	3.5	3.4	3.3	0.1	0.880	0.539	0.110	0.588	0.224	0.077

^a,b,cLeast squares means within a row without a common superscript differ (P < 0.05).

^A,BLeast squares means within a row without a common superscript tend to differ (0.05 < P < 0.10).

¹Each least squares mean represents eight observations.

²Standard error of the mean.

³GOS, effect of GOS supplementation (0.0% and 1.5%); FL, effect of FL supplementation (0.0% and 0.2%); GOS×FL, interaction between GOS and FL supplementation (1.5% and 0.2%, respectively); Con versus GOS+FL, contrast between Con (0.0% and 0.0% GOS and FL, respectively) and GOS+FL (1.5% and 0.2% GOS and FL, respectively); Linear GOS, linear effect of GOS (0.0%, 1.5%, and 2.3%); Linear FL, linear effect of FL (0.0%, 0.2%, and 0.3%).

Discussion

Weaning is a challenging period for young pigs, marked by substantial changes to the intestinal environment. The intestinal microbiota plays a central role in intestinal health, and early establishment of a functional microbiota is closely linked to the development of intestinal and immune functions (Duarte and Kim 2022). Among the spatial niches of the intestinal microbiota, the mucosa-associated microbiota exerts particularly strong effects on host responses due to its proximity to the intestinal epithelium (Belkaid and Hand 2014; Adhikari et al. 2019). Prior to weaning, piglets consume MO via sow milk, which act as prebiotics and can support development and maintenance of a commensal mucosa-associated microbiota (Ruiz-Palacios et al. 2003; Coppa et al. 2006). After weaning, MO intake is largely derived from bovine milk co-products, which contain lower concentrations and a different composition of MO compared with porcine milk. Moreover, dried bovine milk co-products comprise only a portion of nursery pig diets, whereas porcine milk serves as the primary source of nutrition for suckling pigs. As a result, weaned pigs experience a marked reduction in MO consumption compared with suckling pigs.

Alpha diversity metrics describe the richness, evenness, and phylogenetic diversity of microbial taxa within a population (Chao 1984; Simpson 1949; Lemos et al. 2011). Previous studies have associated increased alpha diversity with improved physiological outcomes in nursery pigs (Duarte et al. 2020; Moita et al. 2021). However, the functional relevance of microbial diversity is recognized as context dependent. In humans, responses of microbial diversity to dietary interventions vary significantly between individuals and are strongly influenced by host phenotype, independent of diet and environment (Cotillard et al. 2013; Le Chatelier et al. 2013). In this article, the increasing dietary levels of GOS and FL in the diets of nursery pigs reduced the alpha diversity of the jejunal mucosa-associated microbiota, which may reflect selective utilization of these prebiotics by specific microbial populations, potentially leading to competitive exclusion and decreased alpha diversity. Notably, the combined supplementation of GOS and FL at physiologically relevant levels did not alter microbial diversity compared to pigs fed diets without supplemental MO. This suggests that concurrent provision of varied prebiotic sources could prevent dominance of a particular taxa driven by a single prebiotic source.

Beta diversity metrics, which assess differences in microbial community composition between populations, can provide complementary information to alpha diversity by capturing shifts in the overall community structure (Vellend 2010). In the present study, pairwise comparisons of beta diversity based on Bray–Curtis distance revealed a significant difference between the control diet and the diet containing FL alone. This separation may have been influenced by the substantially greater absolute and relative abundance of Helicobacteraceae observed in pigs fed FL alone compared with the other treatments (P < 0.05; data not shown).

Although relative abundance is commonly used to characterize intestinal microbial communities, the relative abundance of a taxon depends on the abundance of all other taxa within a sample (Aitchison 1982; Bruijning et al. 2023). In contrast, absolute abundance is not influenced by the presence of other taxa, allowing for more objective comparisons among dietary treatments and across studies. In this study, supplementation with FL at 0.2% of the diet increased the absolute abundance of Helicobacter in the jejunal mucosa-associated microbiota. The absence of a linear response, combined with the relatively minor difference in absolute abundance across the treatments, indicates that this finding may reflect inter-individual variation rather than a strong dietary effect. These results suggest that supplementation with GOS and FL at the levels evaluated exerted only modest effects on the absolute and relative abundance of jejunal mucosa-associated bacterial taxa, which contrasts with expectations based on previous studies (Wu et al. 2017; Boston et al. 2024).

The findings of this study regarding intestinal microbiota and immune activation are generally consistent with previous work evaluating MO in pigs as translational models for early-life nutrition. Prior studies using porcine models have demonstrated that MO can shape the development of microbial communities and influence immune development (Monaco et al. 2023; Boston et al. 2024; Daniels et al. 2024). The comparatively modest responses observed in the present study may be attributable to differences in analytical approach, including the use of relative versus absolute abundance measures, as well as differences in intestinal sampling site and experimental design. In addition, most of the previous work has been conducted in suckling pigs, whereas the present study was performed in nursery pigs, which possess a more mature and ecologically diverse microbiota that may respond differently to dietary MO supplementation.

Despite only modest shifts in the bacterial taxa of the jejunal mucosa-associated microbiota, changes were observed in the gene expression of pattern recognition receptors involved in microbial sensing. Increasing levels of GOS and FL were associated with decreased gene expression of TLR4, a receptor primarily associated with the recognition of lipopolysaccharides derived from gram-negative bacteria (Pålsson‐McDermott and O’Neill 2004), along with a simultaneous decrease in CD14 expression, a key co-receptor of TLR4 signaling (Zanoni and Granucci 2013). These findings suggest that subtle changes in the mucosa-associated microbiota or microbiota-derived signaling molecules may be sufficient to modulate epithelial immune sensing in the jejunum. Furthermore, measures of microbial diversity do not capture spatial rearrangements of the microbiota, suggesting that GOS and FL may have altered the proximity of select microbial communities to key signaling receptors of the jejunal mucosa. Importantly, changes in receptor expression may not directly translate to downstream inflammatory responses, due to post-translational modification and regulation. The oxidative damage products and inflammatory markers measured in this article reflect baseline physiological conditions in the absence of an intestinal environmental or immunological challenge. Under such conditions, inflammatory and oxidative responses may differ substantially. This may explain why alterations in TLR4 and CD14 expression were not accompanied by changes in oxidative damage products or inflammatory markers in this article (Liu et al. 2012; Chen et al. 2025).

Decreased villus heigh is often interpreted as a reduction in absorptive surface area (Wang et al. 2020), however, maintenance of the intestinal barrier and structure is a dynamic balance between epithelial cell death and renewal (Günther et al. 2013). The supplementation of GOS without FL reduced the villus height in the jejunum, but this effect was not observed when GOS was provided in combination with FL. Despite this reduction, villus height remained within physiological reference ranges reported for nursery pigs (Kim et al. 2026), suggesting that the observed changes were unlikely to be detrimental to intestinal function, which is further supported by the lack of adverse effects and the observed improvements in growth performance. Interestingly, the increasing levels of GOS or FL increased the Ki-67 proliferative cell count in the jejunal crypt, indicating enhanced epithelial cell proliferation. Together these findings suggest that GOS and FL may increase epithelial turnover of jejunal tissue, and the elevated crypt cell proliferation could initially contribute to decreased villus height during a remodeling phase. It is possible that an extended feeding period may result in a corresponding increase in villus height, as increased stem cell proliferation would precede lengthening of the villus. In fact, the provision of MO, particularly GOS, improved several growth performance metrics compared to diets without supplemental MO, with the combined use of GOS and FL showing the greatest improvements in ADG and ADFI. Although the mechanism by which feed intake was improved in pigs fed supplemental MO was not directly assessed, this study suggests that MO may influence post-weaning intestinal adaptation and feeding behavior through interactions with the intestinal microbiota (Fleming et al. 2021).

In conclusion, supplementation with GOS and FL can improve key aspects of intestinal health and growth. Although modest shifts were observed related to the diversity and composition of the jejunal mucosa-associated microbiota, supplementation with GOS or FL altered the expression of pattern recognition receptors involved in pathogen sensing and immune activation. Both GOS and FL also promoted intestinal stem cell proliferation which could potentially improve intestinal morphology with an extended feeding period. Collectively, these results suggest that GOS and FL provided at physiologically relevant levels, can support intestinal development, reduce inflammatory receptor activation, and improve growth performance in the post-weaning period. Notably, increasing supplementation of GOS had consistent linear effects on growth performance, but the combined use of GOS and FL provided the most consistent benefits related to overall jejunal function and growth promotion in nursery pigs.

Glossary

Abbreviations

ADFI

average daily feed intake

ADG

average daily gain

BW

body weight

FL

2′-fucosyllactose

GAPDH

glyceraldehyde-3-phosphate dehydrogenase

G:F

gain to feed ratio

GOS

galacto-oligosaccharides

IFN-γ

interferon γ

IgA

immunoglobulin A

IgG

immunoglobulin G

IL-8

interleukin-8

IL-6

interleukin-6

MDA

malondialdehyde

MO

milk oligosaccharides

mTOR

mammalian target of rapamycin

NF-kB

nuclear factor-κB

NOD1

nucleotide binding oligomerization domain containing 1

NOD2

nucleotide binding oligomerization domain containing 2

PBS

phosphate buffered saline

PC

protein carbonyl

SID

standardized ileal digestible

STTD

standardized total tract digestible

TLR2

Toll-like receptor 2

TLR4

Toll-like receptor 4

TNF-α

tumor necrosis factor alpha

VH:CD

villus height to crypt depth ratio

ZO-1

zonula occludens-1

Author contributions

Alexa R. Gormley (Data curation, Formal analysis, Investigation, Writing—original draft, Writing—review & editing), Jung Yeol Sung (Data curation, Formal analysis, Investigation, Writing—original draft, Writing—review & editing), and Sung Woo Kim (Conceptualization, Funding acquisition, Methodology, Project administration, Resources, Supervision, Validation, Writing—original draft, Writing—review & editing)

Conflict of interest statement. The authors declare no real or perceived conflicts of interest.