Dietary taurine-mediated alleviation of post–hatch transport stress in broilers: Improvements in growth, antioxidant status, and intestinal barrier integrity linked to gut microbiota modulation

Abstract

This study investigated the effects of dietary taurine (Tau) supplementation on growth performance, antioxidant capacity, intestinal barrier function, and gut microbiota in yellow-feathered broilers exposed to post–hatch transport stress (TS). A total of 180 one-d-old chicks (initial body weight 35.93 ± 0.26 g) were randomly divided into five treatments, with six replicates each group and six birds each replicate, including control, TS, TS + 0.25% Tau, TS + 0.50% Tau, and TS + 0.75% Tau. The experiment lasted for two weeks. Compared with the control, post–hatch TS reduced final body weight (BW), average daily gain (ADG), plasma catalase (CAT) activity, and villus height (VH) in duodenum and ileum at d 7, while increasing plasma aspartate aminotransferase (AST) activity, cortisol level at d 7 and jejunal relative mRNA expression levels of HSP40, HSP70, and HSP90 (P < 0.05). Compared with the TS group, dietary Tau supplementation significantly increased final BW, ADG, plasma glucose level at d 14, CAT activity, duodenal VH at d 7, but decreased plasma AST activity and duodenal crypt depth at d 14 (P < 0.05). Meanwhile, compared with the TS group, the relative mRNA expression levels of TJP1, TJP2, LC3Ⅰ, LC3Ⅱ, and PRKN in the jejunum were upregulated, and the jejunal relative mRNA expression levels of HSP40 were downregulated by TS + 0.50% Tau (P < 0.05). Compared with the TS group, the gut microbiome analysis revealed that TS + 0.50% Tau significantly improved the cecal microbial Shannon and Simpson indexes (P < 0.05). Compared with TS group, dietary Tau supplementation increased the relative abundance of Firmicutes at d 7, Defluviitaleaceae_UCG-011, Shuttleworthia, and Subdoligranulumat at d 14, and decreased the relative abundance of Proteobacteria at d 7 and 14 (P < 0.05). Spearman correlation analysis revealed that the ADG during d 1 to 14 and plasma CAT activity positively correlated with the relative abundance of Shuttleworthia and Defluviitaleaceae_UCG-011, while plasma CAT activity and LC3Ⅰ and LC3Ⅱ relative mRNA expression negatively correlated with the relative abundance of Proteobacteria and Escherichia-Shigella (P < 0.05). Collectively, dietary Tau supplementation improved growth performance, antioxidant capacity, and intestinal barrier integrity in yellow-feathered broilers subjected to post–hatch TS, which might be linked to the alterations of gut microbiota.

1. Introduction

Transportation is an indispensable component in the modern intensive poultry industry, encompassing both post–hatch transfer and pre-slaughter handling. Post–hatch transport stress (TS) exposes chicks to a myriad of challenges, including feed and water deprivation, thermal fluctuations, and physical vibrations, which collectively disrupt physiological homeostasis (Mitchell and Kettlewell, 2008). A critical consequence of this disruption is the induction of systemic and tissue-specific oxidative stress, which disrupts the redox balance in broiler chicks (Huang et al., 2025; Sun et al., 2025; Xu et al., 2022). The gastrointestinal tract is particularly vulnerable, as oxidative stress directly impairs intestinal barrier integrity (Qiao et al., 2022) and perturbs the gut microbiota (Lee et al., 2025), collectively undermining growth performance and health. Emerging evidence indicates that early-life TS significantly impacts chick development, manifesting as reduced body weight (BW) (Xu et al., 2022) and increased first-week mortality (Yerpes et al., 2021). Consequently, nutritional interventions have emerged as a key strategy to mitigate TS-induced adverse effects (He et al., 2022; Zhang et al., 2019). While significant research has focused on mitigating pre-slaughter TS in market-age broilers (Gou et al., 2021; Zanetti et al., 2011; Zhang et al., 2017, 2022), investigations into using antioxidant bioactive compounds to counteract the oxidative stress and intestinal barrier disruption caused by post–hatch TS in newly hatched chicks remain limited.

Taurine (Tau), a sulfur-containing non-protein amino acid abundant in animal tissues, plays a vital role in antioxidant defense, osmoregulation, ion balance, and energy metabolism (Schaffer and Kim, 2018). Dietary Tau supplementation has been well demonstrated to effectively alleviate various stress responses, including oxidative stress (Zhang et al., 2021), heat stress (Li et al., 2023), and immune stress (Han et al., 2020; Kim and Cha, 2014). Moreover, in ovo injection of Tau significantly enhanced antioxidant capacity and the content of bioactive peptides in chicken embryos (Łukasiewicz Mierzejewska et al., 2024). Notably, Tau contributes to cellular stress adaptation through mitochondrial quality control, particularly by regulating mitophagy to eliminate damaged mitochondria and attenuate oxidative injury (San et al., 2023). Given that TS can induce mitochondrial dysfunction in intestinal epithelial cells and disrupt barrier integrity (He et al., 2019), the current study proposed that Tau might alleviate TS-related damage partly through supporting mitophagy.

Furthermore, gut microbiota plays a pivotal role in host health by regulating physiological functions and immune modulation (Kosiewicz et al., 2011). Stressors such as TS are known to disturb microbial composition in several species, including Dezhou donkeys (Jiang et al., 2021), calf (Vinayamohan et al., 2024), and growing pigs (Dang and Kim, 2021). Importantly, dietary nutritional intervention can restore microbial homeostasis and alleviate TS-induced oxidative stress and inflammatory response (He et al., 2023). Taurine may influence gut microbiota by serving as a metabolic substrate or signaling molecule for certain beneficial bacteria, and as a precursor for taurine-conjugated bile acids which shape microbial community structure (Duszka, 2022; Jia et al., 2018; Qian et al., 2023; Winston and Theriot, 2020). Thus, the current study further hypothesized that Tau-mediated protection against post–hatch TS in broilers might also be linked to the alterations of gut microbiota.

Chinese yellow-feathered broilers are particularly susceptible to TS due to their distinct physiological characteristics, often manifesting as reduced BW and oxidative stress (Gou et al., 2021). This study therefore aimed to evaluate whether dietary Tau supplementation could improve growth, antioxidant capacity, and intestinal barrier function in yellow-feathered broilers subjected to post–hatch TS, and to examine its potential associations with gut microbiota and mitophagy-related markers.

2. Materials and methods

2.1. Animal ethics statement

The experimental protocol of the animal study was reviewed and approved by the Animal Care and Use Committee of Foshan University (FOSU2022004).

2.2. Experimental design, diet and management

A total of 180 one-d-old Lingnan Yellow-feathered male broiler chicks were randomly allotted to five treatments (six replicates per treatment, six birds per replicate): control (no TS), TS (TS only), TS + 0.25% Tau, TS + 0.50% Tau, and TS + 0.75% Tau. Dietary Tau supplementation levels were based on a previous study (Han et al., 2020). All chicks were initially transferred from the hatchery to the experimental facility within 10 min. The control group was then kept in a warm box maintaining at 29 °C, while the other four groups underwent 5 h of road transport at an average speed of 70 km/h (vehicle conditions: 29 °C, 68% relative humidity). After transport, all birds were returned to the same facility and provided feed and water ad libitum. The basal diet (Table 1) was formulated according to the nutrient requirements for yellow broilers recommended by the Ministry of Agriculture and Rural Affairs of the People's Republic of China (2020). Taurine (purity ≥ 98.5%; Qianjiang Yongan Pharmaceutical Co., Ltd., Qianjiang, Hubei, China) was added to the respective treatment diets. Crude protein (method 990.03), dry matter (934.01), calcium (method 968.08), and phosphorus (method 985.01) contents of the basal diet was analyzed following the Association of Official Analytical Chemists (AOAC, 2012). Apparent metabolizable energy, L-lysine, DL-methionine and L-threonine were calculated in accordance with NY/T 3645-2020 (Ministry of Agriculture and Rural Affairs of the People's Republic of China, 2020). The organic matter content was determined as the difference between dry matter and crude ash content. All birds had free access to feed and water during the whole experimental period for 14 d.

Table 1.

Ingredients and nutrient levels of the basal diet (air-dry basis, %).

Items	Content
Ingredients
Corn	44.50
Soybean meal	33.50
Extruded soybean	5.00
Sorghum	10.00
Lard	1.50
Fishmeal	1.30
CaHPO4	1.30
Limestone	1.40
L-Lysine hydrochloride (98.5%)	0.25
DL-Methionine (99%)	0.23
L-Threonine (98%)	0.05
Premix1	0.71
NaCl	0.12
Choline (50%)	0.12
Antioxidants2	0.01
Phytase3	0.01
Total	100.00
Nutrients4
Apparent metabolizable energy, MJ/kg	12.04
Dry matter	88.47
Crude protein	20.14
Organic matter	83.22
Calcium	1.00
Phosphorus	0.60
L-Lysine	1.39
DL-Methionine	0.56
L-Threonine	0.88

¹The premix provided per kg of the diet: VA, 12,000 IU, VD₃ 3000 IU, VE, 10 IU, VK₃, 2 mg, VB₁, 1 mg, VB₂, 3 mg, VB₆, 2 mg, VB₁₂, 0.01 mg, niacin, 20 mg, calcium pantothenate, 4 mg, folic acid, 1 mg, biotin, 0.05 mg, Fe, 100 mg, Cu, 20 mg, Mn, 100 mg, Zn, 80 mg, I, 3 mg, Se, 0.5 mg.

²Antioxidants provided by Shandong Zhongmu Jiarui Biotechnology Development Co., Ltd. (Jinan, Shandong, China), are mainly composed of butylated hydroxytoluene (BHT, 10%-15%), tert-butylhydroquinone (TBHQ, 1.5%-5%), and citric acid, with silicon dioxide and zeolite powder as carriers.

³Provided per kg of diets: 20,000 U/g.

⁴Dry matter, crude protein, calcium, and phosphorus were analyzed values, while the others were calculated values.

2.3. Sample collection and determinations

2.3.1. Weight loss, rectal temperature, and heart rate

All the broilers were weighed on a replicate basis before and after transportation to calculate the weight loss per bird within each replicate during transportation. Moreover, one broiler from each replicate in both control group and TS group was randomly selected to measure the rectal temperature and heart rate after transportation.

2.3.2. Growth performance

The weight and feed consumption of broilers were recorded at d 1, 7, and 14 based on a replicate cage. Average daily gain (ADG), average daily feed intake (ADFI) and feed to gain ratio (F/G) during these stages were calculated accordingly.

2.3.3. Plasma biochemical parameters and cortisol level

At d 7 and 14 of the trial after fasting for 12 h, one broiler close to the average BW in each replicate was selected for blood collection. Blood was collected through the wing vein, and centrifuged at 996 × g at 4 °C for 15 min to obtain plasma samples followed by storage at −80 °C. The activities of alkaline phosphatase (AKP; A059-2-2), alanine aminotransferase (ALT; C009-2-1), aspartate aminotransferase (AST; C010-2-1), and lactate dehydrogenase (LDH; A020-2-2), as well as the concentrations of total cholesterol (TC; A111-1-1), triglyceride (TG; A110-1-1), total protein (TP; A045-4-2), glucose (Glu; A154-1-1), uric acid (UA; C012-2-1), and albumin (ALB; A028-2-1) in the plasma were measured following the instructions of the manufacturer (Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu, China). Plasma cortisol (H094-1-2) levels were analyzed by ELISA method according to the manufacturer's instructions (Jiangsu Meimian Industrial Co., Ltd., Yancheng, Jiangsu, China).

2.3.4. Organ indexes

After blood collection at d 14, the liver, spleen, thymus, and bursa of Fabricius were excised and weighed individually. The immune organ index was calculated as follows:

$$\text{Organ}\text{index}(\%)=\left(\text{Organ}\text{weight}/\text{Chicken}\text{live}\text{weight}\right)\times 100\text{.}$$

2.3.5. Antioxidant capacity

The middle jejunum section were harvested, immediately flash-frozen in liquid nitrogen, and stored at −80 °C for subsequent analysis. The jejunal samples were homogenized using 0.9% physiological saline with a tissue homogenizer to prepare a 10% homogenate. The homogenate was centrifuged at 1620 × g at 4 °C for 15 min to harvest the supernatant for determining the antioxidant capacity. The antioxidant indicators in the plasma and jejunal homogenate, including total antioxidant capacity (T-AOC; A015-3-1), catalase (CAT; A007-1-1) activity, superoxide dismutase (SOD; A001-1-2) activity, glutathione peroxidase (GSH-Px; A005-1-2) activity, and malondialdehyde (MDA; A003-1-2) level, were measured according to the instructions of the manufacturer (Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu, China).

2.3.6. Intestinal morphology

The middle segments of duodenum, jejunum, and ileum (about 2 cm) of yellow-feathered broilers were collected, fixed in 4% paraformaldehyde solution, and stained with hematoxylin-eosin (H&E) as previously described (Nie et al., 2025). The villus height (VH) and crypt depth (CD), and the corresponding villus height/crypt depth (V/C) were calculated accordingly.

2.3.7. RNA extraction, cDNA synthesis, and real-time quantitative PCR (RT-qPCR) analysis

Total RNA was isolated from samples using TRIzol reagent (15596018 C N, Invitrogen, Thermo Fisher Scientific Inc., Carlsbad, CA, USA). RNA purity and concentration were measured with a DS-11 spectrophotometer (v3.51, DeNovix Inc., Wilmington, DE, USA). cDNA was synthesized using the PrimeScript reverse transcriptase system (Takara Bio Inc., Tokyo, Japan). Quantitative real-time PCR was performed on a Quant-Studio 3 Flex system (Applied Biosystems Inc., Foster City, CA, USA) with iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories, Inc., Hercules, CA, USA). β-Actin was used as the reference gene, and relative mRNA expression levels were calculated using the 2-^ΔΔCt method (Fleige et al., 2006). All primers (Table 2) were designed with Primer Premier 5.0 (Applied Biosystems Inc., Foster City, CA, USA) and synthesized by Guangzhou IGE Biotechnology Co., Ltd. (Guangzhou, Guangdong, China). The full names of the abbreviations of all genes can be found in Table S1.

Table 2.

Sequence of primers for real-time quantitative PCR.

Items	Primer sequences (5′-3′)	Access number
TJP1	F: CTTCAGGTGTTTCTCTTCCTCCTC	XM 030016322.2
	R: CTGTGGTTTCATGGCTGGATC
TJP2	F: GAAGCAGAGGTCGTAGTAGG	XM 046934796.1
	R: CTGTCCATAGCCACCATCC
OCLN	F: GCACCCAGCAACGACAT	XM 005672525
	R: CATAGACAGAATCCGAATCAC
CLDN1	F: ACGGCCCAGGCCATCTAC	AJ318102.1
	R: TGCCGGGTCCGGTAGATG
CLDN5	F: CCTTCCTGGACCACAACATC	NM 001161636.1
	R: CACCGAGTCGTACACCTTGC
MUC2	F: ATGCCCACCTCCTCAAAGAC	NM 023566.4
	R: GTAGTTTCCGTTGGAACAGTGAA
LC3Ⅰ	F: TTACACCCATATCAGATTCTTG R: ATTCCAACCTGTCCCTCA	XM 417327.8
LC3Ⅱ	F: AGTGAAGTGTAGCAGGATGA	NM 001031461.2
	R: AAGCCTTGTGAACGAGAT
PINK1	F: TGCAGTTGTTGGAAGGTGTG	NM 001389481
	R: CAGCCAGCAGAATCGAACTC
PRKN	F: GTCCAGCAAAGCATCGTTCA	XM 419615
	R: CAACGATGGAAGGATGCTGG
SQSTM1	F: AAGAAGAATCGGTGTGCTAA	XM 414587.7
	R: GTTAATCCTCTGCGTGTGA
HSP40	F: GCTGACGGCCGCATCA	NM 001199325.1
	R: CTATGCTGTTGAATGCCCGT
HSP60	F: GTCACCGCAAACCTTTGTC	NM 001012916.1
	R: TCAGAGCCGTTCTCACAACC
HSP70	F: ACGTATTCTTGGTGTGTGT	NM 001006685.1
	R: AATCCTGGATGGATTGGCCCT
HSP90	F: GGACCAACCAATGGAGGAGG	NM 001109785.1
	R: TGCTCGGGTCAGTCAAACTC
β-Actin	F: ATGATATTGCTGCGCTCGTT	AY550069
	R: TCTTTCTGGCCCATACCAACC

2.3.8. Western blot

Proteins were extracted from jejunal tissues and quantified with a BCA (A045-4-2, Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu, China) assay kit. Western blotting was performed following a standard protocol (Zhu et al., 2021). Membranes were incubated overnight at 4 °C with primary antibodies against PARKIN (Wanlei Life Sciences Co., Ltd., Shenyang, Liaoning, China; 1:500), PINK1 (Cell Signaling Technology, Inc., Danvers, MA, USA; 1:2000), LC3 (Proteintech Group, Inc., Rosemont, IL, USA; 1:2000), and β-actin (Cell Signaling Technology, Inc., Danvers, MA, USA; 1:1000). After washing with Tris (hydroxymethyl) aminomethane-buffered saline containing Tween 20 (TBST), membranes were incubated for 1 h with corresponding horseradish peroxidase-conjugated secondary antibodies (Abbkine Scientific Co., Ltd., Wuhan, Hubei, China; 1:5,000). The full names of the abbreviations of all proteins can be found in Table S1. Protein bands were visualized using an Azure 280 imaging system (Azure Biosystems, Inc., Dublin, CA, USA) and quantified with ImageJ software (2.16.0, National Institutes of Health, Bethesda, MD, USA) based on grayscale intensity.

2.3.9. Analysis of gut microbial composition and diversity

The 16S rRNA gene sequencing was employed to analyze the dynamic changes of cecal microbiota in yellow-feathered broilers. The isolation and purification of cecal digesta DNA, validation of sample integrity, synthesis of V3–V4 region primers, and processing of raw sequencing data were performed by Tianjin Novogene Bioinformatics Technology Co., Ltd (Tianjin, China). Additionally, sequencing libraries were constructed on the HiSeq 2500 platform. The α-diversity, including Chao1 index, Observed_species, Shannon index, and Simpson index, was performed to analyze the intragroup differences, while β-diversity analysis including principal coordinate analysis (PCoA), non-metric multidimensional scaling (NMDS) and unweighted pair-group method with arithmetic mean (UPGMA) based on Unweighted Unifrac distances was performed to evaluate inter-group dissimilarities. Differences in relative abundance of microbiota were identified using linear discriminant analysis (LDA) effect sizes (LEfSe; LDA > 4.0) and t-test analysis.

2.4. Data analysis

Data were analyzed by one-way ANOVA method using SPSS 27.0 (SPSS, Inc., Chicago, IL, USA) statistical software. The mathematical model for analysis of variance in one-way ANOVA experiments is as follows:

$$X_{ij}=\mu +{\alpha }_i+{ℇ}_{ij}\text{,}$$

where X_ij denotes the experimental results; μ denotes the population mean; α_i denotes the treatment effect; ℇ_ij denotes the random experimental error. Duncan's multiple comparisons were used to compare significant differences between means. In addition, the orthogonal polynomial contrasts were conducted to analyze the linear and quadratic effects of dietary Tau levels. t-test was used to analyze weight loss, rectal temperature, heart rate and cortisol level after transportation in control and TS groups. The results were expressed as mean and standard error of the mean (SEM). P < 0.05 indicates a significant difference, while 0.05 ≤ P < 0.10 indicates a trend. Spearman correlations between differential bacteria (or mitophagy-related gene expression) and phenotypic parameters were assessed and plotted as heat maps using the R package (version 2.15.3).

3. Results

3.1. Weight loss, body temperature, heart rate, and plasma cortisol level

As shown in Table 3, the BW of yellow-feathered broilers after transportation was significantly lower in TS group than control group, while the weight loss and heart rate after transportation and plasma cortisol level at d 7 were significantly increased in TS group when compared with the control group (P < 0.05). However, there was no significant difference in rectal temperature or plasma cortisol level at d 14 between control group and TS group (P > 0.05).

Table 3.

Effects of transport stress (TS) on weight loss, rectal temperature and heart rate, and plasma cortisol level in yellow-feathered broilers (n = 6).

Items	Groups1		SEM	P-value
	Control	TS
Weight before transportation, g	37.33	37.28	0.056	0.376
Weight after transportation, g	36.19a	35.87b	0.103	0.004
Weight loss, g	1.14b	1.41a	0.096	0.009
Rectal temperature, °C	39.8	40.27	0.312	0.165
Heart rate, beats/min	146.83b	165.17a	4.815	0.003
Plasma cortisol level, μg/L
d 7	131.61b	154.53a	22.924	0.017
d 14	151.30	159.26	7.960	0.437

SEM = standard error of the mean.

Means with no common superscripts within each row are significantly different (P < 0.05). The results were expressed as mean and SEM.

¹The control group was not subjected to TS, and was fed a basal diet; TS group was subjected to TS, and fed a basal diet.

3.2. Growth performance

As shown in Table 4, TS significantly reduced the BW of yellow-feathered broilers on d 7 and 14 after transportation, and led to a significant decrease in the ADG of yellow-feathered broilers on the d 1 to 7, d 1 to 14, and d 8 to 14 compared to the control group (P < 0.05). The addition of dietary Tau significantly reversed the reduced BW on d 7 and 14 as well as the ADG at d 1 to 7, d 1 to 14, and d 8 to 14 caused by TS (P < 0.05). In addition, TS significantly increased the F/G at d 1 to 7 (P < 0.001), whereas dietary Tau supplementation significantly decreased the F/G of yellow-feathered broilers at d 1 to 7 and d 1 to 14 (P < 0.05). However, there was no significant difference in the ADFI of yellow-feathered broilers among treatments (P > 0.05).

Table 4.

Effects of dietary taurine (Tau) supplementation on growth performance in yellow-feathered broilers subjected to transport stress (TS) (n = 6).

Items	Groups1					SEM	P-value2
	Control	TS	TS + 0.25% Tau	TS + 0.50% Tau	TS + 0.75% Tau		ANOVA	Linear	Quadratic
BW, g
d 1	37.33	37.34	37.27	37.23	37.27	0.022	0.552	0.233	0.213
d 7	102.04a	95.61b	102.44a	104.91a	102.93a	0.823	<0.001	0.004	<0.001
d 14	223.69c	209.21d	226.1bc	234.25a	229.01b	1.709	<0.001	<0.001	<0.001
d 1–7
ADG, g	9.41a	8.51b	9.52a	9.89a	9.57a	0.119	<0.001	0.004	<0.001
ADFI, g	12.44	12.24	12.16	12.71	11.93	0.146	0.537	0.803	0.590
F/G	1.32b	1.44a	1.28b	1.29b	1.25b	0.017	<0.001	<0.001	<0.001
d 8–14
ADG, g	17.38b	16.23c	17.67b	18.48a	18.01ab	0.176	<0.001	<0.001	<0.001
ADFI, g	26.90	25.26	25.15	26.51	26.01	0.322	0.359	0.284	0.553
F/G	1.55	1.56	1.42	1.44	1.45	0.023	0.162	0.217	0.173
d 1–14
ADG, g	13.39c	12.37d	13.59bc	14.18a	13.79b	0.123	<0.001	<0.001	<0.001
ADFI, g	20.91	19.97	19.87	20.88	20.16	0.224	0.423	0.518	0.695
F/G	1.56ab	1.61a	1.46b	1.47b	1.46b	0.018	0.011	0.021	0.015

BW = body weight; ADG = average daily gain; ADFI = average daily feed intake; F/G = feed to gain ratio; SEM = standard error of the mean.

Means with no common superscripts within each row are significantly different (P < 0.05). The results were expressed as mean and SEM.

¹The control group was not subjected to TS, and was fed a basal diet; TS group was subjected to TS, and fed a basal diet; the TS + 0.25% Tau group was subjected to TS, and fed a basal diet supplemented with 0.25% Tau; the TS + 0.50% Tau group was subjected to TS, and fed a basal diet supplemented with 0.50% Tau; and the TS + 0.75% Tau group was subjected to TS, and fed a basal diet supplemented with 0.75% Tau.

²One-way ANOVA was performed to examine the differences among all treatment groups. Additionally, polynomial contrast was employed to examine linear and quadratic trend analysis on groups that had undergone TS.

3.3. Organ index

Compared with the control group, TS significantly increased the spleen index at d 7 (P = 0.007) (Table 5). However, there were no significant differences in thymus and bursa of Fabricius indexes at d 7 and neither in thymus, bursa of Fabricius, liver, and spleen indexes at d 14 among treatments (P > 0.05).

Table 5.

Effects of dietary taurine (Tau) supplementation on organ indexes (%) in yellow-feather broilers subjected to transport stress (TS) (n = 6).

Items	Groups1					SEM	P-value2
	Control	TS	TS + 0.25% Tau	TS + 0.50% Tau	TS + 0.75% Tau		ANOVA	Linear	Quadratic
d 7
Thymus index	0.41	0.37	0.51	0.54	0.54	0.024	0.051	0.032	0.044
Bursa of Fabricius index	0.25	0.24	0.31	0.24	0.24	0.010	0.084	0.422	0.251
Liver index	3.78a	3.52ab	3.94a	3.49ab	3.21b	0.079	0.025	0.032	0.002
Spleen index	0.06c	0.12ab	0.14a	0.10bc	0.09bc	0.009	0.007	0.095	0.203
d 14
Thymus index	0.34	0.32	0.39	0.39	0.42	0.018	0.466	0.145	0.322
Bursa of Fabricius index	0.30	0.29	0.30	0.28	0.25	0.011	0.641	0.247	0.360
Liver index	2.81	3.08	2.76	2.82	2.93	0.045	0.153	0.397	0.065
Spleen index	0.11	0.13	0.12	0.11	0.11	0.006	0.675	0.136	0.312

SEM = standard error of the mean.

Means with no common superscripts within each row are significantly different (P < 0.05). The results were expressed as mean and SEM.

¹The control group was not subjected to TS, and was fed a basal diet; TS group was subjected to TS, and fed a basal diet; the TS + 0.25% Tau group was subjected to TS, and fed a basal diet supplemented with 0.25% Tau; the TS + 0.50% Tau group was subjected to TS, and fed a basal diet supplemented with 0.50% Tau; and the TS + 0.75% Tau group was subjected to TS, and fed a basal diet supplemented with 0.75% Tau.

²One-way ANOVA was performed to examine the differences among all treatment groups. Additionally, polynomial contrast was employed to examine linear and quadratic trend analysis on groups that had undergone TS.

3.4. Plasma biochemical parameters

As shown in Table 6, TS significantly increased the plasma AST activity of yellow-feathered broilers at d 7 and 14 compared with the control group (P < 0.05). Compared with the TS group, TS + 0.50% Tau group significantly decreased the plasma AST activity in yellow-feathered broilers at d 7 and 14 (P < 0.05). Compared to the TS group, the TS + 0.25% Tau and TS + 0.75% Tau groups significantly increased the plasma content of Glu in yellow-feathered broilers at d 14 (P < 0.001). No significant differences were observed in AKP, TP, ALT, LDH, ALB, TG, TC, or UA levels among groups at d 7 and 14, and no significant difference was found in Glu levels at d 7 either (P > 0.05).

Table 6.

Effects of dietary taurine (Tau) supplementation on plasma biochemical parameters in yellow-feathered broilers subjected to transport stress (TS) (n = 6).

Items	Groups1					SEM	P-value2
	Control	TS	TS + 0.25% Tau	TS + 0.50% Tau	TS + 0.75% Tau		ANOVA	Linear	Quadratic
d 7
AKP, U/L	3.73	3.40	5.89	6.82	2.88	0.556	0.112	0.871	0.053
TP, μg/mL	47,071.33	41,349.49	40,868.49	40,016.07	40,248.62	996.985	0.108	0.641	0.883
AST, U/L	5.79c	13.51a	12.90ab	7.55bc	12.75ab	0.956	0.016	0.460	0.285
ALT, U/L	8.79	7.24	6.16	6.42	7.20	0.393	0.296	0.993	0.359
LDH, U/L	73.35	72.39	72.45	75.00	80.59	1.245	0.162	0.034	0.068
ALB, g/L	14.13	13.79	13.33	14.21	13.43	0.216	0.638	0.915	0.938
TG, mmol/L	0.49	0.39	0.43	0.40	0.45	0.019	0.511	0.441	0.737
TC, mmol/L	6.29	4.96	5.57	5.12	5.41	0.183	0.214	0.578	0.780
Glu, mmol/L	9.31	8.81	10.10	9.43	10.12	0.278	0.532	0.215	0.416
UA, μmol/L	294.03	215.57	224.87	211.95	297.16	13.300	0.058	0.059	0.057
d 14
AKP, U/L	9.28	5.72	5.46	6.32	5.73	0.770	0.526	0.893	0.981
TP, μg/mL	42,646.10	42,584.20	37,877.91	41,690.79	41,088.49	1029.821	0.606	0.952	0.713
AST, U/L	9.14b	21.78a	3.77b	4.48b	9.12b	1.318	<0.001	0.131	<0.001
ALT, U/L	6.28	5.97	6.49	6.52	5.73	0.151	0.405	0.564	0.151
LDH, U/L	12,126.18	12,770.77	13,171.40	11,466.88	15,043.53	533.063	0.323	0.390	0.267
ALB, g/L	13.24	12.37	12.60	12.31	13.77	0.284	0.435	0.185	0.272
TG, mmol/L	0.38	0.36	0.39	0.32	0.40	0.011	0.222	0.625	0.607
TC, mmol/L	4.05	3.96	5.46	5.25	5.82	0.282	0.103	0.055	0.130
Glu, mmol/L	9.96c	9.45c	13.25a	10.77bc	11.50b	0.328	<0.001	0.285	0.051
UA, μmol/L	155.09	157.63	178.82	163.76	166.96	5.430	0.682	0.879	0.788

AKP = alkaline phosphatase; TP = total protein; AST = aspartate aminotransferase; ALT = alanine aminotransferase; LDH = lactate hydrogenase; ALB = albumin; TG = triglyceride; TC = total cholesterol; Glu = glucose; UA = uric acid; SEM = standard error of the mean.

Means with no common superscripts within each row are significantly different (P < 0.05). The results were expressed as mean and SEM.

¹The control group was not subjected to TS, and was fed a basal diet; TS group was subjected to TS, and fed a basal diet; the TS + 0.25% Tau group was subjected to TS, and fed a basal diet supplemented with 0.25% Tau; the TS + 0.50% Tau group was subjected to TS, and fed a basal diet supplemented with 0.50% Tau; and the TS + 0.75% Tau group was subjected to TS, and fed a basal diet supplemented with 0.75% Tau.

²One-way ANOVA was performed to examine the differences among all treatment groups. Additionally, polynomial contrast was employed to examine linear and quadratic trend analysis on groups that had undergone TS.

3.5. Antioxidant capacity in plasma and jejunum

As shown in Table 7, compared to the control group, TS significantly decreased plasma CAT activity in yellow-feathered broilers at d 14 (P < 0.001). Additionally, dietary Tau supplementation significantly increased CAT activity in the jejunum and plasma at d 14, respectively, when compared to the TS group (P < 0.05). However, no significant differences were observed in both plasma and jejunal activities of SOD and GSH-Px, T-AOC, or MDA level among all groups on d 14 (P > 0.05).

Table 7.

Effects of dietary taurine (Tau) supplementation on the antioxidant capacity in the plasma and jejunum of yellow-feathered broilers subjected to transport stress (TS) (n = 6).

Items	Groups1					SEM	P-value2
	Control	TS	TS + 0.25% Tau	TS + 0.50% Tau	TS + 0.75% Tau		ANOVA	Linear	Quadratic
Plasma
CAT, U/mL	8.34bc	6.21d	7.93c	11.30a	9.92ab	0.405	<0.001	0.002	0.006
SOD, U/mL	147.51	164.90	168.80	147.75	166.79	3.399	0.093	0.456	0.604
T-AOC, mmol/mL	0.89	0.85	0.93	0.86	0.90	0.025	0.865	0.921	0.995
MDA, nmol/mL	3.01	2.26	2.82	2.23	2.84	0.162	0.412	0.623	0.508
GSH-Px, U/mL	1533.33	1432.97	1390.81	1311.26	1417.28	40.03	0.519	0.198	0.227
Jejunum
CAT, U/mg prot	4.85bc	3.99c	6.27ab	7.59a	6.41ab	0.361	0.009	0.007	0.025
SOD, U/mg prot	261.58	234.96	246.78	239.74	258.08	5.901	0.583	0.890	0.373
T-AOC, U/mg prot	0.14	0.11	0.12	0.15	0.13	0.007	0.487	0.837	0.733
MDA, nmol/mg prot	0.19	0.13	0.21	0.14	0.10	0.015	0.078	0.089	0.123
GSH-Px, U/mg prot	1.51	1.69	2.54	1.78	2.79	0.284	0.298	0.583	0.267

CAT = catalase; SOD = superoxide dismutase; T-AOC = total antioxidant capacity; MDA = malondialdehyde; GSH-Px = glutathione peroxidase; SEM = standard error of the mean.

Means with no common superscripts within each row are significantly different (P < 0.05). The results were expressed as mean and SEM.

¹The control group was not subjected to TS, and was fed a basal diet; TS group was subjected to TS, and fed a basal diet; the TS + 0.25% Tau group was subjected to TS, and fed a basal diet supplemented with 0.25% Tau; the TS + 0.50% Tau group was subjected to TS, and fed a basal diet supplemented with 0.50% Tau; and the TS + 0.75% Tau group was subjected to TS, and fed a basal diet supplemented with 0.75% Tau.

²One-way ANOVA was performed to examine the differences among all treatment groups. Additionally, polynomial contrast was employed to examine linear and quadratic trend analysis on groups that had undergone TS.

3.6. Intestinal morphology

As shown in Table 8, compared to the control group, TS significantly decreased the VH in duodenum and ileum at d 7 (P < 0.05) and significantly increased the CD in duodenum and ileum of yellow-feathered broilers at d 14 (P < 0.05). Moreover, compared to the control group, the duodenum V/C at d 7 and the V/C of duodenum and ileum at d 14 were significantly decreased by TS (P < 0.05). Compared to the TS group, dietary Tau supplementation at 0.50% significantly increased VH of duodenum and ileum at d 7, while dietary Tau supplementation at 0.25% increased the VH of duodenum at d 14 (P < 0.05). Furthermore, CD in the duodenum and jejunum at d 7 as well as in the duodenum at d 14 were significantly reduced in the TS + 0.75% Tau group (P < 0.05), while the V/C in the duodenum and jejunum at d 7 as well as in the duodenum and ileum at d 14 were increased in TS + 0.50% Tau group (P < 0.05).

Table 8.

Effects of dietary taurine (Tau) supplementation on intestinal morphology in yellow-feathered broilers subjected to transport stress (TS) (n = 6).

Items	Groups1					SEM	P-value2
	Control	TS	TS + 0.25% Tau	TS + 0.50% Tau	TS + 0.75% Tau		ANOVA	Linear	Quadratic
Duodenum
d 7
VH, μm	1051.90ab	877.39c	1018.50b	1106.19a	1093.42a	12.195	<0.001	<0.001	<0.001
CD, μm	105.56a	107.38a	100.70a	100.26a	84.48b	1.702	<0.001	<0.001	<0.001
V/C	9.79c	7.71d	10.21bc	11.05b	13.03a	0.244	<0.001	<0.001	<0.001
d 14
VH, μm	1207.31b	1184.33b	1259.15a	1200.29b	1208.62b	7.820	0.034	0.902	0.167
CD, μm	159.51c	195.29a	179.47b	170.44b	153.31c	2.108	<0.001	<0.001	<0.001
V/C	7.62ab	6.27c	7.11b	7.16b	7.89a	0.097	<0.001	<0.001	<0.001
Jejunum
d 7
VH, μm	674.47	657.54	669.99	670.47	677.46	5.423	0.817	0.247	0.500
CD, μm	69.85ab	74.04a	63.26bc	59.32bc	57.00c	1.751	0.006	<0.001	0.001
V/C	10.15bc	9.15c	10.56abc	11.79ab	12.62a	0.355	0.015	<0.001	0.002
d 14
VH, μm	875.50	866.75	915.95	869.13	907.73	7.809	0.136	0.330	0.598
CD,nμm	151.43	157.43	147.40	148.06	143.38	2.033	0.252	0.032	0.084
V/C	5.84ab	5.55b	6.38a	5.75b	6.43a	0.097	0.009	0.043	0.122
Ileum
d 7
VH, μm	593.54a	544.58b	564.64ab	581.77a	568.12ab	5.171	0.036	0.103	0.096
CD, μm	61.73	66.92	64.71	62.63	60.85	1.345	0.622	0.128	0.316
V/C	9.33	8.24	8.99	9.70	9.41	0.207	0.202	0.031	0.049
d 14
VH, μm	656.59	629.33	668.11	668.92	640.33	5.410	0.082	0.581	0.029
CD, μm	99.55b	120.36a	116.34a	111.47ab	115.11a	2.150	0.026	0.367	0.488
V/C	6.60a	5.27c	5.97abc	6.20ab	5.65bc	0.129	0.012	0.281	0.057

VH = villus height; CD = crypt depth; V/C = villus height to crypt depth ratio; SEM = standard error of the mean.

Means with no common superscripts within each row are significantly different (P < 0.05). The results were expressed as mean and SEM.

¹The control group was not subjected to TS, and was fed a basal diet; TS group was subjected to TS, and fed a basal diet; the TS + 0.25% Tau group was subjected to TS, and fed a basal diet supplemented with 0.25% Tau; the TS + 0.50% Tau group was subjected to TS, and fed a basal diet supplemented with 0.50% Tau; and the TS + 0.75% Tau group was subjected to TS, and fed a basal diet supplemented with 0.75% Tau.

²One-way ANOVA was performed to examine the differences among all treatment groups. Additionally, polynomial contrast was employed to examine linear and quadratic trend analysis on groups that had undergone TS.

3.7. Intestinal gene expression

As shown in Fig. 1A, compared to the control group, the relative mRNA expression levels of HSP40, HSP70, and HSP90 in the TS group were significantly upregulated (P < 0.05). Compared to the TS group, dietary supplementation with 0.50% Tau significantly upregulated the relative mRNA expression levels of intestinal barrier function-related genes including TJP1 and TJP2 as well as that of mitochondrial autophagy genes including LC3Ⅱ and PRKN in the jejunum, and significantly reduced the relative mRNA expression levels of HSP40 and HSP70 in the jejunum of yellow feathered broilers (P < 0.05). The relative mRNA expression of LC3Ⅰ in the jejunum of yellow feathered broilers was also significantly upregulated in both TS + 0.50% Tau group and TS + 0.75% group (P < 0.001). The relative mRNA expression of HSP40 in the jejunum of was decreased significantly in TS + 0.25% Tau group (P < 0.001). However, no significant differences were observed in the relative mRNA levels of jejunal OCLN, CLDN1, CLDN5, LC3Ⅱ/LC3Ⅰ, PINK1, SQSTM1, HSP60, and the protein levels of PINK1, PARKIN and LC3 (Fig. 1B) in yellow feathered broilers among groups (P > 0.05).

Fig. 1.

Effects of dietary taurine (Tau) supplementation on intestinal gene expression in yellow-feathered broilers subjected to transport stress (TS). (A) The relative mRNA expression of intestinal genes by real-time quantitative PCR (RT-qPCR). (B) The protein expression of intestinal PINK1, PARKIN, and LC3 by western blot. Means with no common superscripts within each column are significantly different (P < 0.05). The control group was not subjected to TS and was fed a basal diet; TS group was subjected to TS and fed a basal diet; the TS + 0.25% Tau group was subjected to TS and fed a basal diet supplemented with 0.25% Tau; the TS + 0.50% Tau group was subjected to TS and fed a basal diet supplemented with 0.50% Tau; and the TS + 0.75% Tau group was subjected to TS and fed a basal diet supplemented with 0.75% Tau. One-way ANOVA was performed to examine the differences between different treatment groups. Additionally, polynomial contrast was employed to examine linear and quadratic trend analysis on groups that had undergone TS. -, not processed for transportation; +, processed for transportation.

3.8. Composition and diversity of cecal microbiota

As shown in Fig. S1A and S1B, the Observed_species and rank–abundance curves demonstrated sufficient amplicon sequence variants (ASVs) coverage and adequate sequencing depth. Based on the ASV annotation results (Fig. S1C and S1D), the top 10 most abundant microbial taxa at both phylum and genus levels were identified and presented in column charts. At the phylum level (Fig. 2A), the top 10 phyla with the highest abundance in the cecal digesta included Firmicutes, Proteobacteria, Bacteroidota, Cyanobacteria, Actinobacteria, Verrucomicrobiota, Chloroflexi, Gemmatimonadota, Desulfobacterota, and Crenarchaeota. Specifically, the TS group demonstrated a significant reduction in Firmicutes abundance at d 7, while showing marked increases in Proteobacteria abundance at d 7 (P < 0.05). At the genus level (Fig. 2B), the top 10 genera with the highest abundance in cecal digesta were Escherichia-Shigella, Enterococcus, Bacteroides, Faecalibacterium, Coprobacter, [Ruminococcus] torques group, Oscillibacter, Pygmaiobacter, Butyricicoccus, and Negativibacillus. Compared to TS group, dietary supplementation with 0.75% Tau significantly reduced the relative abundance of Escherichia-Shigella at d 14 (P = 0.047). Moreover, dietary supplementation with 0.25% Tau showed marked enrichment of [Ruminococcus] torques group, while dietary Tau supplementation at 0.75% led to significant proliferation of Pygmaiobacter at d 14 compared with control group (P < 0.05).

Fig. 2.

Effects of dietary taurine (Tau) supplementation on the composition of cecal microbiota in yellow-feathered broilers subjected to transport stress (TS). The top 10 microbial community at the phylum (A) and genus (B) levels. The α-diversity of cecal microbiota at d 7 (C) and 14 (D). (E) principal coordinate analysis (PCoA) plot. (F) The non-metric multidimensional scaling (NMDS) analysis. (G) The Unweighted Pair Group Method with Arithmetic Mean (UPGMA) analysis based on unweighted unifrac distance. The control group was not subjected to TS and was fed a basal diet; TS group was subjected to TS and fed a basal diet; the TS + 0.25% Tau group was subjected to TS and fed a basal diet supplemented with 0.25% Tau; the TS + 0.50% Tau group was subjected to TS and fed a basal diet supplemented with 0.50% Tau; and the TS + 0.75% Tau group was subjected to TS and fed a basal diet supplemented with 0.75% Tau. One-way ANOVA was performed to examine the differences between different treatment groups. Additionally, polynomial contrast was employed to examine linear and quadratic trend analysis on groups that had undergone TS. ∗ P < 0.05. PC = principal coordinate.

For the microbial community diversity analysis (Fig. 2C), TS significantly decreased the Chao1 index, Observed_species, and Shannon index of cecal microbiota at d 7 when compared with the control group (P < 0.05). In contrast, compared to the TS group, dietary supplementation with 0.25% and 0.75% Tau significantly increased Chao1 index, Observed_species, and Shannon index at d 7, while dietary supplementation with 0.50% Tau increased the Simpson index at d 7 (P < 0.05). For the cecal microbiota at d 14 (Fig. 2D), TS induced a significant decrease in the Shannon index (P = 0.002). However, dietary supplementation with Tau were significantly increased the Shannon and Simpson indexes of cecal microbiota at d 14 in yellow-feathered broilers when compared with TS group (P < 0.05). No significant differences were observed in the Chao1 index and Observed_species among all groups at d 14 (P > 0.05). The microbial community structures at d 7 (Figs. 2E) and 14 (Fig. 2F) exhibited distinct clustering patterns, indicating that TS modulates the β-diversity of the microbial community. UPGMA hierarchical clustering was used to clearly show the differences between treatment groups (Fig. 2G). Fig. 3A and B presents the results of pairwise t-tests comparing microbial community differences at the genus level among treatment groups. At d 7, compared with the TS group, the relative abundance of Colidextribacter was significantly increased in the TS + 0.25% Tau group (P = 0.021), while Escherichia-Shigella abundance was significantly reduced in the TS + 0.50% Tau group and unidentified_Oscillospiraceae abundance decreased in the TS + 0.75% Tau group (P < 0.05). At d 14, compared to the TS group, dietary supplementation with TS + 0.25% Tau significantly enriched [Ruminococcus] torques group, Shuttleworthia, and Subdoligranulum in cecal digesta of yellow-feathered broilers (P < 0.05). Moreover, Shuttleworthia, Anaerotruncus, and Defluviitaleaceae_UCG-011 abundances were significantly increased in the TS + 0.50% Tau group (P < 0.05). Additionally, dietary supplementation with 0.75% Tau resulted in a marked elevation of Anaerotruncus abundance alongside a significant reduction in Escherichia-Shigella in the cecal digesta of yellow-feather broilers (P < 0.05).

Fig. 3.

Effects of dietary taurine (Tau) supplementation on the diversity and differential genera bacteria of cecal microbiota in yellow-feathered broilers subjected to transport stress (TS). t-test analysis for the significant changes of differential bacteria of cecal microbiota at the genus level at d 7 (A) and 14 (B). (C) Linear discriminant analysis effect sizes (LEfSe) analysis of the cecal microbiota at d 7. (D) LEfSe analysis of the cecal microbiota at d 14. Linear discriminant analysis (LDA) score ≥ 4. The control group was not subjected to TS and was fed a basal diet; TS group was subjected to TS and fed a basal diet; the TS + 0.25% Tau group was subjected to TS and fed a basal diet supplemented with 0.25% Tau; the TS + 0.50% Tau group was subjected to TS and fed a basal diet supplemented with 0.50% Tau; and the TS + 0.75% Tau group was subjected to TS and fed a basal diet supplemented with 0.75% Tau. P < 0.05 indicates a significant difference.

Linear discriminant analysis effect size with a logarithmic LDA score threshold of 4 (Fig. 3C and D) was performed to identify differentially enriched taxa as potential biomarkers across groups. At d 7, the unidentified_Oscillospiraceae was enriched in the TS group relative to other treatments. The TS group also showed enrichment of Enterobacteriaceae, Proteobacteria, Gammaproteobacteria, and Enterobacterales compared with the TS + 0.25% Tau group. Conversely, the phylum Firmicutes was enriched in the TS + 0.25% Tau group relative to the TS group. At d 14, the Escherichia-Shigella, Enterobacteriaceae, Proteobacteria, Gammaproteobacteria, and Enterobacterales were enriched in the TS group compared with the TS + 0.50% Tau group. In addition, supplementation with 0.50% or 0.75% Tau led to enrichment of the short-chain fatty acid-producing beneficial bacteria Clostridia_UCG_014 and the Eubacterium_coprostanoligenes_group at d 14.

Tax4Fun functional prediction was performed on the cecal microbiota of yellow-feathered broilers at d 7 and 14, thereby predicting the functional composition of microbial communities (Fig. S2).

3.9. Spearman correlation of gut microbiota with host phenotypic parameters

Further Spearman correlation analysis (Fig. 4A) revealed that the relative abundances of Proteobacteria, Escherichia-Shigella, Enterobacterales, Gammaproteobacteria, and Enterobacteriaceae at d 14 were negatively correlated with plasma CAT activity and relative mRNA expression of LC3Ⅰ and LC3Ⅱ (P < 0.05). Moreover, the relative abundance of Escherichia-Shigella also showed a negative correlation with jejunum V/C (P < 0.05). The relative abundances of Eubacterium_coprostanoligenes_group and Clostridia_UCG-014 were positively correlated with ADG during d 1 to 14 (P < 0.05). Additionally, the relative abundances of Defluviitaleaceae_UCG-011 and Shuttleworthia exhibited positive correlations with both ADG during d 1 to 14 and plasma CAT activity (P < 0.05). The relative abundance of Subdoligranulum was positively correlated with jejunal V/C, but negatively correlated with MUC2 relative mRNA expression (P < 0.05). Notably, the relative abundance of Clostridia_UCG-014 showed a positive correlation with jejunal V/C. Furthermore, the relative abundances of Enterococcus, Defluviitaleaceae_UCG-011, Shuttleworthia, and Clostridia_UCG-014 were negatively correlated with plasma AST levels (P < 0.05). Moreover, as shown in Fig. 4B, the relative mRNA expression of PRKN was positively correlated with the VH of the duodenum (P < 0.05). The relative mRNA expressions of LC3Ⅰ and LC3Ⅱ were positively correlated with ADG during d 1 to 14, plasma CAT activity and BW at d 14, while the relative mRNA expression of LC3Ⅰ was negatively correlated with F/G during d 1 to 14 (P < 0.05).

Fig. 4.

The spearman correlations of gut microbiota with host parameters in yellow-feathered broilers. ADG = average daily gain; CAT = catalase; V/C = villus height to crypt depth ratio; VH = villus height; AST = aspartate aminotransferase; F/G = feed to gain ratio; BW = body weight; ∗ P < 0.05; ∗∗ P < 0.001.

4. Discussion

In modern livestock and poultry production practices, transportation represents as one of the critical challenges affecting animal health and production performance (Zhu et al., 2009). This study investigated the potential effects of Tau in mitigating growth performance, antioxidant status, and intestinal health in yellow-feathered broilers subjected to post–hatch TS, and its possible association with gut microbiota and mitophagy-related markers. The present findings demonstrated that dietary Tau supplementation alleviated weight loss during transportation and later growth retardation induced by post–hatch TS, and improved antioxidant capacity and intestinal integrity and barrier function, at least partly linking the modulation of gut microbiota composition.

4.1. Dietary Tau supplementation improves the growth performance of yellow-feathered broilers subjected to post–hatch TS

Post–hatch transportation exposes chicks to multiple stressors, including temperature fluctuations, air pollution, motion disturbances, noise, and social group disruption (Nordquist et al., 2022). Prolonged transport durations and distances further exacerbate these effects, often resulting in significant body weight loss (Li et al., 2017). In present study, Chinese yellow-feathered broiler chicks subjected to post–hatch TS showed a significant increase in weight loss and heart rate, and significantly reduced both the BW and ADG during the first two weeks, alongside elevated F/G after transportation. These outcomes are consistent with prior reports that TS induced notable weight loss in cattle (González et al., 2012), yaks (Wang et al., 2024), and ROSS 308 broilers (Xu et al., 2022). Similarly, broilers that were transported after feed withdrawal had higher BW loss than those with feed intervention before transport (Nijdam et al., 2005). This might involve the changes of plasma hormone and metabolite concentrations under TS condition (Nijdam et al., 2005), which impacted the following growth performance of broilers at early stages. Notably, the present study found that TS-induced growth retardation persisted in chicks for at least two weeks’ post-exposure, while dietary Tau supplementation significantly improved the ADG and reduced F/G in yellow-feathered broilers, thus alleviating the growth retardation at the first two weeks induced by post–hatch TS. The results of current study were in accordance with the existing evidence supporting the efficacy of Tau in alleviating heat stress-related growth deficits in broilers (He et al., 2019) and mitigating TS-induced weight loss in yaks (Wang et al., 2024).

4.2. Dietary Tau supplementation alters plasma biochemical indicators in yellow-feathered broilers subjected to post–hatch TS

Increasing evidence indicates that TS induces significant alterations of blood biochemical parameters in different livestock and poultry (De et al., 2021; Xu et al., 2022; Zhao et al., 2021). In the current study, TS-induced elevation of plasma AST activity at both d 7 and 14, and decrease of Glu levels at d 14 in yellow-feathered broilers, indicating possible hepatocellular damage and enhanced hepatic glycogenolysis in broilers after post–hatch transportation. Consistently, prior studies have documented elevated plasma AST activity in male Ross 308 broilers following TS exposure (Xu et al., 2022), with parallel observations reported in emus subjected to TS (Menon et al., 2014). Similarly, TS also induces a reduction in plasma Glu levels of Ross 308 broilers at d 1 (Jacobs et al., 2017; Xu et al., 2022). This might be due to the reason that once glycogen reserves are depleted, the body intensifies lipolysis and proteolysis to meet energy demands, leading to further Glu reduction (Han et al., 2016). Importantly, dietary Tau supplementation significantly reduced plasma AST activity and increased Glu level in current study. This phenomenon may be attributed to the ability of Tau to enhance lipid catabolism, thereby providing additional energy substrates for the organism (Lu et al., 2019a). These substrates could subsequently be converted into Glu through gluconeogenesis pathways, leading to elevated plasma Glu concentrations. Furthermore, previous studies have demonstrated that Tau can alleviate tert-butyl hydroperoxide (TBHP)-induced oxidative damage in hepatocytes (Roy and Sil, 2012). Consequently, Tau may preserve hepatic function by mitigating TS-induced liver injury, thereby maintaining hepatic glycogen synthesis and gluconeogenic capacity. These results suggest the potential of dietary Tau supplementation to mitigate growth impairments induced by TS at least partially via metabolic regulation.

4.3. Dietary Tau supplementation enhances the antioxidant capacity of yellow-feathered broilers subjected to post–hatch TS

Importantly, TS could increase broilers' susceptibility to physiological stressors by disturbing redox homeostasis to induce oxidative stress (Xu et al., 2022). Moreover, TS suppresses antioxidant enzyme activity by downregulating gene expression or disrupting post-translational modifications, exacerbating oxidative damage (Sun et al., 2025). Previous studies have reported the cytoprotective effects of Tau in heat-stressed chickens are attributed to its upregulation of antioxidant enzymes via Nrf2 pathway activation (Lu et al., 2019b). Similarly, the present study found that TS significantly decreased plasma CAT activity in yellow-feathered broilers at d 14, while Tau supplementation markedly increased CAT activity in both the jejunum and plasma. This suggests that Tau may enhance the conversion of hydrogen peroxide (H₂O₂) into water and oxygen by upregulating CAT expression, thereby providing primary cellular defense against free radicals (Surai et al., 2019). Consistently, previous study has shown that dietary Tau supplementation elevated plasma CAT activity to enhance antioxidant defenses and alleviate lipopolysaccharide-induced inflammatory responses in broiler chickens (Han et al., 2020). Moreover, Tau could inhibit nicotinamide adenine dinucleotide phosphate (NADPH) oxidase, a key reactive oxygen species (ROS) source in the plasma membrane, thereby reducing ROS production (Ma et al., 2022; Shimada et al., 2015). Indeed, excessive ROS accumulation can thereby disrupt the oxidative-antioxidant balance by inducing oxidative damage and stress (Bhattacharyya et al., 2014). These findings demonstrated that dietary Tau supplementation mitigated TS-induced adverse oxidative effects by improving the antioxidant capacity in yellow-feathered broilers.

4.4. Dietary Tau supplementation alleviates the impairments of intestinal barrier integrity induced by post–hatch TS in yellow-feathered broilers

Notably, stress-induced damage extends beyond systemic physiological functions, with the intestine as a highly stress-sensitive site suffering significant impairments. The intestinal barrier function is closely relied on the structural integrity of its mucosal layer, and the intestinal barrier integrity is commonly assessed through morphological evaluation and expression of tight junction proteins (Ducatelle et al., 2018; Nishiyama et al., 2001). The present study found that TS significantly decreased duodenal and ileal VH at d 7 while increasing duodenal and ileal CD at d 14. Consistently, a previous study has shown that TS could induce the destruction of intestinal mucosal barrier in pigs (He et al., 2019). Furthermore, TS could also lead to the damage of intestinal mucosa in 1-d-old ducklings (Zhang et al., 2020). Severe epithelial damage and apoptosis of the small intestine were also observed in TS-simulated rat models (Wan et al., 2014). However, the current study found that dietary Tau supplementation alleviated the intestinal villus atrophy and up-regulated the expression of TJP1, TJP2, and MUC2 in yellow-feathered broilers subjected to post–hatch TS. This was in consistent with a recent study that dietary Tau supplementation restored VH and reduced CD in weaned piglets challenged with deoxynivalenol (Ji et al., 2025). Moreover, other studies have shown that dietary Tau treatment upregulated TJP1, TJP2, and MUC2 expression for reinforcing barrier function of piglets (Ma et al., 2022; Wen et al., 2020). Meanwhile, heat shock proteins (HSPs) serve as critical cellular stress mediators by facilitating refolding of denatured proteins under stress (Chen et al., 2018). The present study found that post–hatch TS significantly upregulated jejunal HSP40, HSP70, and HSP90 expression, while dietary Tau supplementation at 0.50% significantly downregulated jejunal HSP40 and HSP70 in the jejunum of broilers. This aligns with Belal et al. (2018), who reported that Tau attenuates heat stress-induced HSPs upregulation in broilers.

Furthermore, this study provided the first evidence that dietary Tau supplementation could upregulate the expression of mitophagy-related genes in yellow-feathered broilers subjected to TS. Specially, the jejunal LC3Ⅰ, LC3Ⅱ, and PRKN expressions were significantly upregulated by dietary supplementation with 0.50% Tau in yellow-feathered broilers subjected to post–hatch TS; however, no significant difference was observed in the protein levels of PINK1, PARKIN, and LC3 in the jejunum of broilers among groups. Importantly, PARKIN and PINK1 were identified as pivotal regulators of mitophagy process, accompanied by increase of LC3Ⅱ and p62 accumulation after impaired lysosomal degradation (Filomeni et al., 2015; Jiang et al., 2015; Tanida et al., 2008). Previous study also demonstrated that TS induces mitophagy in finishing pigs, where stress-triggered intestinal damage activates autophagic pathways to restore cellular homeostasis (He et al., 2019). These results suggested that dietary Tau supplementation might activate mitophagy of intestinal mucosal epithelial cells in yellow-feathered broiler chicks subjected to post–hatch TS, which might promote the clearance of damaged mucosal epithelial cells and enhance intestinal epithelial renewal under TS-induced barrier impairments. However, the discrepancy of mRNA and protein levels of mitophagy-related markers could reflect post-transcriptional regulation, compensatory changes in protein turnover, or the moderate sensitivity of current assay given the sample size, which represent potential limitations of this study. Although significant correlations between mitophagy-related gene expression and growth performance and oxidative stress were observed in current study, the potential mechanism whether Tau alleviates the intestinal barrier repair induced by post–hatch TS in broilers through mitophagy-mediated mitochondrial regulation requires further investigations.

4.5. Dietary Tau supplementation modulates the composition of intestinal microbiota in yellow-feathered broilers subjected to post–hatch TS

The microbial analysis revealed significant reductions in α-diversity indices (Chao1, Observed_species, and Shannon indexes) of cecal microbiota in the TS group. Consistent with this, a recent study has demonstrated that TS significantly reduces the Ace and Chao indexes in the intestinal microbiota of chicks (Sun et al., 2025). Meanwhile, the present study found that TS induced significant alterations of microbial composition in cecal digesta of yellow-feathered broilers, with a pronounced decline in Firmicutes abundance and a concurrent rise in the relative abundances of Proteobacteria, while dietary Tau supplementation reversed the TS-induced microbial community and diversity changes. Previous study has shown that Firmicutes plays a crucial role in intestinal energy supply, barrier function, and anti-inflammatory capacity (Hays et al., 2024). As a specific substrate for beneficial bacteria, Tau enables Firmicutes to metabolize sulfur and energy, promoting these bacteria growth (Duszka, 2022). Elevated Proteobacteria abundance was recognized as important biomarker of intestinal inflammation and barrier dysfunction (Shin et al., 2015). Collectively, the current study found that dietary Tau supplementation reduced the abundance of the pathogenic bacteria while enriching the beneficial bacterial populations, which may help improve intestinal health in yellow-feathered broilers affected by post–hatch TS.

Intestinal health is intricately linked to gut microbiota homeostasis. Nutritional interventions could effectively alleviate the oxidative stress responses and enhance intestinal health in livestock and poultry through modulating gut microbiota composition (Song et al., 2024). Further Spearman's correlation analysis revealed significant associations between Tau-mediated improvement of antioxidant capacity and intestinal barrier integrity, and the significant taxa in cecal microbiota of yellow-feathered broilers subjected to post–hatch TS. Specially, this present study revealed a significant negative correlation between Escherichia-Shigella abundance and plasma CAT activity, jejunal VH/CD, as well as relative mRNA expression of LC3Ⅰ and LC3Ⅱ, confirming its close association with intestinal health. Moreover, Defluviitaleaceae_UCG-011 demonstrated significant positive correlations with plasma CAT activity and negative correlations with plasma AST levels, implying its potential role in enhancing antioxidant capacity and hepatic function. Consistently, previous study has shown that the increase of Defluviitaleaceae_UCG-011 abundance was associated with reduced plasma AST levels, which helped alleviate hepatic damage and intestinal barrier repair in an ulcerative colitis model (Cheng et al., 2023). In broiler intestinal inflammation models, lipopolysaccharide challenge reduced the abundance of Shuttleworthia, whereas dietary intervention restored its abundance with positive correlation to anti-inflammatory metabolites (Wang et al., 2024). Consistent with these findings, the present study revealed that Shuttleworthia abundance was positively correlated with plasma CAT and jejunal V/C ratio, but negatively correlated with plasma AST and jejunal MUC2 expression, demonstrating close associations with intestinal health status. Indeed, the composition and activity of the gut microbiota actively modulate changes in the mucus barrier (Paone and Cani, 2020). Additionally, Tau may enhance mucus secretion to improve microbial nutrient bioavailability and lowers intestinal pH via its sulfur moiety, suppressing alkaliphilic pathogens such as Proteobacteria (Qian et al., 2023). Furthermore, it is noteworthy that Tau may modulate the gut microbiota composition by regulating bile acid metabolism involving the conversion of primary bile acids into secondary bile acids, catalyzed by bile salt hydrolase (BSH) among Bacteroidetes, Firmicutes, and Actinomycetota (Foley et al., 2021). However, whether the Tau-mediated attenuation of post–hatch TS in broilers relies on the gut microbiota-bile acid axis and the precise mechanisms involved require further investigations.

Future studies should elucidate how dietary Tau improves performance and health in TS broilers through regulating intestinal mitophagy and gut microbiota or its metabolites, particularly involving larger animal sizes and longer experimental period, and explore its precise application under varying TS intensities to advance stress management in intensive poultry production.

5. Conclusion

In conclusion, this study demonstrated that dietary Tau supplementation effectively alleviated post–hatch TS-induced impairments in growth, antioxidant status, and intestinal barrier integrity in yellow-feathered broilers. The potential mechanism of dietary Tau supplementation on mitigating the post–hatch TS-induced negative effects in yellow-feathered broilers was shown in Fig. S3. This protective effect might be linked to the modulation of gut microbiota.

Credit Author Statement

Shuhan Pan: Writing – original draft, Validation, Methodology, Investigation, Formal analysis. Wenling Huang: Writing – original draft, Validation, Methodology, Investigation, Formal analysis. Yang Dai: Methodology, Investigation, Formal analysis. Zhitong Fan: Investigation. Yucheng Yin: Investigation. Yizheng Hong: Investigation. Huihua Zhang: Resources. Cui Zhu: Writing – review & editing, Supervision, Conceptualization.

Data availability statement

The datasets presented in this study can be found in the NCBI Bioproject repository (http://www.ncbi.nlm.nih.gov/bioproject) with accession number (PRJNA1298574).

Declaration of competing interest

We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, and there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the content of this paper.

Appendix A. Supplementary data

The following is the Supplementary data to this article.