Trypanosoma cruzi in anteaters from southeastern Brazil: molecular evidence and implications for sylvatic transmission networks

Abstract

Anthropogenic environmental changes have intensified interactions among wildlife, domestic animals, and humans, reshaping parasite transmission dynamics. In this context, anteaters may play an important role as hosts within sylvatic transmission networks of Trypanosoma cruzi. This study investigated the occurrence and molecular characterization of T. cruzi in anteaters from São Paulo State, Brazil. Whole blood samples from 26 individuals were analyzed using PCR assays targeting the 18S rRNA gene, followed by sequencing and Bayesian phylogenetic inference. Trypanosoma cruzi DNA was detected in 42.3% (11/26) of the samples. Sequence analysis revealed high similarity (93.66–99.65%) with reference strains available in GenBank, and phylogenetic reconstruction confirmed that all sequences clustered within the T. cruzi clade with low intraspecific divergence. No statistically significant associations were observed between infection status and host-related variables, including host species (p = 0.348), sex (p = 1.000), age class (p = 0.674), and sampling season (p = 0.275), indicating no evidence of these factors as determinants of infection in the studied population. Positive individuals were identified across multiple municipalities, with a spatial concentration in the central-western region of São Paulo State, suggesting widespread circulation of the parasite in anthropogenically influenced landscapes. Although no clear temporal pattern could be established due to opportunistic sampling, the detection of infected individuals across different years supports the persistence of T. cruzi in these host populations. These findings provide molecular evidence of T. cruzi infection in anteaters from southeastern Brazil and reinforce their relevance as hosts in sylvatic transmission networks. The results highlight the importance of wildlife in maintaining parasite circulation and emphasize the need for integrative approaches combining molecular, ecological, and epidemiological data to better understand host–parasite dynamics and potential transmission interfaces.

Graphical abstract

Highlights

• •T. cruzi detected in anteaters from southeastern Brazil.
• •Molecular and phylogenetic analyses confirmed parasite identity.
• •Anteaters act as hosts in sylvatic transmission networks.
• •Study reinforces importance of wildlife disease surveillance.

1. Introduction

Approximately 75% of emerging and re-emerging infectious diseases are of zoonotic origin, highlighting the importance of wildlife in the maintenance and transmission of pathogens within complex ecological systems (Zanella, 2016). Zoonoses are defined as infections naturally transmitted between vertebrate animals and humans (Asokan, 2015), and their emergence is frequently associated with ecological disruption and increased interfaces among wildlife, domestic animals, and human populations. In this context, zoonotic spillover events are strongly influenced by anthropogenic environmental changes that modify ecological and biological barriers between hosts (Cunningham et al., 2017; Plowright et al., 2017).

Environmental changes, including habitat fragmentation and landscape modification, can alter vector distribution and host community structure, intensifying contact among species and reshaping enzootic transmission networks (Calchi et al., 2023; Priyadarsini et al., 2020). In the case of Trypanosoma cruzi, fragmented landscapes, particularly smaller forest patches, have been associated with higher infection prevalence in both vectors and mammalian hosts, likely due to intensified vector–host contact, reduced host diversity, and increased parasite circulation (Urbano et al., 2025).

Xenarthrans, including the giant anteater (Myrmecophaga tridactyla) and the southern tamandua (Tamandua tetradactyla), are widely distributed across Brazil and occupy both natural and anthropogenically altered environments. In São Paulo State, these species frequently occur in fragmented landscapes, persisting in remnant habitats within agricultural matrices (Sartori et al., 2021; Bertassoni and Ribeiro, 2019). These mammals have a long coevolutionary history with trypanosomatids (Roque and Jansen, 2014), and previous studies have demonstrated natural infection by T. cruzi and other trypanosomatids, often without evident clinical manifestations (De Araújo et al., 2013; Herrera et al., 2022; Richini-Pereira et al., 2014). Notably, anteaters are capable of maintaining stable infections with T. cruzi, frequently exhibiting high parasitemia, which may represent an important source of infection for triatomine vectors (Pessanha et al., 2023). In addition, these hosts may harbor mixed infections involving distinct T. cruzi lineages, as well as other trypanosomatids such as Trypanosoma rangeli and Leishmania infantum (De Araújo et al., 2013; Pessanha et al., 2023), reinforcing their role as important components in the maintenance and diversity of these parasites in natural environments (Jansen et al., 2018).

The epidemiological role of these species may be even more complex, as they appear to operate across different transmission contexts within T. cruzi networks. Evidence indicates that Tamandua tetradactyla, a scansorial species that moves between ground and arboreal environments, may play an important ecological role in canopy-based transmission dynamics, serving as a blood meal source for infected triatomines in coati nests. At the same time, its use of terrestrial shelters suggests a potential role in linking transmission cycles occurring in both canopy and ground-level environments (Pessanha et al., 2023; Dias et al., 2010).

Despite increasing evidence highlighting the ecological and epidemiological relevance of anteaters within transmission networks of this protozoan, important gaps remain regarding their role as hosts in fragmented landscapes, particularly in southeastern Brazil. Although recent advances have improved the molecular detection and characterization of T. cruzi in wildlife from São Paulo State, such as studies focusing on Chiroptera (França et al., 2024), records involving anteaters remain scarce. Within this context, this study aimed to investigate the occurrence and molecular characterization of T. cruzi in anteaters from São Paulo State, Brazil, in order to provide additional molecular evidence of their role as hosts within sylvatic transmission networks and contribute new occurrence records of T. cruzi in these species in São Paulo State.

2. Materials and methods

2.1. Sample origin and animals

Between 2012 and 2025, whole blood samples from 26 individuals of giant anteaters (Myrmecophaga tridactyla) and southern tamanduas (Tamandua tetradactyla) were obtained from the Center for Wild Animal Medicine and Research (CEMPAS) and the Zoonosis Diagnostic Service (SDZ), both affiliated with the School of Veterinary Medicine and Animal Science, São Paulo State University (UNESP), Botucatu, Brazil. Although the biological samples were not collected directly from free-ranging animals in the field, they were obtained at the time of admission of these individuals to the respective institutions. Samples were collected in EDTA tubes and stored at −20 °C until DNA extraction procedures and molecular screening. For each individual, the institutions provided associated data including species, date of sample collection, body weight, sex, age, and municipality of origin, totaling records from 18 municipalities in São Paulo State (Supplementary Table S1). All total of 26 whole blood samples were subjected to molecular screening for Trypanosoma cruzi. Associated host-related information, including biometric data, was obtained from clinical records generated during the veterinary evaluation of each animal.

When necessary, animals were chemically restrained via intramuscular administration of ketamine (8 mg/kg) and midazolam (0.3 mg/kg), according to institutional anesthetic protocols. Approximately 2 mL of whole blood were collected by venipuncture and stored in EDTA tubes at −20 °C until DNA extraction. All procedures were approved by the Ethics Committee on the Use of Animals (CEUA; protocol no. 0562/2023) and authorized by the Brazilian Biodiversity Authorization and Information System (SISBIO; permit no. 86964-1).

2.2. DNA extraction and molecular detection

Genomic DNA was extracted from whole blood samples using the DNeasy Blood & Tissue Kit (QIAGEN, Germany), following the manufacturer's instructions. DNA concentration and purity were assessed by spectrophotometry. Amplification of the glyceraldehyde-3-phosphate dehydrogenase (gapdh) gene was performed to verify DNA integrity and the absence of PCR inhibitors (Birkenheuer et al., 2003).

Conventional and nested PCR assays were performed for the molecular detection of trypanosomatids (family Trypanosomatidae) (Noyes et al., 1999), including specific detection of Trypanosoma cruzi (Viettri et al., 2018). Primers targeting T. cruzi were used to increase diagnostic specificity. Primer sequences and expected amplicon sizes are presented in Table 1.

Table 1.

Primers used for molecular detection, including nucleotide sequences, target genes and expected amplicon sizes.

Target organism	Primer name	Primer sequence (5′–3′)	Target gene	Amplicon size (bp)	Reference
Mammalia (endogenous control)	GAPDH-F	CCTTCATTGACCTCAACTACAT	GAPDH	400	Birkenheuer et al. (2003)
	GAPDH-R	CCAAAGTTGTCATGGATGACC
Trypanosomatidae (PCR round 1)	TRY816-F	CAGAAAGAAACACGGGAG	18S rRNA (SSU)	816	Noyes et al. (1999)
	TRY816- R	CCTACTGGGCAGCTTGGA
Trypanosomatidae (nested PCR)	SSU450-F	TGGGATAACAAAGGAGCA	18S rRNA (SSU)	650	Noyes et al. (1999)
	SSU450-R	CTGAAGCTGTAACCCTCAAAGC
Trypanosoma cruzi (species-specific)	121	AAATAATGTACGGGTGAGATGCATA	kDNA	330	Viettri et al. (2018)
	122	GGGTTCGATTGGGGTTGGTGT

PCR reactions were performed in a final volume of 25 μL, containing 12.5 μL of 2.0× Taq DNA Polymerase Master Mix (Class Five), 0.5 μL of each primer (50 ng/μL), 1–7 μL of DNA (100 ng/μL), and 10.5–4.5 μL of ultrapure water. For Nested PCR reactions, 1–7 μL of the amplified product from the first assay was used as template. The primers used, their sequences, target genes, and expected amplicon sizes are detailed in Table 1. For trypanosomatid analyses, including T. cruzi, the Y strain of T. cruzi from the protozoan collection of the Oswaldo Cruz Institute (COLPROT 0106) was used. Sterile ultrapure water was used as a negative control. PCR products were visualized by electrophoresis on 1.5% agarose gels stained with GelRed® and compared with a 100 bp molecular weight marker.

2.3. Sequencing and phylogenetic analysis

PCR-positive amplicons were purified enzymatically and sequenced bidirectionally using the Sanger method. Sequence quality was assessed using BioEdit and ChromasPro, and consensus sequences were generated and aligned using ClustalW. Sequence identity was determined through comparison with reference sequences available in GenBank using BLASTn.

Phylogenetic analyses were performed using Bayesian inference implemented in BEAST 2 (Bouckaert et al., 2014). Multiple sequence alignments were generated using MUSCLE (Edgar, 2004). Convergence and effective sample sizes were evaluated using Tracer (Drummond and Rambaut, 2007). Maximum clade credibility trees were summarized using TreeAnnotator and visualized in FigTree v1.3.1. Trypanosoma vivax (MH184518.1) was used as the outgroup.

All laboratory and bioinformatic analyses, except Sanger sequencing, were conducted at the Department of Genetics, Microbiology and Immunology, Institute of Biosciences, UNESP. Sequences generated in this study were deposited in GenBank under accession numbers PZ062943–PZ062953.

2.4. Statistical analysis

Statistical analyses were performed using R software (version 4.5.2; R Core Team, 2025). Associations between infection status and categorical variables, including host species, sex, age class, and sampling season, were evaluated using Fisher's exact test for 2 × 2 contingency tables and the Fisher-Freeman-Halton exact test for contingency tables with more than two categories. Body weight was recorded as descriptive information but was not included as an explanatory variable because of the small sample size, marked body-size differences between host species, and the unbalanced distribution of individuals among species and age classes. Statistical significance was defined as p < 0.05.

3. Results

All 26 DNA samples analyzed tested positive for the endogenous mammalian gene (gapdh). Molecular screening detected the presence of T. cruzi (18S rRNA) in 42.3% (11/26) of the analyzed samples. Among the positive individuals, seven (63.6%) were Myrmecophaga tridactyla and four (36.4%) were Tamandua tetradactyla. No significant associations were observed between infection status and the evaluated categorical variables, including host species (p = 0.348), sex (p = 1.000), age class (p = 0.674), and sampling season (p = 0.275). All animals originated from municipalities within São Paulo State. Positive individuals were identified in Lençóis Paulista, Piratininga, Areiópolis, Avaré, Capão Bonito, Jaú, Promissão, and Cerqueira César, while Botucatu presented the highest number of positive cases (n = 3) (Fig. 1; Table 2).

Fig. 1.

Geographic distribution of Trypanosoma cruzi-positive anteaters (n = 11) across municipalities in São Paulo State, Brazil. The intensity of shading represents the number of infected animals per municipality, with darker tones indicating higher numbers of positive cases. White dots indicate the locations of T. cruzi-positive animals, and the acronyms represent the host species (MT = Myrmecophaga tridactyla; TT = Tamandua tetradactyla).

Positive cases were mainly distributed in the central-western region of São Paulo State, with Botucatu accounting for the highest number of infected individuals (n = 3) among the sampled municipalities. Insets highlight municipalities with additional positive records. The inset map at the bottom right indicates the geographic location of São Paulo State within Brazil.

Table 2.

Geographic distribution of Trypanosoma cruzi–positive anteaters by municipality in São Paulo State, Brazil.

Municipality	M. tridactyla (n)	T. tetradactyla (n)	Total positive (n)
Botucatu	2	1	3
Lençóis Paulista	0	1	1
Piratininga	0	1	1
Areiópolis	0	1	1
Avaré	1	0	1
Capão Bonito	1	0	1
Jaú	1	0	1
Promissão	1	0	1
Cerqueira César	0	1	1
Total	7	4	11

Animals originated from rescue events and were referred to veterinary institutions.

BLASTn analysis of the 18S (SSU) rRNA sequences revealed similarity values ranging from 93.66% to 99.65% in comparison with T. cruzi reference sequences. The seven sequences obtained from giant anteaters showed identities between 93.66% and 99.31%. Six sequences were identical to isolate C00964 of T. cruzi, while one corresponded to isolate C00259N. Among the sequences obtained from T. tetradactyla, one sample (TT-06) showed 99.65% identity with isolate C00964, whereas the remaining three sequences ranged from 97.18% to 99.17% identity with the 18S rRNA gene of the T. cruzi Y strain (Table 3). All sequences generated in this study were deposited in GenBank under accession numbers PZ062943–PZ062953.

Table 3.

BLASTn comparison of 18S rRNA sequences of Trypanosoma cruzi obtained from anteaters with reference sequences available in GenBank.

Sample ID	Host species	GenBank accession number (this study)	Closest BLAST match	Reference accession number	Identity (%)
MT-01	Myrmecophaga tridactyla	PZ062943	Trypanosoma cruzi isolate C00964	PV528790.1	99.31
MT-02	Myrmecophaga tridactyla	PZ062944	Trypanosoma cruzi isolate C00964	PV528790.1	99.31
MT-07	Myrmecophaga tridactyla	PZ062945	Trypanosoma cruzi isolate C00964	PV528790.1	99.31
MT-09	Myrmecophaga tridactyla	PZ062946	Trypanosoma cruzi isolate C00259N	PV528790.1	93.66
MT-11	Myrmecophaga tridactyla	PZ062947	Trypanosoma cruzi isolate C00964	PV528790.1	99.31
MT-14	Myrmecophaga tridactyla	PZ062948	Trypanosoma cruzi isolate C00964	PV528790.1	99.31
MT-15	Myrmecophaga tridactyla	PZ062949	Trypanosoma cruzi isolate C00964	PV528790.1	99.31
TT-01	Tamandua tetradactyla	PZ062950	Trypanosoma cruzi Y strain	AF301912	97.18
TT-03	Tamandua tetradactyla	PZ062951	Trypanosoma cruzi Y strain	AF301912	99.17
TT-04	Tamandua tetradactyla	PZ062952	Trypanosoma cruzi Y strain	AF301912	98.94
TT-06	Tamandua tetradactyla	PZ062953	Trypanosoma cruzi isolate C00964	PV528790.1	99.65

Sequences generated in this study were deposited in GenBank under accession numbers PZ062943–PZ062953.

Bayesian phylogenetic analysis based on a 650 bp fragment of the 18S rRNA gene produced a supported topology with low intraspecific divergence among T. cruzi sequences. The tree was rooted with Trypanosoma vivax, which remained clearly separated from the T. cruzi clade. The eleven sequences obtained from anteaters (GenBank accession numbers PZ062943–PZ062953), highlighted in red in Fig. 2, clustered within the known diversity of Trypanosoma cruzi and formed a well-supported clade. The major nodes defining this clade were strongly supported (posterior probabilities ≥0.95) relative to the reference sequences retrieved from GenBank (shown in black).

Fig. 2.

Bayesian phylogenetic tree based on partial 18S rRNA gene sequences of Trypanosoma cruzi obtained from anteaters and reference sequences retrieved from GenBank. Posterior probability values are indicated at the nodes. Sequences generated in the present study are highlighted in red, whereas reference sequences are shown in black. Branch lengths represent genetic distances inferred under the selected nucleotide substitution model. As expected for a highly conserved molecular marker such as 18S rRNA, the tree exhibits short branch lengths and low sequence divergence, reflecting its limited resolution for intraspecific discrimination. Nevertheless, the analysis allows reliable species-level identification and supports the placement of the obtained sequences within the broader phylogenetic context of T. cruzi.

Within the main clade, some internal structure was observed; however, branch lengths were short and sequence divergence was minimal, consistent with the conserved nature of the 18S rRNA marker. The sequences obtained in this study were phylogenetically close to, or interspersed with, reference sequences previously identified as T. cruzi. No clear clustering according to host or geographic origin was observed.

4. Discussion

The present study provides molecular evidence of T. cruzi circulation in anteaters from southeastern Brazil, reinforcing the role of wildlife in the maintenance of complex sylvatic transmission networks (Jansen et al., 2015). The detection of T. cruzi in a relatively high proportion of individuals suggests that parasite circulation may be associated with the ecological contexts in which wild mammals occur, particularly in landscapes affected by anthropogenic disturbance. Previous studies indicate that transmission dynamics can be influenced by changes in host community composition, increased interspecific contact, and proximity to human-modified environments, especially in transitional areas between sylvatic and peri-urban settings (Soto-Vivas et al., 2025).

The animals analyzed originated from municipalities within São Paulo State characterized by anthropogenically altered landscapes. Landscape structure, the distribution of human dwellings, and artificial lighting are factors that may favor the dispersal of triatomine vectors and increase contact between wildlife and infected vectors (Leite et al., 2011). Additionally, a study conducted with captive animals from the São Paulo Zoo and surrounding wildlife demonstrated that T. cruzi transmission may occur locally at the interface between forest remnants and human-managed environments. In that system, interactions among free-ranging mammals (Didelphis aurita and Coendou spinosus), infected triatomines (Panstrongylus megistus), and captive animals were associated with the maintenance of an active enzootic cycle even within highly urbanized settings (Ferreira et al., 2025).

Together, these findings are consistent with broader evidence from São Paulo State, where the recurrent detection of T. cruzi in vectors and wild hosts across multiple municipalities highlights the role of anthropogenically altered landscapes in sustaining local transmission cycles (Silva et al., 2024; Monteiro et al., 2025). Additionally, previous molecular studies involving bats in São Paulo State identified positive detections concentrated in the central-western region, including the municipality of Botucatu, which also accounted for the highest number of positive animals in the present study (França et al., 2024).

In natural environments, oral transmission represents one of the main routes of T. cruzi infection (Jansen et al., 2018). Although this pathway is considered important for several generalist mammalian species (Jansen et al., 2015, 2018), anteaters have a diet primarily restricted to ants and termites (Magioli et al., 2025), with no reports of triatomine consumption in the literature. In this context, exposure to infected vectors is more likely associated with interspecific ecological interactions and the use of shared transmission microhabitats rather than direct predation on triatomines. For example, ecological interactions observed in natural environments suggest that T. tetradactyla may contribute to linking T. cruzi transmission contexts between canopy and ground-level environments. In the Pantanal, coati (Nasua nasua) nests function as transmission hubs harboring infected triatomines, for which T. tetradactyla was identified as the exclusive blood meal source (Pessanha et al., 2023). The recurrent use of these arboreal structures, together with terrestrial shelters such as giant armadillo (Priodontes maximus) burrows, suggests a potential role for this species in connecting parasite circulation across distinct forest strata (Pessanha et al., 2023).

Although body weight was not included as an explanatory variable in the present study due to the small sample size, marked body-size differences between species, and the unbalanced distribution of individuals among age classes, previous studies involving other mammalian hosts have suggested that body mass may influence exposure to vectors and pathogens. Larger individuals may provide greater surface area, emit stronger thermal and chemical cues, and sustain higher parasite burdens, potentially increasing contact rates with hematophagous vectors (Han et al., 2015).

Regarding age class, although no significant association was detected, aspects of anteater biology should be considered when interpreting these findings. Juvenile individuals of both anteater species typically remain in prolonged physical contact with their mothers and are frequently transported on their backs during early developmental stages. Such behavior may facilitate shared exposure to infected vectors, potentially contributing to the absence of detectable differences among age classes (Bertassoni et al., 2022).

Additionally, there is indirect evidence suggesting that seasonality may influence T. cruzi transmission. Previous studies have demonstrated increased abundance and dispersal of triatomine vectors during warmer periods (Vazquez-Prokopec et al., 2006), which may result in higher vector density and increased contact rates between infected triatomines and susceptible hosts such as anteaters. Therefore, although no seasonal effect was detected in the present study, seasonality should still be considered as a potentially relevant ecological factor in transmission dynamics. Furthermore, sampling was unevenly distributed across months and among host categories, which may have reduced the statistical power to detect potential associations for the evaluated categorical variables.

The 18S rRNA marker, although highly conserved, proved adequate for confirming that the sequences obtained from anteaters belong to T. cruzi. Bayesian phylogenetic analysis recovered a supported topology at the major nodes, reinforcing the utility of this marker for species-level identification and phylogenetic positioning. However, due to its conserved nature, the 18S rRNA gene lacks sufficient resolution for intraspecific discrimination, preventing the assignment of discrete typing units (DTUs; TcI–TcVI). As demonstrated by Zingales et al. (2009, 2012), accurate lineage classification in T. cruzi requires more polymorphic molecular targets or multilocus approaches. Therefore, although the present analysis robustly supports species-level identification, characterization of specific genetic lineages would require additional markers beyond the scope of this study. Nevertheless, the use of 18S rRNA remains valuable for positioning novel sequences within a broader phylogenetic framework and ensuring comparability with reference sequences available in international databases.

From an ecological and epidemiological perspective, the consistent detection of T. cruzi in anteaters expands current knowledge regarding the diversity of wild hosts participating in natural transmission cycles. The clustering of the obtained sequences with reference sequences from diverse hosts suggests low host specificity, indicating that these lineages likely circulate among multiple mammalian hosts and vectors. This broad host circulation reinforces the relevance of anteaters within sylvatic transmission systems and highlights the potential interconnection between sylvatic and domestic cycles, with possible implications for human health.

Although the 18S rRNA marker does not allow definitive characterization of intraspecific diversity or lineage assignment, it remains valuable for confirming species-level identity of T. cruzi, positioning sequences within supported phylogenetic clades, and reinforcing the ecological relevance of anteaters as wild hosts. Nevertheless, future studies incorporating complementary molecular markers would provide higher-resolution phylogenetic analyses and improve understanding of parasite diversity in these mammals.

Taken together, our findings support the role of anteaters as relevant hosts within T. cruzi transmission systems, particularly in anthropogenically influenced landscapes. The samples analyzed in this study were obtained over an extended time period, and although no clear temporal or ecological patterns could be assessed due to opportunistic sampling, the consistent detection of T. cruzi across different years and municipalities highlights the widespread circulation and persistence of the parasite in São Paulo State. Although direct implications for human transmission cannot be inferred from the present data, these findings reinforce the participation of anteaters in parasite maintenance within environments where these species persist and emphasize the importance of future studies integrating ecological information and multiple molecular targets to better understand host–parasite dynamics.

Ethics statement

All procedures involving animals were conducted in accordance with institutional and national guidelines for the care and use of wildlife. The study was approved by the Ethics Committee on the Use of Animals of São Paulo State University (CEUA-UNESP; protocol no. 0562/2023) and authorized by the Brazilian Biodiversity Authorization and Information System (SISBIO; permit no. 86964-1).

Funding statement

This research received no specific grant from any funding agency in the public, commercial or not-for-profit sectors.

CRediT authorship contribution statement

Mateus Oliveira Machado: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Validation, Visualization, Writing – original draft, Writing – review & editing. Larissa Pereira Rodrigues: Conceptualization, Data curation, Formal analysis. João Otávio Mochiuti: Conceptualization, Data curation, Methodology. Catharina Eulasya Resende: Investigation, Methodology, Project administration. Talita Aleixo Nakajima: Methodology, Supervision, Validation, Writing – original draft. Lígia Souza Lima Silveira da Mota: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Supervision, Writing – original draft.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A. Supplementary data

The following is the Supplementary data to this article.