Serum GPX4 and LPO as Biomarkers for Perioperative Oxidative Stress: Impact of Ciprofol Anesthesia in A Randomized Controlled Trial

Abstract

Background:

Perioperative oxidative stress contributes to postoperative organ dysfunction, but sensitive mechanistic biomarkers are limited.

Objectives:

This study uses serum GPX4 and lipid peroxides to quantify oxidative stress, explore ferroptosis-related pathways, and evaluate the antioxidative effects of ciprofol anesthesia in patients undergoing thoracoscopic lung cancer surgery.

Materials and Methods:

Patients scheduled for video-assisted thoracoscopic surgery (VATS) for lung cancer at the Fourth Affiliated Hospital of Soochow University were enrolled and randomly assigned to one of three groups (n=50 per group): a Ciprofol group, a Propofol group, and a Sevoflurane group. The Ciprofol group received Ciprofol for induction and continuous intravenous maintenance; the Propofol group received Propofol for both induction and maintenance; and the Sevoflurane group received Ciprofol for induction followed by Sevoflurane inhalation for maintenance. Arterial blood samples were collected at four time points: before anesthesia induction (T0), after induction (T1), at the end of surgery (T2), and 24 hours postoperatively (T3). Serum levels of GPX4 and LPO were measured. Hemodynamic changes were compared among the three groups under the different anesthetic regimens. A549 lung adenocarcinoma cells were treated with varying concentrations of Ciprofol (10 µM, 25 µM, 50 µM and 100 µM) for 24 hours. Cell viability was assessed using the CCK-8 assay, and cell proliferation was evaluated using the EdU assay. After treatment, RNA was extracted from the treated and control groups for qRT-PCR analysis to measure GPX4 expression levels as an indicator of oxidative stress

Results:

In the Ciprofol group, serum GPX4 levels significantly increased, while LPO levels markedly decreased at T2 and T3. In the Propofol group, GPX4 levels were significantly higher and LPO levels significantly lower at T2 and T3 compared to the Sevoflurane group (P<0.01). At T1, the heart rate in the Propofol group was significantly higher than in the Ciprofol group. At T2, heart rates in both the Propofol and Sevoflurane groups were higher than in the Ciprofol group (all P<0.01). Ciprofol treatment at 100 µM significantly inhibited tumor cell growth, with the strongest effect observed at this concentration. The subsequent experiments were conducted at 50 µM. After 24 hours, a significant decrease in GPX4 expression was observed in the treated group compared to the control group. Additionally, Ciprofol significantly inhibited tumor cell proliferation, as shown by a marked reduction in EdU-positive cells.

Conclusion:

Ciprofol elevates postoperative serum GPX4 and reduces LPO, alleviating oxidative stress in thoracoscopic lung cancer surgery with minimal effects on heart rate. Monitoring GPX4 and LPO may assess perioperative oxidative stress. In A549 lung adenocarcinoma cells, Ciprofol suppresses GPX4 expression and tumor proliferation, suggesting dual roles in oxidative stress modulation and tumor growth inhibition.

1. Background

During thoracic surgery, factors such as surgical trauma, hypoxia caused by one-lung ventilation, and intermittent interruption of blood flow can lead to excessive production of free radicals, triggering significant oxidative stress and ultimately affecting patient outcomes ( 1 ). Anesthetic agents may contribute to free radical generation by disrupting cellular energy metabolism, impairing mitochondrial function, or activating oxidase systems ( 2 , 3 ). However, several studies have suggested that certain anesthetics may attenuate intraoperative and postoperative oxidative stress by activating antioxidant enzymes or elevating endogenous antioxidant levels ( 4 , 5 ). Therefore, suppre-ssing postoperative inflammatory mediator release and mitigating perioperative acute inflammatory and stress responses have become key strategies for improving patient prognosis.

Glutathione peroxidase 4 (GPX4) reduces lipid peroxides (LPO), thereby protecting cells from oxidative injury and ferroptosis. It is thus considered a reliable biomarker for assessing oxidative stress levels ( 6 - 8 ).

2. Objectives

Based on these considerations, the present study investigates the effects of different anesthetic agents on oxidative stress during anesthesia maintenance by measuring serum GPX4 and LPO levels, while simultaneously monitoring heart rate changes.

3. Materials and Methods

3.1. Study Design and Participant Enrollment

This study was conducted as part of a prospective clinical trial (Registration No.: ChiCTR2200062756). A total of 150 patients who underwent thoracoscopic radical lung cancer surgery under general anesthesia at the Fourth Affiliated Hospital of Soochow University between November 20, 2022, and November 20, 2024, were included in the study. Eligible participants were adults aged 18 to 70 years who underwent video-assisted thoracoscopic surgery (VATS) or robot-assisted thoracic surgery (RATS), including wedge resection, segmentectomy, or lobectomy, and provided written informed consent. Patients were excluded if they were younger than 18 or older than 70 years, had an American Society of Anesthesiologists (ASA) physical status of III–IV, or had known renal, hepatic, chronic pulmonary (such as COPD or asthma), or cardiac diseases (including coronary artery disease, decompensated heart failure, or myocardial infarction within the previous six months), as well as those with obesity (BMI > 30). Using a random number table method, patients were assigned to the Ciprofol group, Propofol group, or Sevoflurane group, with 50 patients in each group. Baseline characteristics were comparable among the groups. The study protocol was approved by the Ethics Committee of the Fourth Affiliated Hospital of Soochow University (Approval No. 220084).

All patients fasted from food and water for more than eight hours before surgery. Upon entering the operating room, routine monitoring was initiated, including electrocardiography (ECG), invasive arterial blood pressure (ABP), heart rate (HR), and oxygen saturation (SpO₂). Anesthesia induction in all three groups included sufentanil 0.4 μg.kg^-1 and rocuronium 1 mg.kg^-1. The Ciprofol group received Ciprofol 0.4 mg.kg^-1 for induction, the Propofol group received Propofol 2 mg.kg^-1, and the Sevoflurane group received Ciprofol 0.4 mg.kg^-1. Following induction, double-lumen endotracheal intubation was performed, and mechanical ventilation was initiated, with tube size selected according to patient height and weight. One-lung ventilation was carried out with a tidal volume of 4–6 mL.kg^-1, respiratory rate of 12–16 breaths/min, and end-tidal CO₂ maintained between 35-45 mmHg. Anesthesia was maintained using continuous intravenous infusion of Ciprofol at 0.8 mg.kg.^-1h^-1 in the Ciprofol group, Propofol at 4 mg.kg.^-1h^-1 in the Propofol group, and 2% Sevoflurane inhalation in the Sevoflurane group, with adjustments guided by bispectral index (BIS) monitoring. All patients received continuous infusion of remifentanil at 0.2 mg.kg.^-1min^-1 for intraoperative analgesia, titrated according to clinical demand. Extubation was performed when patients regained consciousness, exhibited adequate spontaneous respiration, achieved stable hemodynamic parameters, and met predefined criteria for tidal volume and respiratory rate. Intraoperative fluid management was conducted according to a standardized protocol. Balanced crystalloids were administered as the primary maintenance fluid, with additional supplementation based on estimated blood loss and hemodynamic status. Colloids were used when clinically indicated. The total intraoperative infusion volume and urine output were recorded for all patients to evaluate fluid balance.

3.2. Observation Indicators

Arterial blood samples were collected at four predefined time points: before anesthesia induction (T0), after induction (T1), at the end of surgery (T2), and 24 hours postoperatively (T3). Blood samples were obtained using non-EDTA tubes and centrifuged to separate serum, which was stored and analyzed promptly. Serum levels of glutathione peroxidase 4 (GPX4) and lipid peroxides (LPO) were quantified using commercially available enzyme-linked immunosorbent assay (ELISA) kits (AIMENG UNING Biotechnology Co., Ltd., Shanghai, China) according to the manufacturer’s instructions. Briefly, standards and serum samples were added to microplate wells and incubated, followed by sequential incubation with biotinylated detection antibody and streptavidin–biotin complex. After substrate reaction with tetramethylbenzidine (TMB), the reaction was terminated, and absorbance was measured at the specified wavelength using a microplate reader. Concentrations were calculated based on standard curves. Heart rate (beats/min) was recorded at each time point to evaluate perioperative hemodynamic changes among the three groups (Fig. 1). The T2 time point (end of surgery) was predefined as the primary endpoint for biomarker analysis.

Figure 1.

The flowchart illustrates the key steps of the randomized controlled trial, including participant enrollment, randomization, intervention, and data collection at specified time points.

3.3. Cell Culture

Lung adenocarcinoma A549 cells were cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. The cells were maintained in an incubator at 37 °C with 5% CO₂. The seeding density was 1 × 10⁶ cells.mL^-1. Subculture was performed when the cells reached 80%-90% confluence.

3.4. RNA Extraction and Quantitative Real-Time PCR (qRT–PCR) Analysis

Total RNA was extracted from cells using TRIzol reagent (Invitrogen, Carlsbad, USA) according to the manufacturer’s instructions. The concentration, purity, and integrity of the RNA were assessed using a NanoDrop 2000c spectrophotometer (Thermo Scientific, Wilmington, USA). For reverse transcription, total RNA was used to synthesize complementary DNA (cDNA) with All-In-One 5×RT MasterMix (ABM, Vancouver, Canada). Subsequently, quantitative real-time PCR (qRT–PCR) was performed using SYBR Green Master Mix (Applied Biosystems, Foster City, USA) on an ABI real-time PCR detection system. Relative gene expression levels were calculated using the comparative Ct (2^-∆∆Ct) method, with GAPDH as an internal reference. The primers used were GPX4-FP: GACCGGAGATCCACGAATGT and GPX4-RP: CCGAACTGGTTACACGGGAA.

3.5. CCK8 Cell Proliferation Assay

A549 cells in the logarithmic growth phase were seeded in a 96-well plate at 100 µL with approximately 2 × 10³ cells per well and incubated for 24 hours. Then, 10 µL of CCK-8 solution was added to each well, with a blank control group included. The plate was incubated for an additional 1 hour in the incubator. Absorbance at 450 nm was measured using a microplate reader, and a growth curve was plotted.

3.6. Tumor Cell Proliferation Assay (EdU)

Cell proliferation was assessed using the BeyoClick^TM EdU-555 Cell Proliferation Kit (Beyotime, Shanghai, China) according to the manufacturer’s instructions. A549 cells in the logarithmic growth phase were incubated with EdU working solution at 37 °C for 2 hours. After incubation, cells were fixed with 4% paraformaldehyde at room temperature for 30 minutes and then incubated with Click reaction buffer to prevent light exposure. The cell nuclei were stained with Hoechst 33342. EdU-positive cells were observed and imaged using a confocal microscope (Olympus, Tokyo, Japan).

3.7. Statistical Analysis

Statistical analyses were performed using GraphPad Prism version 10 (GraphPad Software, La Jolla, CA, USA). Continuous variables were expressed as mean ± standard deviation (SD). Normality was assessed prior to parametric testing. Comparisons between two groups were conducted using the independent-samples t-test for normally distributed data. To evaluate longitudinal changes in GPX4 and LPO levels across time points and between groups, two-way repeated-measures analysis of variance (ANOVA) was applied, with time and treatment group as factors. Interaction effects (group × time) were examined to determine whether dynamic biomarker changes differed among anesthetic regimens. When appropriate, post hoc multiple comparisons were performed with correction for multiple testing. A two-sided P value < 0.05 was considered statistically significant.

4. Results

4.1. Serum GPX4 and LPO Levels at Different Time Points across Three Groups

Serum GPX4 and LPO concentrations were measured at T0, T1, T2, and T3. In the Ciprofol group, serum GPX4 levels significantly increased at T2 and T3. Similarly, the Propofol group demonstrated significantly higher GPX4 levels than the Sevoflurane group at T2 and T3, with all differences reaching statistical significance (Fig. 2, Table 1). Regarding LPO levels, the Ciprofol group showed a marked reduction at T2 and T3, and the Propofol group likewise exhibited significantly lower LPO levels than the Sevoflurane group at these time points (Fig. 3, Table 1).

Figure 2.

Serum GPX4 levels at different time points in the Ciprofol, Propofol, and Sevoflurane groups.

Table 1.

Comparison of serum GPX4 and LPO levels among the three groups at different time points ($\overline{x}$±s, ng.ml^-1)

Group	Time	GPX4	LPO
Ciprofol	T0	8.62±1.81	0.92±0.31
	T1	7.99±2.16	0.89±0.30
	T2	8.43±2.07	0.67±0.28
	T3	9.75±1.64	0.54±0.27
Propofol	T0	7.94±1.66	0.79±0.36
	T1	7.66±1.97	0.77±0.36
	T2	7.58±1.76	0.76±0.30
	T3	7.26±0.77	0.66±0.33
Sevoflurane	T0	8.03±1.44	0.81±0.31
	T1	7.48±1.69	0.77±0.30
	T2	5.27±1.44	0.96±0.30
	T3	3.77±1.15	0.86±0.36

Figure 3.

Serum LPO levels at different time points in the Ciprofol, Propofol, and Sevoflurane groups.

4.2. Comparison of Hemodynamic Parameters among the Three Groups

Heart rate was measured at T0, T1, T2, and T3 to evaluate hemodynamic fluctuations among the groups. At T1, patients in the Propofol group exhibited a significantly higher heart rate compared with those in the Ciprofol and Sevoflurane groups. At T2, both the Propofol and Sevoflurane groups showed a marked increase in heart rate relative to the Ciprofol group, with all differences reaching statistical significance (Fig. 4,5). These findings suggest that Ciprofol provides superior hemodynamic stability, exerting minimal influence on heart rate during use (Table 2).

Figure 4.

Heart rate changes at different time points in the Ciprofol, Propofol, and Sevoflurane groups.

Figure 5.

Comparison of heart rate among the three groups at T0, T1, T2, and T3.

Table 2.

Comparison of heart rate (beats/min) among the three groups at different time points.

Group	Time	Heart rate (beats/min)
Ciprofol	T0	79.16±9.5
	T1	79.64±8.13
	T2	81.42±7.51
	T3	81.62±6.83
Propofol	T0	78.8±8.59
	T1	81.62±10.10
	T2	87.92±12.74
	T3	79.8±7.47
Sevoflurane	T0	79.72±8.63
	T1	79.96±7.74
	T2	85.46±8.82
	T3	82.6±7.65

4.3. Expression of GPX4 mRNA in A549 Lung Adenocarcinoma Cells before and After Treatment with Rosmarinic Acid

Ciprofol was dissolved in sterile PBS and further diluted in cell culture medium to achieve final concentrations of 10 µM, 25 µM, 50 µM, and 100 µM. The cells were treated for 24 hours, and cell viability at different concentrations was assessed (Fig. 6A). The results indicated that Ciprofol at a concentration of 100 µM exhibited the strongest inhibitory effect on tumor cell growth, and subsequent experiments were conducted at a concentration of 50 µM. After 24 hours of treatment, RNA was extracted from both the treated group (with Ciprofol) and the control group (without treatment) for qRT-PCR analysis. The GPX4 expression levels were analyzed, and the results showed a decrease in GPX4 expression in the treated group (Fig. 6B).

Figure 6.

Effects of Ciprofol on cell viability and GPX4 expression. A) Cell viability was assessed after 24-hour treatment with Ciprofol at concentrations of 10 µM, 25 µM, 50 µM, and 100 µM. B) qRT-PCR analysis was performed to compare GPX4 expression levels between the two groups.

4.4. Inhibition of Tumor Cell Proliferation by Ciprofol

The proliferation ability of cells in both groups was assessed using the EdU assay. The results showed that Ciprofol treatment significantly inhibited tumor cell proliferation, as evidenced by a marked decrease in the number of EdU-positive cells (Fig. 7).

Figure 7.

EdU assay was used to assess cell proliferation (red: EdU-555, blue: DAPI, Scale bar: 100 µm).

5. Discussion

Thoracic surgery–related trauma and one-lung ventilation can trigger oxidative stress responses, leading to increased production of free radicals that damage cells and tissues, thereby exacerbating postoperative inflammation, impairing tissue repair, and ultimately affecting postoperative recovery and prognosis. According to the Enhanced Recovery after Surgery (ERAS) concept—an evidence-based perioperative management strategy—a key objective is to reduce surgical stress responses and promote rapid postoperative recovery ( 9 ).

Glutathione peroxidase 4 (GPX4) is a core suppressor of ferroptosis and plays a crucial role in enhancing the body’s antioxidant defense by consuming glutathione (GSH) to eliminate lipid peroxides (LPO), thereby maintaining intracellular lipid homeostasis. Abnormal GPX4 expression has been closely linked to various diseases, including inflammatory bowel disease ( 10 ), myocardial ischemia–reperfusion injury ( 11 ), and cancer ( 12 ). During tumor metastasis, particularly in circulating tumor cells exposed to high oxidative stress, GPX4 is essential for resisting ferroptosis via the system xc–GPX4 axis ( 13 ). In recent years, increasing attention has been directed toward the interplay between ferroptosis and anesthesia recovery, opening new avenues for anesthesia-related organ protection. Anesthetic agents may induce or inhibit ferroptosis by exerting anti-inflammatory effects or regulating intracellular Fe²⁺ homeostasis ( 14 ). However, studies assessing oxidative stress by measuring serum GPX4 and LPO levels remain scarce ( 15 ). Therefore, the present study aimed to explore strategies to minimize physiological stress responses by evaluating serum GPX4 and LPO levels and monitoring hemodynamic changes under different anesthetic regimens.

Ciprofol is a novel intravenous anesthetic characterized by rapid onset, fast recovery, high potency, and minimal injection pain. Its cyclopropyl substitution based on the Propofol structure forms a chiral configuration that enhances steric hindrance and increases affinity for GABA_A receptors ( 16 , 17 ). It is suitable for procedural sedation, general anesthesia for surgery, and ICU sedation. Prior research has shown that Ciprofol exerts neuroprotective effects in Parkinson’s disease models by improving neuronal and mitochondrial function, increasing tyrosine hydroxylase (TH) expression in the substantia nigra, and inhibiting activation of the Wnt/β-catenin signaling pathway ( 17 ). Propofol, in contrast, primarily mitigates perioperative oxidative stress, whereas Sevoflurane, a newer inhalational anesthetic, offers advantages such as rapid onset, low irritation, and excellent controllability.

In this study, serum GPX4 and LPO measurements at T0, T1, T2, and T3 demonstrated that Ciprofol significantly increased GPX4 and reduced LPO at T2 and T3. Propofol also produced significantly higher GPX4 levels and lower LPO levels compared with Sevoflurane at T2 and T3. Heart-rate monitoring revealed that at T1, the Propofol group exhibited a higher heart rate than the Ciprofol and Sevoflurane groups; at T2, both Propofol and Sevoflurane resulted in higher heart rates than Ciprofol. Collectively, these findings suggest that Ciprofol exerts minimal influence on hemodynamics and provides superior cardiovascular stability. Moreover, in vitro experiments using A549 lung adenocarcinoma cells showed that Ciprofol significantly inhibited tumor cell proliferation and reduced GPX4 expression, further supporting its potential to modulate oxidative stress and suppress tumor growth.

The observed increase in serum GPX4 levels in the clinical setting is unlikely to result from a universal upregulation of GPX4 transcription across all tissue types. Rather, it may reflect an indirect systemic effect of ciprofol. By attenuating anesthesia- and surgery-induced stress responses, improving tissue perfusion, and potentially modulating systemic inflammatory pathways, ciprofol may contribute to an overall improvement in redox homeostasis. The elevated serum GPX4 levels could therefore represent enhanced stability, release, or preservation of GPX4 activity from key organs such as the liver or skeletal muscle, rather than a direct transcriptional activation in all cells.

In contrast, the downregulation of GPX4 mRNA observed in vitro represents a cell-autonomous effect of ciprofol within a specific tumor cell context. This reduction may partially underlie its inhibitory effect on tumor cell proliferation. Importantly, the in vitro findings primarily suggest a potential novel role of ciprofol in tumor biology, rather than directly explaining its systemic protective effects in anesthetized patients. At present, these two observations should be interpreted as parallel phenomena occurring at different biological levels. Differences in tissue specificity, drug concentration, exposure duration, and the inherent complexity of in vivo versus in vitro environments may account for this apparent discrepancy. Attempting to reconcile these findings under a single simplified mechanistic framework represents a limitation of the current study.

Several additional limitations should be acknowledged. In the sevoflurane group, ciprofol was used for induction but not maintenance, which may partially confound intergroup comparisons. Moreover, perioperative variables—including the administration of vasoactive agents, fluid manage-ment strategies, duration of one-lung ventilation, bispectral index (BIS) targets, and titration of remifentanil—may all influence oxidative stress responses and hemodynamic parameters. Although these factors were clinically controlled, residual confounding cannot be fully excluded.

Future studies will aim to strengthen the clinical relevance of these findings by incorporating predefined postoperative outcome measures. In particular, we plan to evaluate the incidence of pulmonary complications and other key recovery indicators to determine whether perioperative modulation of GPX4 and LPO translates into meaningful clinical benefits.

Overall, Ciprofol significantly increases serum GPX4 and decreases LPO during the perioperative period, thereby enhancing antioxidant defense capacity while maintaining optimal hemodynamic stability with minimal disturbance. These findings are supported by in vitro experiments, where Ciprofol treatment in A549 lung adenocarcinoma cells inhibited tumor cell proliferation and reduced GPX4 expression, indicating its potential in modulating oxidative stress and suppressing tumor growth. Dynamic monitoring of serum GPX4 and LPO is valuable for evaluating perioperative oxidative stress in patients undergoing thoracoscopic lung cancer surgery, offering a promising approach for improving patient outcomes in clinical practice.