Summary
Hyperuricemia (HUA) affects diverse biological processes and signaling pathways across multiple organ systems; however, its impact on the intestine remains poorly understood. Here, we show that HUA disrupts intestinal barrier function primarily by impairing intestinal stem cell (ISC) function, which is essential for epithelial renewal. Mechanistically, elevated uric acid (UA) directly binds to the mitochondrial protein CCDC90B, leading to excessive mitochondrial ROS accumulation, activation of the NLRP3 inflammasome, and subsequent initiation of downstream pyroptotic signaling. The resulting exhaustion of the intestinal stem cell pool impairs epithelial regeneration and further weakens intestinal barrier integrity. Collectively, these findings reveal a previously unrecognized mechanism linking UA to ISC dysfunction and highlight CCDC90B as a potential therapeutic target for HUA-associated intestinal dysfunction.
Keywords: hyperuricemia, intestinal stem cells, pyroptosis, intestinal organoids, CCDC90B
Graphical abstract

Highlights
-
•
Single-cell transcriptomic analysis reveals ISC depletion with enriched pyroptosis signatures
-
•
Uric acid directly engages CCDC90B to perturb mitochondrial function
-
•
AAV8-CCDC90B curbs ROS, suppresses inflammation, and restores barrier integrity
-
•
CCDC90B/NLRP3 axis is a promising target for hyperuricemic intestinal dysfunction
In this article, Huang and colleagues show that hyperuricemia disrupts intestinal barrier function by impairing intestinal stem cell activity. Mechanistically, elevated uric acid binds to mitochondrial protein CCDC90B, triggering excessive ROS accumulation, NLRP3 inflammasome activation, and pyroptotic signaling. This leads to intestinal stem cell pool exhaustion and impaired epithelial regeneration, identifying CCDC90B as a potential therapeutic target for hyperuricemia-associated intestinal dysfunction.
Introduction
The digestive system is pivotal for systemic metabolism and health. Among its components, the intestine not only mediates nutrient digestion and absorption but also preserves systemic homeostasis (Garrett et al., 2010; Shamburek and Farrar, 1990; Spiller, 1994). Intestinal stem cells (ISCs), with their capacity for self-renewal and multi-lineage differentiation, sustain epithelial turnover and barrier integrity; thus, ISC homeostasis is essential for intestinal function (Barker, 2014; Gehart and Clevers, 2019). However, lifestyle changes and aging populations have led to a rise in metabolic disorders, which can adversely affect intestinal physiology (Shay and Yilmaz Ö, 2025). Hyperuricemia (HUA), a common feature of metabolic syndrome, has shown a steadily increasing incidence, yet its impact on ISC homeostasis remains poorly defined.
Uric acid (UA), the final product of purine metabolism, is synthesized in the liver and eliminated mainly through the kidneys, with ∼30% excreted via the intestine (Holmes et al., 1972; Steele, 1971). Transporters such as SLC22A12, SLC2A9, and ABCG2, together with gut microbiota-derived purine metabolism, critically regulate UA homeostasis (Reginato et al., 2012; So and Thorens, 2010). While UA at physiological levels acts as an antioxidant, elevated UA promotes oxidative stress, inflammation, and metabolic dysfunction. HUA is a well-established risk factor for gout and is closely linked to hypertension, atherosclerosis, chronic kidney disease, and type 2 diabetes (Dalbeth et al., 2019; Du et al., 2024; Keating and Croom, 2007; Khan et al., 2016). Despite extensive studies, the molecular targets of UA in the intestine remain unclear. Defining these mechanisms in ISCs may not only clarify intestinal contributions to HUA pathophysiology but also inform early interventions for metabolic disease-related intestinal dysfunction.
Mitochondria are central to energy metabolism in ISCs, with the electron transport chain generating reactive oxygen species (ROS) as byproducts (Detmer and Chan, 2007). Superoxide anion (O2−), the primary mitochondrial ROS, is converted to hydrogen peroxide (H2O2) by superoxide dismutase (SOD) and further detoxified by antioxidant systems such as glutathione peroxidase and catalase, maintaining ROS homeostasis (Adam-Vizi and Chinopoulos, 2006; Willems et al., 2015). ISCs are highly sensitive to ROS, which at moderate levels regulate signaling and differentiation, but imbalances can disrupt mitochondrial function and ISC maintenance (Hsu et al., 2023; Iatsenko et al., 2018; Wu et al., 2021). The molecular mechanisms linking HUA-induced metabolic stress to mitochondrial ROS accumulation and ISC dysfunction remain unclear.
In this study, single-cell RNA sequencing (scRNA-seq) of purine diet-induced HUA mice revealed impaired intestinal barrier integrity with reduced ISC populations, indicating ISC dysfunction as a key consequence of elevated UA. Bioinformatic analyses implicated ISC pyroptosis as a downstream process. Using DARTS, we identified CCDC90B as a direct UA target that promotes mitochondrial ROS accumulation and triggers ISC pyroptosis. Targeting CCDC90B mitigated UA-induced pyroptosis and restored barrier integrity in intestinal organoids. Together, these findings reveal a previously unrecognized mechanism by which UA perturbs ISC homeostasis and highlight CCDC90B as a potential therapeutic target in HUA-associated intestinal dysfunction.
Results
HUA disrupts intestinal homeostasis
To mimic human HUA, we established a mouse model using adenine combined with potassium oxonate, which robustly elevated serum UA levels (Figure 1A). Histological analyses revealed marked epithelial injury, as shown by increased injury scores, reduced villus height, and diminished crypt depth in the jejunum (Figures 1B–1E), indicating impaired epithelial architecture.
Figure 1.
Hyperuricemia disrupts intestinal homeostasis
(A) Serum uric acid level of WT and HUA intestine (n = 6 mice per group; unpaired t test).
(B) Representative H&E staining images and their magnified versions in WT and HUA intestines (scale bars, 200 μm for original pictures and 50 μm for enlarged pictures).
(C–E) Statistical analysis of histological injury score, jejunal villus height, and jejunal crypt depth in (B) (n = 6 mice per group; unpaired t test).
(F) Statistical analysis of the serum cytokines (IL-1β, IL-6, TNF-α, IL-22) in WT and HUA mice (n = 6 mice per group; unpaired t test).
(G–J) Statistical analysis of the relative expression levels of genes related to the intestinal barrier function of WT and HUA intestine (n = 6 mice per group; unpaired t test).
(K and L) Representative immunofluorescence staining and statistics of intestinal tight junction proteins Occludin and ZO-1 in WT and HUA mice (scale bars, 100 μm, n = 6 mice per group; unpaired t test).
(M–O) Western blot analysis and statistics of intestinal Occludin and ZO-1 in WT and HUA mice (n = 6 mice per group; unpaired t test).
(P and Q) Analysis of intestinal bacterial species and genus levels in WT and HUA mice. (n = 3 mice per group).
All data are mean ± SEM; In all bar charts, each dot represents one data point; ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001, ns: no significant.
Since UA can trigger inflammation, we next measured systemic cytokine levels. Serum IL-1β, IL-6, TNF-α, and IL-22 were significantly elevated (Figure 1F), and intestinal IL-22 mRNA was upregulated (Figure 1G), linking HUA to mucosal inflammatory activation. Consistently, the expression of tight junction genes (Occludin, Claudin-1, Zo-1) was reduced (Figures 1H–1J), and immunofluorescence together with immunoblotting confirmed decreased Occludin and ZO-1 protein levels (Figures 1K–1O), demonstrating barrier disruption at both transcript and protein levels.
Given that epithelial damage and barrier dysfunction often reshape the microbial ecosystem (Albillos et al., 2020; Xie et al., 2025), we performed 16S rRNA sequencing, which revealed profound alterations in gut microbiota composition (Figures 1P–1Q). Collectively, these results demonstrate that HUA compromises intestinal homeostasis through epithelial injury, inflammatory activation, barrier impairment, and microbial dysbiosis.
HUA reduces ISC abundance
To further explore how HUA shapes the intestinal microenvironment, we conducted scRNA-seq to comprehensively profile intestinal cell populations. This analysis revealed a marked remodeling of intestinal cellular composition under hyperuricemic conditions (Figures 2A and 2B). Cell count analysis revealed a significant reduction in stem cells in the HUA group (Figure 2C). Milo analysis further showed that most stem cell-associated neighborhoods exhibited negative logFC values in the cell-type-stratified neighborhood-level distribution (Figure 2D). In addition, the median neighborhood logFC for stem cells was also below zero in the cell type summary plot (Figure 2E), supporting an overall depletion of the stem cell compartment in HUA. This reduction was further validated by immunofluorescence staining, which demonstrated a pronounced loss of OLFM4-positive cells in the intestinal epithelium (Figures 2F and 2G).
Figure 2.
Hyperuricemia reduces intestinal stem cell abundance
(A) Cell clusters of the scRNA-seq data from WT and HUA mice (A total of 64,093 cells were analyzed, including 34,384 cells from WT and 29,709 cells from HUA mice; n = 3 mice per group).
(B) Gene expression profiles of different cells in the intestine (n = 3 mice per group).
(C) Statistical analysis of the relative number of different cells from WT and HUA mice in (A) (n = 3 mice per group).
(D) The distribution of neighborhood-level logFC values across annotated cell types (n = 3 mice per group).
(E) Median neighborhood logFC for each annotated cell type (HUA vs. WT; n = 3 mice per group).
(F–G) Immunofluorescence staining images of Olfm4 and statistical analysis of MFI in WT and HUA mice (scale bars, 100 μm for original pictures and 20 μm for enlarged pictures; n = 6 mice per group; unpaired t test).
(H) Bubble plot of functional enrichment analysis of differentially expressed genes in HUA and WT mice.
All data are mean ± SEM; In all bar charts, each dot represents one data point; ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001, ns: no significant.
In addition, Gene Ontology analysis of differentially expressed genes in ISCs revealed significant enrichment of pathways related to mitochondrial function and inflammation (Figure 2H), suggesting that UA may impair mitochondrial homeostasis and activate inflammatory programs in ISCs. Collectively, these findings indicate that HUA not only reduces ISC abundance and stemness marker expression but also induces mitochondrial and inflammatory dysfunction, thereby compromising intestinal epithelial maintenance.
HUA induces pyroptosis in ISCs
To further explore the mechanisms underlying the altered ISC state, we next analyzed the expression of genes involved in multiple forms of programmed cell death, including apoptosis, necroptosis, ferroptosis, cuproptosis, and pyroptosis. Among these, only pyroptosis-related genes were markedly upregulated in the HUA group (Figure 3A). Consistent with this, GSEA analysis revealed significant enrichment of the NOD-like receptor signaling pathway, a canonical regulator of pyroptosis (Figure 3B). Given the central role of inflammasomes in mediating pyroptosis, we next profiled inflammasome components. Notably, Nlrp3 mRNA expression was significantly increased in hyperuricemic intestines, whereas Nlrp1 and Nlrp6 showed no significant changes (Figure 3C).
Figure 3.
Hyperuricemia induces pyroptosis in ISCs
(A) Analysis of gene expression related to pyroptosis, ferroptosis, necroptosis, apoptosis, and cuproptosis in intestinal tissues in HUA mice (n = 3 mice per group).
(B) The GSEA of the hallmark gene sets in MSigDB database revealing the enrichment of response to Nod-like receptor signaling pathway in ISCs. NES, normalized enrichment score (n = 3 mice per group).
(C) Heatmap expression analysis of Nod-like receptor family members (Nlrp1, Nlrp6, Nlrp3) (n = 6 mice per group; unpaired t test).
(D) Analysis of lactate dehydrogenase (LDH) content in WT and HUA mice (n = 6 mice per group; unpaired t test).
(E) Relative mRNA expression of pyroptosis-related molecules (ASC, CASPASE-1, Gsdmd, IL-1β) (n = 6 mice per group; unpaired t test).
(F–H) Representative immunofluorescence staining and statistical analysis of Cle-caspase-1 and GSDMD in WT and HUA mice (scale bars, 20 μm; n = 6 mice per group; unpaired t test).
(I) Transmission electron microscopy of ISCs (scale bars, 1 μm for original pictures and 500 nm for enlarged pictures).
All data are mean ± SEM; In all bar charts, each dot represents one data point; ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001, ns: no significant.
To further validate pyroptotic activation, we assessed biochemical and molecular markers. LDH release, a hallmark of pyroptotic membrane rupture, was elevated in the serum of HUA mice (Figure 3D). In parallel, the mRNA levels of Asc, Caspase-1, Gsdmd, and IL-1β were significantly upregulated (Figure 3E). Importantly, immunofluorescence co-staining of the ISC marker OLFM4 with cleaved-Caspase-1 or Cleaved-GSDMD (Figures 3F–3H) confirmed that ISC loss was accompanied by increased pyroptosis.
Pyroptosis is accompanied by pronounced mitochondrial remodeling (Li et al., 2020). TEM examination of FACS-purified ISCs showed that WT cells harbored elongated mitochondria with intact outer membranes and well-defined cristae. By contrast, HUA-treated cells exhibited rounded or vacuolated mitochondria with marked swelling, extensive cristae disruption, and focal breaches in the outer membrane (Figure 3I). Together, these findings demonstrate that HUA preferentially triggers ISC pyroptosis, providing a mechanistic explanation for stem cell depletion and subsequent disruption of intestinal homeostasis.
HUA promotes pyroptosis in intestinal organoid stem cells
To further determine whether HUA induces pyroptosis in ISCs, intestinal crypts were isolated from WT and HUA mice and subjected to organoid culture (Figure 4A). Organoids derived from HUA mice exhibited significantly reduced growth areas compared to those from WT mice at multiple time points (Figures 4B and 4C). EdU staining on day 9 demonstrated impaired ISC proliferation in the HUA group (Figures 4D and 4E). Consistently, the mRNA expression of Olfm4 was decreased (Figure 4F), and immunofluorescence staining confirmed reduced OLFM4 expression (Figures 4G and 4H). LDH is released following loss of plasma membrane integrity, and elevated extracellular LDH is widely used as a surrogate marker of pyroptosis. LDH levels were markedly elevated in HUA organoids (Figure 4I).
Figure 4.
HUA promotes pyroptosis in intestinal organoid stem cells
(A) Schematic diagram of constructing intestinal organoids directly from intestinal tissues of HUA mice. Created with BioRender.com.
(B and C) Representative images of intestinal organoids cultured under control and HUA conditions for 3, 5, and 7 days, and the analysis curve of organoid area (scale bars, 200 μm; n = 3 independent experiments).
(D and E) Immunofluorescence images of EdU staining in control and HUA mice (scale bars, 100 μm; n = 3 independent experiments; unpaired t test).
(F) qPCR analysis of relative Olfm4 mRNA expression in control and HUA groups (n = 3 independent experiments; unpaired t test).
(G and H) Representative immunofluorescence staining and statistical analysis of OLFM4 in control and HUA groups (scale bars, 50 μm; n = 3 independent experiments; unpaired t test).
(I) Analysis of LDH content in control and HUA groups (n = 3 independent experiments; unpaired t test).
(J) Representative immunofluorescence images of YO-PRO-1 and PI in the control and HUA groups. YO-PRO-1, green, labels early cell injury; PI, red, labels cell death (scale bars, 50 μm).
(K and L) Analysis of the contents of proinflammatory cytokines IL-1β and IL-6 in control and HUA groups (n = 3 independent experiments; unpaired t test).
All data are mean ± SEM; In all bar charts, each dot represents one data point; ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001, ns: no significant.
In addition, YO-PRO-1/PI staining revealed increased YO-PRO-1+ cells in the HUA group, indicating enhanced membrane pore formation by Cleaved-GSDMD—a hallmark of pyroptosis, while the rise in PI+ cells reflected progression to late pyroptotic stages characterized by complete membrane disruption (Figure 4J). In addition, inflammatory cytokine analysis showed significantly increased levels of IL-1β, IL-6, IL-22, and TNF-α in HUA organoids (Figures 4K–4L, S1A, and S1B). At the molecular level, qPCR revealed the upregulation of Nlrp3, Caspase-1, Asc, and Gsdmd transcripts (Figure S1C), and western blotting confirmed elevated protein expression of these canonical pyroptotic effectors (Figures S1D–S1H). We further examined barrier-associated proteins and found that both Occludin and ZO-1 were markedly reduced at the mRNA and protein levels in HUA organoids (Figures S1I–S1L). Together, these findings demonstrate that UA impairs ISC function and reduces their numbers by activating the NLRP3/Caspase-1/GSDMD pyroptotic pathway, accompanied by heightened inflammatory cytokine production and compromised epithelial barrier integrity.
High UA induces pyroptosis in ISCs in vitro
To investigate whether high UA induces pyroptosis in ISCs, crypts from wild-type mice were cultured as organoids and treated with 0.6 mM UA on day 3 (Figure 5A), a concentration that reduced cell viability to ∼50% after 48 h (Figure 5B). To ascertain whether these effects were specific to UA rather than reflecting nonspecific cytotoxicity, we enzymatically degraded UA using urate oxidase (UOX) (Li et al., 2024). Notably, removal of UA markedly restored viability, indicating that UA clearance mitigates the cytotoxic effects of high UA exposure (Figure 5C). UA-treated organoids showed significantly reduced growth area (Figures 5D and S2A), impaired ISC proliferation (EdU staining, Figures 5E and 5F), and decreased the expression of Olfm4 at both mRNA (Figure 5G) and protein levels (Figures 5G–5I). LDH release was markedly elevated (Figure 5J), and YO-PRO-1/PI staining revealed increased membrane-compromised cells (Figure 5K). UA treatment also increased inflammatory cytokines (IL-1β, IL-6, IL-22, TNF-α), (Figures S2B–S2E) and upregulated key pyroptosis mediators, including NLRP3, Caspase-1, ASC, and GSDMD, at both transcript (Figure S2F) and protein levels (Figures S2G–S2K). Barrier proteins Occludin and ZO-1 were reduced (Figures S2L–S2O). Together, these results indicate that UA impairs ISC function and reduces ISC numbers by activating the NLRP3/Caspase-1/GSDMD pyroptosis pathway, accompanied by inflammation and disrupted epithelial barrier integrity.
Figure 5.
High uric acid induces pyroptosis in ISCs in vitro
(A) Schematic diagram of constructing intestinal organoids in a high UA environment from normal intestinal tissues obtained from C57BL/6 mice. Created with BioRender.com.
(B) Detection of cell viability under different UA concentrations (n = 3 independent experiments; one-way ANOVA).
(C) Detection of cell viability in intestinal organoids treated with UA, with or without uricase (UOX) rescue (n = 3 independent experiments; one-way ANOVA).
(D) Representative images of intestinal organoids cultured under control and UA conditions for 3, 5, and 7 days (scale bars, 200 μm, n = 3 independent experiments; unpaired t test).
(E and F) Immunofluorescence images of EdU staining in control and UA organoids (scale bars, 100 μm; n = 3 independent experiments; unpaired t test).
(G) Gene expression heatmap of Olfm4 in control and UA groups (n = 3 independent experiments; unpaired t test).
(H–I) Representative immunofluorescence staining and statistical analysis of OLFM4 in control and UA groups (scale bars, 50 μm; n = 3 independent experiments; unpaired t test).
(J) Analysis of LDH content in control and UA groups (n = 3 independent experiments; unpaired t test).
(K) Representative immunofluorescence images of YO-PRO-1 and PI in control and UA groups (scale bars, 50 μm).
All data are mean ± SEM; In all bar charts, each dot represents one data point; ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001, ns: no significant.
UA induces ISC pyroptosis via CCDC90B
To investigate the mechanism by which UA induces pyroptosis in ISCs, we first performed a DARTS assay (Figure 6A). DARTs analysis revealed that CCDC90B exhibited the highest fold change among the candidate targets. (Figure 6B), suggesting it as a key mediator of UA’s effect on ISCs. Molecular docking showed that UA forms hydrogen bonds with residues LYS-105, ARG-57, VAL-103, and THR-52 of CCDC90B (Figure 6C), which stabilize the protein-ligand interaction. The predicted binding affinity between UA and CCDC90B was −4.954 kcal/mol, indicating favorable binding.
Figure 6.
Uric acid induces intestinal stem cell pyroptosis via CCDC90B
(A) Schematic diagram of the screening process for DARTS technology. Created with BioRender.com.
(B) Volcano plots of log2 fold change (FC) and log10 adjusted p value of differentially proteins between UA-treated intestinal organoids and control intestinal organoids. Red dots, proteins upregulated in UA-treated intestinal organoids; blue dots, proteins upregulated in control intestinal organoids (n = 3 independent experiments; unpaired t test).
(C) The stereo view of MD-optimized complex structure of detailed interactions between CCDC90B and UA.
(D) CETSA experiment was used to evaluate the binding between UA and CCDC90B at the thermodynamic level. The expression level of CCDC90B protein was detected by western blot (n = 3 independent experiments; unpaired t test).
(E) Colocalization analysis of CCDC90B and MCU (n = 3 independent experiments; unpaired t test).
(F) Colocalization analysis in (E) was performed using Pearson’s correlation coefficients (n = 3 independent experiments; unpaired t test).
(G) Rho-AM (red) staining shows altered mitochondrial Ca2+ levels in control and UA-treated organoids (n = 3 independent experiments; unpaired t test).
(H) Flow cytometry analysis of mitochondrial ROS levels in ISCs stained with MitoSOX in control and UA groups (n = 3 independent experiments; unpaired t test).
(I) Flow cytometry analysis of mitochondrial membrane potential (MMP) probed with JC-1 in control and UA groups (n = 3 independent experiments; unpaired t test).
(J) Western blot analysis of mitochondrial respiratory chain complex protein expression (n = 3 independent experiments; unpaired t test).
(K) Flow cytometry analysis of mitochondrial ROS levels in ISCs stained with MitoSOX in control, UA, control+shCCDC90B, and UA + shCCDC90B groups (n = 3 independent experiments; one-way ANOVA).
(L) Rho-AM (red) staining shows altered mitochondrial Ca2+ levels in control, UA, control+shCCDC90B, and UA + shCCDC90B groups (n = 3 independent experiments; one-way ANOVA).
(M) Flow cytometry analysis of mitochondrial membrane potential (MMP) probed with JC-1 in control, UA, control+shCCDC90B, and UA + shCCDC90B groups (n = 3 independent experiments; one-way ANOVA).
(N) Flow cytometry analysis of mitochondrial ROS levels in ISCs stained with MitoSOX in control, UA, and UA + MitoT groups (n = 3 independent experiments; one-way ANOVA).
(O and P) Rho-AM (red) staining shows altered mitochondrial Ca2+ levels in control, UA, and UA + MitoT group, along with statistical analysis (n = 3 independent experiments; one-way ANOVA).
(Q) Western blot analysis and statistics of NLRP3, cleaved-caspase-1 and cleaved-GSDMD in control, UA, and UA + MitoT groups (n = 3 independent experiments; one-way ANOVA).
All data are mean ± SEM. In all bar charts, each dot represents one data point; ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001, ns: no significant.
Molecular dynamics simulations further demonstrated that the ligand maintained excellent conformational stability throughout the 0–100 ns simulation, with an RMSD fluctuating between 0.01 and 0.02 nm and occasional short peaks near 0.03 nm, averaging ∼0.015 nm (Figure S3A). The overall RMSD of the protein-ligand complex rose rapidly from ∼0 nm at the start to ∼1.4 nm at 25 ns, then increased slowly to 3.3 nm by 100 ns (Figure S3B), reflecting system equilibration. Hydrogen bond analysis revealed that 3–6 hydrogen bonds formed during the initial 0–10 ns “locking” phase, which later converged to 1–3 bonds and dynamically rearranged, maintaining both stability and adaptability of the interaction (Figure S3C). Residue-level RMSF analysis indicated flexible regions of the protein, with fluctuations ranging from 0.6 to 2.5 nm (Figure S3D). Binding energy decomposition identified ARG-47 as the key residue contributing most (−2.0 kcal/mol) to UA binding, likely via hydrogen bond formation (Figure S3E).
Consistent with these predictions, CETSA confirmed strong binding between CCDC90B and UA (Figures 6D and S3F). Given the mitochondrial localization of CCDC90B, we next assessed UA accumulation in mitochondria. LC-MS/MS analysis revealed significantly elevated UA levels in the UA-treated group (Figure S3G), indicating effective mitochondrial uptake.
Given the functional association of CCDC90B with mitochondrial Ca2+ handling, we examined its localization relative to the mitochondrial calcium uniporter (MCU), which is localized to the inner mitochondrial membrane and is required for Ca2+ uptake into the mitochondrial matrix (Marchi et al., 2019). Co-immunostaining revealed that UA treatment enhanced CCDC90B-MCU colocalization (Figures 6E and 6F). Consistently, Rhod-2 AM staining showed increased mitochondrial Ca2+ levels in UA-treated cells (Figures 6G and S3H). UA also elevated mitochondrial ROS (MitoSOX; Figures 6H and S3I), reduced mitochondrial membrane potential (Figures 6I and S3J), and decreased the expression of mitochondrial electron transport chain complexes (Figures 6J and S3K), accompanied by reduced ATP levels (Figure S3L).
To assess the requirement of CCDC90B in UA-induced mitochondrial stress, CCDC90B expression was silenced using shRNA (sh-C). Notably, CCDC90B depletion abolished the UA-induced increases in mitochondrial ROS (Figures 6K and S3M) and mitochondrial Ca2+ levels (Figures 6L and S3N), and effectively prevented the loss of mitochondrial membrane potential (Figures 6M and S3O). Consistently, pharmacological scavenging of mitochondrial ROS with Mito-TEMPO markedly reduced MitoSOX fluorescence (Figures 6N and S3P) and attenuated mitochondrial Ca2+ accumulation (Figures 6O and 6P). Importantly, the suppression of mtROS by Mito-TEMPO significantly decreased the protein levels of NLRP3, cleaved caspase-1, and cleaved GSDMD (Figures 6Q and S3Q–S3S), thereby establishing a direct causal link between mitochondrial stress and NLRP3 inflammasome activation in response to UA exposure.
AAV8-CCDC90B attenuates pyroptosis in ISCs
The previous section showed that CCDC90B knockdown alleviated uric acid UA–induced pyroptosis of intestinal stem cells. To further determine whether CCDC90B overexpression exacerbates uric acid–induced ISC injury, we established a CCDC90B overexpression model using an in vitro intestinal organoid system. Specifically, intestinal crypts isolated from hyperuricemic mice were cultured to generate intestinal organoids, which recapitulate the ISC microenvironment and serve as an in vitro model of chronic HUA-induced injury. To overexpress CCDC90B, we selected AAV serotype 8 (AAV8) owing to its high transduction efficiency in ISCs (Buckinx and Timmermans, 2016; Buckinx et al., 2016). AAV-CAG-mCherry vectors (8 × 1011 gc/well) were applied to organoid cultures on day 3, and histological analysis on day 9 revealed successful transduction in >70% of ISCs, as evidenced by mCherry co-localization with Olfm4 (Figures S4A and S4B). To optimize expression, organoids were treated with increasing doses of AAV8-CCDC90B (AAV8-C), and qPCR analysis at day 9 showed a dose-dependent elevation of CCDC90B mRNA (Figure S4C).
Mechanistically, we first assessed the effect of AAV8-C on mitochondrial ROS. Treatment with AAV8-C suppressed mitochondrial ROS production (Figures 7A and S4D), increased mitochondrial membrane potential as measured by JC-1 staining (Figures 7B and S4E), and elevated intracellular ATP levels (Figure 7C). A dose of 8 × 1011 gc not only achieved robust gene upregulation but also restored organoid morphology and size (Figures 7D and 7E).
Figure 7.
AAV8-CCDC90B attenuates pyroptosis in ISCs
(A) Flow cytometry analysis of mitochondrial ROS levels in ISCs stained with MitoSOX under different treatment conditions (blank, control, HUA, AAV8-C, and AAV8-NC) (n = 3 independent experiments for each group; one-way ANOVA).
(B) Flow cytometry analysis of MMP probed with JC-1 in ISCs (n = 3 independent experiments for each group; one-way ANOVA).
(C) Quantitative analysis of cellular ATP levels (n = 3 independent experiments for each group; one-way ANOVA).
(D and E) Representative images of intestinal organoids cultured under control, HUA, AAV8-C, and AAV8-NC conditions for 3, 5, and 7 days, and the analysis curve of organoid area (scale bars, 200 μm, n = 3 independent experiments for each group; one-way ANOVA).
(F) Representative immunofluorescence images of EdU under different treatment conditions (control, HUA, AAV8-C, and AAV8-NC) (scale bars, 50 μm, n = 3 independent experiments for each group; one-way ANOVA).
(G) Representative immunofluorescence staining and statistics of OLFM4 under different treatment conditions (control, HUA, AAV8-C, and AAV8-NC) (scale bars, 50 μm, n = 3 independent experiments for each group; one-way ANOVA).
(H) Analysis of LDH content under different conditions (control, HUA, AAV8-C, and AAV8-NC) (n = 3 independent experiments for each group; one-way ANOVA).
(I) Representative immunofluorescence images of YO-PRO-1 and PI under different conditions (control, HUA, AAV8-C, and AAV8-NC) (scale bars, 50 μm, n = 3 independent experiments for each group; one-way ANOVA).
(J and K) qPCR and western blot analysis of key molecules in the pyroptosis pathway under different conditions (control, HUA, AAV8-C, and AAV8-NC) (n = 3 independent experiments for each group; one-way ANOVA).
(L and M) qPCR and western blot analysis of intestinal epithelial tight junction proteins under different conditions (control, HUA, AAV8-C, and AAV8-NC) (n = 3 independent experiments for each group; one-way ANOVA).
All data are mean ± SEM; in all bar charts, each dot represents one data point; ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001, ns: no significant.
In addition, AAV8-C significantly enhanced ISC proliferation, as demonstrated by EdU incorporation (Figures 7F and S4F), and restored ISC numbers, confirmed by OLFM4 immunofluorescence and mRNA expression (Figures 7G, S4G, and S4H). Mechanistically, AAV8-C reduced LDH release (Figure 7H) and decreased the number of YO-PRO-1 and PI-positive cells (Figure 7I), indicating protection against cell death. It also lowered inflammatory cytokine levels, including IL-1β, IL-6, IL-22, and TNF-α (Figures S4I–S4L).
Furthermore, both mRNA and protein levels of canonical pyroptosis markers were suppressed, while the expression of barrier-related proteins was restored (Figures 7J, 7K, and S4M). Consistently, mRNA and protein levels associated with intestinal barrier function were markedly increased (Figures 7L, 7M, and S4N). Together, these findings demonstrate that CCDC90B overexpression alleviates UA-induced ISC pyroptosis by mitigating mitochondrial dysfunction, suppressing inflammatory signaling, and preserving epithelial barrier integrity.
Discussion
HUA is a prevalent metabolic disorder worldwide and poses a substantial threat to human health (Borghi et al., 2022; Joosten et al., 2020; Nishizawa et al., 2022). As a key organ of the human digestive system, the intestine is closely associated with nutrient absorption and the maintenance of systemic homeostasis (Garrett et al., 2010; Shamburek and Farrar, 1990; Spiller, 1994). However, the connection between HUA and intestinal homeostasis remains relatively limited in current research. Here, we show that elevated UA disrupts ISC homeostasis by directly binding the mitochondrial scaffold protein CCDC90B. This interaction impairs mitochondrial function, leading to excessive ROS accumulation, which activates the NLRP3 inflammasome and triggers ISC pyroptosis. Targeting CCDC90B mitigates mitochondrial dysfunction, reduces ROS levels, suppresses NLRP3-mediated pyroptosis, and restores ISC homeostasis and intestinal barrier integrity. Collectively, our findings reveal a previously unrecognized HUA/CCDC90B/NLRP3 axis that links HUA to ISC dysfunction, highlighting a potential therapeutic strategy to preserve intestinal barrier function.
The sustained stability of intestinal function depends critically on the homeostatic regulation of ISCs. Residing at the crypt base, ISCs are multipotent adult stem cells that sustain epithelial renewal through continuous self-renewal and differentiation into absorptive enterocytes and secretory lineages (Barker, 2014; Medema and Vermeulen, 2011; Sato and Clevers, 2013). Consistent with this framework, our single-cell analysis of intestinal tissue revealed a reduction in the ISC compartment under HUA conditions. Moreover, immunofluorescence staining demonstrated a marked decrease in the expression of the Olfm4, further supporting the impairment of the intestinal stem cell pool during HUA-induced intestinal injury.
The intestinal epithelium is known to exhibit considerable plasticity in response to stress, and a moderate loss of active Olfm4+ ISCs can sometimes be offset by TA expansion or progenitor dedifferentiation to preserve epithelial homeostasis (Beumer and Clevers, 2021; Tetteh et al., 2016; Tian et al., 2011). However, such a compensatory pattern was not observed here. Instead, the concurrent decline in both ISCs and TA cells points to a more profound disruption of the ISC-TA regenerative unit, indicating stem cell pool exhaustion and impaired epithelial renewal under HUA conditions.
Intestinal organoids served as a complementary experimental platform to functionally validate these findings. By recapitulating key epithelial features in vitro, organoids enabled controlled interrogation of how elevated UA compromises ISC survival and barrier stability, thereby linking the scRNA-seq observations to cellular mechanisms of mitochondrial dysfunction and pyroptosis.
Pyroptosis is a form of programmed cell death initiated by inflammasomes, distinct from the “silent” process of apoptosis (Broz, 2025; Minton, 2020). It is characterized by membrane rupture, release of proinflammatory cytokines, and amplification of local inflammation. Gasdermin family proteins execute this process: cytosolic pattern recognition receptors such as NLRP3 assemble inflammasomes and activate Caspase-1, which cleaves GSDMD to release its N-terminal domain (GSDMD-NT). GSDMD-NT oligomerizes in the plasma membrane, forming β-barrel pores (∼10–20 nm) that allow water influx, cell swelling, membrane rupture, and IL-1β/IL-18 maturation and secretion (Broz et al., 2020; Elias et al., 2023; Lawlor et al., 2024; Liu et al., 2021). Morphological hallmarks include membrane blebbing, random chromatin fragmentation, and cytoplasmic content release. Additionally, mitochondrial dysfunction has been recognized as a crucial link between NLRP3 inflammasome activation and pyroptosis. On one hand, mitochondria are the primary source of ROS within cells (Detmer and Chan, 2007). Mitochondrial dysfunction leads to abnormal accumulation of ROS, which not only damages cells as oxidative stress mediators but also serves as an upstream signal for the NLRP3 inflammasome, promoting its assembly and activation (Zhu et al., 2024). On the other hand, pathological changes such as mitochondrial calcium overload and loss of membrane potential can enhance NLRP3 inflammasome activity, facilitating Caspase-1-mediated GSDMD cleavage, thereby driving pyroptosis (Evavold et al., 2021; Wang et al., 2025). Furthermore, dysregulation of mitophagy can lead to the accumulation of damaged mitochondria, further amplifying ROS-induced inflammation and inflammasome activation, which increases the incidence of inflammatory cell death (Zhao et al., 2025). ISCs are particularly vulnerable to inflammatory stress owing to their low antioxidant capacity (Ramos-León et al., 2024), high mitochondrial activity (Rodríguez-Colman et al., 2017), and constant exposure to microbial and metabolic signals (Arnauts et al., 2022). Consistently, we show that HUA enhances Caspase-1/GSDMD signaling in ISCs, leading to cell loss and suggesting a direct threat to ISC homeostasis under metabolic stress.
Coiled-coil domain-containing protein 90 B (CCDC90B) is a conserved mitochondrial inner-membrane scaffold protein containing an N-terminal mitochondrial targeting sequence and a central coiled-coil domain (Adlakha et al., 2019). It localizes to the inner membrane, facilitating the assembly of respiratory supercomplexes I, III, and IV, optimizing electron transfer and limiting ROS generation. Its coiled-coil domain may interact with mitochondrial transporters, assisting the translocation of nuclear-encoded mitochondrial proteins (Hwang et al., 2020). Dysregulation of CCDC90B, through mutation or post-translational modification, can disrupt supercomplex assembly, trigger ROS bursts, and induce mtDNA release via Bax/VDAC channels, activating innate immune responses. In our study, DARTS identified CCDC90B as a direct UA target in ISCs, linking high UA to excessive mitochondrial ROS production and activation of NLRP3/GSDMD pyroptotic signaling. Organoid experiments further demonstrated that targeting CCDC90B suppressed ISC pyroptosis, indicating its key regulatory role in UA-mediated ISC injury. To validate this mechanism, we used AAV8 vectors to overexpress CCDC90B in intestinal organoids. Intestinal organoids were treated with different doses of AAV8-C vectors, and the transcript levels of CCDC90B were assessed 6 days post-treatment to confirm overexpression efficiency. The experimental results showed that the overexpression of CCDC90B suppressed pyroptosis in ISCs and significantly alleviated mitochondrial dysfunction and stem cell damage induced by HUA. Notably, shRNA-mediated CCDC90B knockdown also exerted partial protective effects in intestinal organoids, suggesting that the role of CCDC90B in UA-mediated ISC injury may not simply depend on its expression level. Consistently, CCDC90B manipulation in vitro also altered mitochondrial membrane potential and mitochondrial ROS levels, as indicated by JC-1 and MitoSOX staining. Since mitochondrial ROS is a key upstream trigger of NLRP3 inflammasome activation, these findings further support a role for CCDC90B in regulating mitochondrial stress during UA-induced ISC injury.
Previous studies have established that various metabolic disorders impair ISC homeostasis and compromise intestinal barrier function (Ludikhuize et al., 2020; Medema and Vermeulen, 2011; Rodríguez-Colman et al., 2017). For example, a high-fat diet activates PPAR-δ in ISCs, promoting aberrant proliferation and differentiation (Beyaz et al., 2016), whereas glucotoxicity impairs L-cell differentiation, potentially linked to reduced ISC proliferative capacity (Filippello et al., 2021). Here, we provide the first evidence that HUA is closely linked to ISC homeostasis and, via DARTS, reveal CCDC90B as a direct molecular target. Using intestinal organoids, we dissected the UA/CCDC90B/NLRP3 axis, showing that CCDC90B overexpression significantly suppresses HUA-induced ISC pyroptosis and restores barrier function. However, the protective effects of CCDC90B manipulation are mainly supported by in vitro organoid data, and their relevance in vivo remains to be further established. Moreover, whether HUA affects other intestinal epithelial secretory cells (e.g., Paneth or goblet cells) via the CCDC90B-pyroptosis axis remains to be investigated. Collectively, our study connects hyperuricemic metabolic stress to ISC pyroptosis, expands the functional understanding of CCDC90B in ISCs, and provides a potential molecular target for interventions aimed at preserving intestinal barrier integrity under HUA conditions.
Resource availability
Lead contact
Further information and requests for resources should be directed to and will be fulfilled by the lead contact, Peng Huang (huangp93@mail2.sysu.edu.cn).
Materials availability
The materials used in this study were commercially available. No new reagents were generated in this study.
Data and code availability
-
•
The RNA-seq data generated in this study have been deposited in the Genome Sequence Archive (GSA) under accession number CRA043081 and are publicly available.
-
•
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.
Acknowledgments
We gratefully acknowledge the support of the Medical Science Public Platform of Shenzhen Campus, SUN YAT-SEN UNIVERSITY for providing technical assistance and instrumentation. We are grateful to Guangzhou Angte Biotechnology Co., Ltd., (Guanzhou, China) for assisting in sequencing. The funding for this project was provided by the National Natural Science Foundation of China (82170604), the Guangdong Basic and Applied Basic Research Foundation (2023B1515020016), the Shenzhen Science and Technology Program (JCYJ20240813150422030), and the Research Start-up Fund of the Seventh Affiliated Hospital, Sun Yat-sen University (ZSQYRSSFAR0003).
Author contributions
Writing – original draft, X.P. and M. L., writing – review and editing, K.Z., conceptualization, W.L. and S.H., methodology, Z.C. and Y.G.; supervision and supervision, T.L., F.Z. and P.H.
Declaration of interests
The authors declare that they have no competing interests.
STAR★Methods
Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER | |
|---|---|---|---|
| Antibodies | |||
| Occludin antibody | Cell Signaling Technology | Cat# 91131S; RRID: AB_2934013 | |
| ZO-1 antibody | Santa Cruz | Cat# sc-33725; RRID: AB_628459 | |
| Olfm4 antibody | Cell Signaling Technology | Cat# 39141S; RRID: AB_2650511 | |
| Cleaved Caspase-1 antibody | Cell Signaling Technology | Cat# 89332S; RRID: AB_2923067 | |
| GSDMD antibody | Cell Signaling Technology | Cat# 39754S; RRID: AB_2916333 | |
| NLRP3 antibody | Cell Signaling Technology | Cat# 15101S; RRID: AB_2722591 | |
| ASC antibody | Santa Cruz | Cat# sc-514414; RRID: AB_2737351 | |
| GAPDH antibody | Cell Signaling Technology | Cat# 2118S; RRID: AB_561053 | |
| CCDC90B antibody | Proteintech | Cat# 27126-1-AP; RRID: AB_3669584 | |
| Goat Anti-Rabbit IgG H&L (HRP) | Abcam | Cat#ab205718; RRID: AB_2819160 | |
| Goat Anti-Mouse IgG H&L (HRP) | Abcam | Cat#ab205719; RRID: AB_2755049 | |
| Goat Anti-Mouse IgG conjugated to Alexa Fluor™ 488 | Invitrogen | Cat#A-11001; RRID: AB_2534069 | |
| Goat Anti-Mouse IgG conjugated to Alexa Fluor™ 555 | Invitrogen | Cat#A-21422; RRID: AB_2535844 | |
| Goat Anti-Mouse IgG conjugated to Alexa Fluor™ 647 | Invitrogen | Cat# A-21235; RRID: AB_2535804 | |
| Goat Anti-Rabbit IgG conjugated to Alexa Fluor™ 488 | Invitrogen | Cat#A-11008; RRID: AB_143165 | |
| Goat Anti-Rabbit IgG conjugated to Alexa Fluor™ 555 | Invitrogen | Cat# A-21428; RRID: AB_141784 | |
| Goat Anti-Rabbit IgG conjugated to Alexa Fluor™ 647 | Invitrogen | Cat# A-21245; RRID: AB_2535813 | |
| FITC anti-mouse CD45 Antibody | Biolegend | Cat# 103108; RRID: AB_312973 | |
| PE Anti-Mouse CD326/EpCAM Antibody | FineTest | Cat# PE-30285 | |
| Bacterial and virus strains | |||
| CCDC90B over expression | N/A | ||
| AAV-CCDC90B | Vigene Bioscience | N/A | |
| AAV-mCherry | Vigene Bioscience | N/A | |
| CCDC90B shRNA | HyCyte Biosciences | N/A | |
| Chemicals, peptides, and recombinant proteins | |||
| Triton X-100 | Sigma-Aldrich | Cat# ×100 | |
| DAPI | Invitrogen | Cat# P36966 | |
| Uric acid | Sigma-Aldrich | Cat# U2625 | |
| Urate oxidase | Sigma-Aldrich | Cat# U0880 | |
| Dilute solution of hydrochloric acid (HCl) | WEST GENE | Cat#WG-XYS-010 | |
| NaOH | MREDA | Cat#M155956 | |
| Sodium carboxymethyl cellulose | Sigma-Aldrich | Cat#419303 | |
| Adenine | Macklin | Cat# A6279 | |
| Potassium oxonate | Macklin | Cat# P831461 | |
| IntestiCult™ OGM Mouse Basel Medium | STEMCELL | Cat#06000 | |
| Gentle Cell Dissociation Reagent | STEMCELL | Cat#100-0485 | |
| Cell Recovery Solution | CORNING | Cat#354253 | |
| Matrigel Matrix | CORNING | Cat#356231 | |
| Sucrose | Macklin | Cat#S818046 | |
| D-Sorbitol | Biosharp | Cat#BS115 | |
| EDTA-Na2 | Solarbio | Cat#E8030 | |
| BSA Albumin Fraction V | Biofroxx | Cat#4240GR100 | |
| 1× Phosphate Buffered Saline | Biosharp | Cat#BL302A | |
| DMEM/F-12 | Gibco | Cat#C11330500BT | |
| Critical commercial assays | |||
| Edu Cell Proliferation Kit | Beyotime | Cat#C0071L | |
| Cell Counting Kit (CCK-8) | YEASEN | Cat#40203ES80 | |
| Uric acid (UA) content determination kit | Solarbio | Cat# BC1360 | |
| Mouse IL-1β(Interleukin 1 Beta) ELISA Kit | Elabscience | Cat# E-EL-M0037 | |
| Mouse IL-6(Interleukin 6) ELISA Kit | Elabscience | Cat# E-EL-M0044 | |
| Mouse TNF-α(Tumor Necrosis Factor Alpha) ELISA Kit | Elabscience | Cat# E-EL-M3063 | |
| Mouse IL-22(Interleukin-22) ELISA Kit | Elabscience | Cat# E-EL-M2446 | |
| Cell Mitochondria Isolation Kit | Beyotime | Cat# C3601 | |
| Deposited data | |||
| Single-cell sequencing of the testis | This paper | GSA: CRA043081 | |
| Experimental models: Organisms/strains | |||
| Mouse: C57BL/6 | Zhuhai BesTest Bio-Tech Co. Ltd | N/A | |
| Mouse intestinal organoids | This paper | N/A | |
| Oligonucleotides | |||
| F: ATGGGACGATGCTGGTACTGA R: TGCTGACAACCTTGAGTGAAAT |
BGI Genomics | Mouse Gapdh qPCR primers | |
| F: CAGAAGACAGGACTGGAAATTAGA R: AACTGAGAGGAGAGCCTGTTT |
BGI Genomics | Mouse IL22 qPCR primers | |
| F: TGCCACCTTTTGACAGTGATG R: TGATGTGCTGCTGCGAGATT |
BGI Genomics | Mouse IL1β qPCR primers | |
| F: GCCCCTCTTTCCTTAGGCG R: TCCCAAGATAAGCGAACCTGC |
BGI Genomics | Mouse Occludin qPCR primers | |
| F: GGGGACAACATCGTGACCG R: AGGAGTCGAAGACTTTGCACT |
BGI Genomics | Mouse Claudin-1 qPCR primers | |
| F: GCCGCTAAGAGCACAGCAA R: TCCCCACTCTGAAAATGAGGA |
BGI Genomics | Mouse ZO-1 qPCR primers | |
| F: CCTGGTGATGCAGACAGACA R: GGGTCCACCTGTACAGAACC |
BGI Genomics | Mouse NLRP1 qPCR primers | |
| F: CAAGGCTGCTATCTGGAGGAA R: TGCAACGGACACTCGTCATC |
BGI Genomics | Mouse NLRP3 qPCR primers | |
| F: TTCTCTCCGTGTCAGCGTTC R: CAGAGCGAGCATTCCTCTCC |
BGI Genomics | Mouse NLRP6 qPCR primers | |
| F: CTATGGACAAGGCACGGGAC R: TCAGCTGATGGAGCTGATTGA |
BGI Genomics | Mouse Cle-caspase 1 qPCR primers | |
| F: GCTTCCCCTTGCTGACCTG R: GTGGTCAAGAACCCTCTCCG |
BGI Genomics | Mouse CCDC90B qPCR primers | |
| F: ACTGTGCTTAGAGACATGGGC R: TGGTCCACAAAGTGTCCTGTT |
BGI Genomics | Mouse ASC qPCR primers | |
| F: ATGGGACGATGCTGGTACTGA R: TGCTGACAACCTTGAGTGAAAT |
BGI Genomics | Mouse Gapdh qPCR primers | |
| Software and algorithms | |||
| R 4.3.3 | R Core Team | https://www.r-project.org/ | |
| Prism 9.0 | GraphPad | https://www.graphpad.com/ | |
| Fiji | N/A | https://imagej.net/Fiji | |
| FlowJo | Version v10 | https://www.flowjo.com/solutions/flowjo/downloads | |
Experimental model and study participant details
Animals
All animal procedures were performed in accordance with institutional ethical guidelines and approved by the Laboratory Animal Management and Use Committee of Shenzhen Top Biotechnology Co., Ltd (Approval No. TOPGM-IACUC-2024-0362). Male C57BL/6J mice (8 weeks old) were obtained from Zhuhai BesTest Bio-Tech Co., Ltd (Zhuhai, China) and maintained under specific pathogen-free (SPF) conditions. Mice were randomly assigned to experimental groups and subjected to a HUA (HUA) protocol consisting of a 0.125% purine-enriched diet in combination with adenine (200 mg/kg) and potassium oxonate (300 mg/kg) administered by oral gavage every other day for 4 weeks. All animals were housed at a constant temperature (24 ± 1°C) with controlled humidity (50–60%) under a 12-h light/dark cycle, with free access to food and water.
Intestinal organoid experiment
Jejunal crypts were isolated from 6-8 weeks old mice as previously described with minor modifications(Ramesh et al., 2019). Briefly, tissue fragments were washed in cold PBS containing antibiotics, incubated with 5 mmol/L EDTA at 4°C for 30 min, and vigorously shaken in crypt isolation buffer to release crypts. After filtration through 100 μm strainers and centrifugation at 300 × g, crypt pellets were washed with 0.1% BSA/PBS, resuspended in DMEM/F12, and embedded in growth factor reduced Matrigel (Mogengel, 082703-MI) at a density of 500 crypts/50 μL. Matrigel domes were seeded into pre-warmed 24-well plates, overlaid with intestinal organoid culture medium supplemented with antibiotics, and maintained with medium replacement three times per week.
By day 3, organoids exhibited luminal structures and budding, at which point UA (UA, 2–12 mM) was added for 48 h. Cell viability was then evaluated using the Cell Counting Kit-8 (CCK-8, Yeasen, 40203ES60). Organoids were incubated in culture medium containing 10% (v/v) CCK-8 reagent at 37°C with 5% CO2 for 2 h, and absorbance at 450 nm was measured. Relative viability was expressed as the percentage of treated organoids compared with untreated controls. Additional organoids were collected on day 6 for downstream analyses.
For passaging, organoids were dissociated after 7-10 days of culture using a gentle dissociation reagent, centrifuged, and re-embedded in Matrigel at a split ratio of 1:2-1:5. All procedures were performed under sterile conditions, with Matrigel manipulations conducted on ice to prevent premature polymerization.
Method details
Tissue dissociation and single-cell preparation
Mouse intestinal tissues were collected and placed in ice-cold calcium- and magnesium-free 1× PBS. Tissues were minced (∼0.5 mm2), washed, and cleared of blood and adipose residues. Samples were digested in dissociation buffer at 37°C with shaking (100 rpm) for 20 min, and digestion was terminated with 1× PBS containing 10% FBS, followed by gentle pipetting. The cell suspension was filtered through 70 μm and 30 μm strainers and centrifuged at 300 × g for 5 min at 4°C. After resuspension in PBS (0.04% BSA), red blood cells were lysed using RBC lysis buffer (MACS, 130-094-183). Dead cells were removed using the Dead Cell Removal Kit (MACS, 130-090-101). Cells were washed, resuspended in PBS (0.04% BSA), and adjusted to 700–1200 cells/μl. Cell viability (>85%) was confirmed by trypan blue staining.
Single-cell RNA sequencing
Single-cell RNA-seq libraries were prepared using the DNBelab C-Series High-throughput Single-Cell RNA Library Prep Kit V3.0 (MGI, 940-001818-00) following the manufacturer’s guidelines. Briefly, individual cells were encapsulated into droplets, followed by emulsion breaking, mRNA capture, reverse transcription, cDNA amplification, and purification. The amplified cDNA was fragmented to approximately 300–500 bp, and sequencing libraries were constructed with indexing adapters. Libraries were sequenced on the DNBSEQ-T7 platform (China National GeneBank) using 100 bp paired-end reads.
Quality control
Cells with <200 or >6,500 detected genes, or with >20% mitochondrial UMIs, were excluded from downstream analysis. Genes expressed in fewer than three cells were removed.
Gene Set Enrichment Analysis
Gene Set Enrichment Analysis (GSEA) was performed using clusterProfiler (v4.0) with the MSigDB hallmark and KEGG collections. Genes were ranked by log2 fold change, and enrichment significance was assessed using 1,000 permutations. Pathways with adjusted P < 0.05 were considered significantly enriched.
Preparation of UA solution
UA stock solutions were prepared by first dissolving UA powder (168.11 mg) in 8 mL of 0.5 mol/L NaOH to obtain a 125 mM solution. One milliliter of this stock was then titrated with 6.4 mL diluted HCl to adjust the pH to 7.2-7.4, yielding a 16.89 mM UA working stock. The solution was sterilized using a 0.22 μm filter and used within 1 week. Final UA concentrations for cell treatments were prepared by diluting the working stock with complete culture medium.
AAV8 for ISCs
AAV8 vectors carrying the full-length cDNA of mouse CCDC90B under the control of the CAG promoter was obtained from Vigene Bioscience; vectors encoding mCherry served as controls. For in vitro administration, Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12) containing AAV8-C particles was applied to intestinal organoid cultures at doses of 8 × 1010, 4 × 1011, 8 × 1011, or 2 × 1012 gc/organoid. Expression of CCDC90B at transcript levels was assessed 6 days after intervention to confirm overexpression efficiency.
Lentiviral shRNA transduction of intestinal organoids
Lentiviral particles carrying shRNAs targeting CCDC90B were obtained from HyCyte Biotechnology company (1×108 TU/ml, GFP-puro vector). Organoids were mechanically dissociated into small fragments and incubated with lentiviruses in ENR medium supplemented with Polybrene (8 μg/ml) for 6 h. After infection, the viral mixture was replaced with fresh complete organoid medium and organoids were re-embedded in Matrigel. GFP fluorescence was examined 48 h after infection to evaluate transduction efficiency. Puromycin selection (optimized kill dose) was applied for 3–5 days to establish stable CCDC90B-knockdown organoid lines. A scramble shRNA lentivirus was used as the negative control under identical conditions.
Flow cytometric staining and isolation of Olfm4+ intestinal stem cells
Single-cell suspensions were prepared from small-intestinal crypts by enzymatic dissociation and filtration. For surface staining, cells were incubated on ice with antibodies against CD45 and EpCAM for 20–30 min, followed by washing with PBS containing 1% BSA. Cells were then fixed with 4% paraformaldehyde for 10 min at room temperature, washed, and permeabilized with 0.1% Triton X-100. Intracellular staining was performed using a rabbit anti-Olfm4 primary antibody followed by an Alexa Fluor–conjugated secondary antibody.
After staining, cells were analyzed and sorted using the fixed-cell sorting mode. Doublets and debris were excluded by FSC/SSC and pulse-width gating, and hematopoietic cells were removed by gating out CD45+ events. EpCAM+Olfm4+ epithelial stem cells were collected and immediately transferred into 2.5% glutaraldehyde for transmission electron microscopy.
Lactate dehydrogenase (LDH) activity assay
Lactate dehydrogenase (LDH) activity was assessed using a commercial kit (C0016, Beyotime Biotechnology, China) following the manufacturer’s instructions. Briefly, tissues or organoids were collected, rinsed twice with ice-cold PBS, and lysed on ice in the supplied lysis buffer. Lysates were centrifuged at 12,000 × g for 5 min at 4°C, and the resulting supernatants were incubated with the LDH detection reagent at 37°C for 30 min. Absorbance was measured at 490 nm using a Synergy H1 microplate reader (BioTek).
Enzyme-linked immunosorbent assay (ELISA) analyses
The concentrations of IL-1β, IL-6, TNF-α and IL-22 in serum and tissue, were measured using ELISA kits (Elabscience Biotechnology Co., Ltd., Wuhan, China), following the manufacturers’ protocols. All assays were carried out in strict accordance with the respective instructions provided with each kit.
Measurements of UA content
The serum of WT and HUA male mice were centrifuged to separate the supernatant, which was then stored at -80°C for further analysis. The levels of UA in serum were determined using a kit provided by Beijing Solarbio Science & Technology Co., Ltd. (Beijing). The OD values were recorded at 505 nm on Synergy H1 microplate reader (BioTek).
Intestinal organoids from UA-treated and control groups were collected and washed three times with ice-cold PBS. Organoids were dissociated using Gentle Cell Dissociation Reagent for 10 min at room temperature. Uric acid levels were quantified using the Uric Acid Assay Kit (Beijing Solarbio Science & Technology Co., Ltd.) following the manufacturer’s protocol. Briefly, cell lysates were prepared, the supernatant was mixed with the kit reagents, and the reaction was incubated at 37°C for 20 min. Absorbance was measured at 505 nm using a Synergy H1 microplate reader (BioTek, USA).
16S rRNA sequencing of gut microbiota
Bacterial DNA was extracted from caecal contents using the DNeasy PowerSoil kit (Qiagen). The V3–V4 regions of the 16S rRNA gene were amplified with barcoded universal primers, purified (AMPure XP beads), quantified (Qubit), and sequenced on an Illumina NovaSeq 6000 platform (2 × 250 bp; OE Biotech, Shanghai). Raw reads were processed in QIIME2 (2020.11) with cutadapt and DADA2 to remove adapters, filter low-quality reads, denoise, merge, and remove chimeras, generating amplicon sequence variants (ASVs). Taxonomy was assigned against the SILVA v138 database, and microbial diversity was assessed by Shannon and Chao1 indices, unweighted UniFrac PCoA, and phylogenetic tree construction.
Drug affinity responsive target stability (DARTS) assay
The DARTS assay was performed as previously described with minor modifications(Lomenick et al., 2009). Briefly, crypts were isolated from the small intestine of wild-type mice and cultured as intestinal organoids. Organoids were harvested and dissociated into single-cell suspensions. Total proteins were extracted using M-PER reagent supplemented with protease and phosphatase inhibitors. After centrifugation at 13,000 × g for 15 min at 4°C, the supernatants were incubated with UA or DMSO for 30 min on ice to allow ligand–protein binding. Samples were then subjected to limited proteolysis, during which ligand-bound proteins exhibited reduced susceptibility to degradation. Proteins were separated by SDS-PAGE, and bands of interest were excised and digested with trypsin for LC–MS/MS analysis on a Thermo LTQ-Orbitrap system. Mass spectrometry data were processed using Rosetta Elucidator for differential protein and peptide quantification.
Molecular docking
The 3D structure of CCDC90B was obtained from the AlphaFold Protein Structure Database. To predict potential binding pockets, loop-trimmed models were analyzed using CavityPlus. Docking of UA (PubChem CID: 1175) was conducted with AutoDock Vina v1.2.0(Eberhardt et al., 2021). Structures were prepared by adding hydrogens and Gasteiger charges, and grid boxes were centered on predicted cavities. Other parameters were set to default.
Molecular dynamics (MD) simulations
The top-scoring UA-CCDC90B docking pose was subjected to MD simulations using AMBER 22. The system was minimized (2,500 steps steepest descent and 2,500 steps conjugate gradient), heated from 0 K to 298 K over 200 ps (NVT ensemble), equilibrated for 500 ps under NVT and then for 500 ps under NPT (1 atm, 298 K), and simulated for 100 ns under periodic boundary conditions. Nonbonded interactions were truncated at 10 Å, electrostatics were treated with PME, and SHAKE constraints were applied to bonds involving hydrogens. Temperature was controlled by a Langevin thermostat (γ = 2 ps-1). Trajectories were saved every 10 ps for downstream analysis.
Cellular thermal shift assay (CETSA)
Organoids were dissociated into single cells and treated with UA or vehicle (DMSO) for 18 h. Cells were then harvested and aliquoted into PCR tubes (100 μL per tube). Samples were subjected to a thermal gradient (37–67°C, in 5°C increments, 5 min at each temperature), snap-frozen in liquid nitrogen, and thawed twice on ice. Following centrifugation, supernatants were collected and analyzed by western blotting for CCDC90B.
Histology
Intestinal samples were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned at 4 μm. Sections were deparaffinized, rehydrated, and stained with hematoxylin and eosin (H&E) for morphology. Slides were imaged with a digital pathology scanner (KF-PRO-020-HI, KFBIO, China).
Immunofluorescence (IF)
Testicular sections or organoids cultured on polyacrylamide gels were fixed, permeabilized, and blocked before incubation with primary antibodies overnight at 4°C. Samples were then incubated with fluorescent secondary antibodies for 1 h at room temperature in the dark. Images were acquired with an LSM800 confocal microscope (Zeiss) or DMI8 (Leica). Antibody information is provided in the key resources table.
Mitochondrial UA measurement
Mitochondria were isolated from intestinal organoids using the Cell Mitochondria Isolation Kit (C3601, Beyotime). Samples were extracted with pre-cooled 70% methanol/water, centrifuged, and filtered prior to LC-MS/MS analysis. UA standards were prepared and diluted for MRM optimization and standard curve construction. LC-MS/MS analysis was performed on an ExionLC system coupled with a QTRAP 5500+ mass spectrometer, using a water/acetonitrile gradient containing 0.04% acetic acid. Quantification was based on peak areas and standard curves, with pooled QC samples included to monitor analytical stability and reproducibility.
Measurements of mitochondrial ROS
Mitochondrial ROS were assessed using MitoSOX™ Red (Invitrogen, M36008). Intestinal organoids were dissociated into single cells, incubated with the dye for 30 min according to the manufacturer’s instructions, washed, and analyzed by flow cytometry. Data were processed with FlowJo v10.6.2.
Measurement of mitochondrial membrane potential (MMP)
MMP was evaluated using a JC-1 assay kit (Beyotime, C2003S). Intestinal organoids were dissociated into single-cell suspensions, stained with JC-1 at 37°C for 20 min, washed, and resuspended in medium. Red fluorescence indicated polarized mitochondria, whereas green fluorescence reflected depolarization. Signals were quantified by flow cytometry, and ΔΨm was expressed as the red/green fluorescence ratio using FlowJo v10.6.2.
Western blotting
Tissue or organoids were harvested, washed with PBS, and lysed in RIPA buffer supplemented with protease inhibitors on ice for 30 min. Lysates were clarified by centrifugation at 12,000 g for 10 min at 4°C, and protein concentrations were measured with a BCA assay (Beyotime). Equal amounts of protein were mixed with loading buffer (Bio-Rad), separated by SDS–PAGE (Epizyme), and transferred to PVDF membranes (0.45 μm, Millipore). Membranes were blocked with 5% BSA, incubated overnight at 4°C with primary antibodies, and then with HRP-conjugated secondary antibodies for 1 h at room temperature. Bands were visualized with chemiluminescent substrate (Beyotime) and quantified using Fiji from at least three independent experiments. Antibody details are listed in the key resources table.
Quantification and statistical analysis
RNA isolation and quantitative RT–PCR
Total RNA was isolated from tissue or organoids using TRIzol reagent (Thermo Fisher Scientific) following the manufacturer’s protocol. RNA concentration and purity were determined with a NanoDrop 8000 spectrophotometer. One microgram of RNA was reverse-transcribed using the HiFiScript All-in-one RT Master Mix Kit (Cwbiotech). qPCR was performed using SuperStar Universal SYBR Master Mix (Cwbiotech) on a CFX96 system (Bio-Rad). Each reaction was run in triplicate, and mRNA levels were normalized to GAPDH. Primer sequences are provided in the key resources table.
Statistics and reproducibility
All experiments were conducted with a minimum of three biological replicates, and consistent reproducibility was confirmed. Data are expressed as mean ± standard error of the mean (SEM) from at least three independent experiments. Sample sizes are provided in the corresponding figure legends. Comparisons between two groups were analyzed using an unpaired t-test, while multiple-group comparisons were evaluated by one-way ANOVA. Statistical analyses were performed with GraphPad Software. A two-sided p-value < 0.05 was considered statistically significant, with significance levels indicated as p < 0.05 (∗), p < 0.01 (∗∗), p < 0.001 (∗∗∗).
Published: June 18, 2026
Footnotes
Supplemental information can be found online at https://doi.org/10.1016/j.stemcr.2026.102970.
Contributor Information
Taoli Liu, Email: liutli@mail.sysu.edu.cn.
Fengping Zheng, Email: zhengfp@mail.sysu.edu.cn.
Peng Huang, Email: huangp93@mail2.sysu.edu.cn.
Supplemental information
References
- Adam-Vizi V., Chinopoulos C. Bioenergetics and the formation of mitochondrial reactive oxygen species. Trends Pharmacol. Sci. 2006;27:639–645. doi: 10.1016/j.tips.2006.10.005. [DOI] [PubMed] [Google Scholar]
- Adlakha J., Karamichali I., Sangwallek J., Deiss S., Bär K., Coles M., Hartmann M.D., Lupas A.N., Hernandez Alvarez B. Characterization of MCU-Binding Proteins MCUR1 and CCDC90B - Representatives of a Protein Family Conserved in Prokaryotes and Eukaryotic Organelles. Structure. 2019;27:464–475.e6. doi: 10.1016/j.str.2018.11.004. [DOI] [PubMed] [Google Scholar]
- Albillos A., de Gottardi A., Rescigno M. The gut-liver axis in liver disease: Pathophysiological basis for therapy. J. Hepatol. 2020;72:558–577. doi: 10.1016/j.jhep.2019.10.003. [DOI] [PubMed] [Google Scholar]
- Arnauts K., Sudhakar P., Verstockt S., Lapierre C., Potche S., Caenepeel C., Verstockt B., Raes J., Vermeire S., Sabino J., et al. Microbiota, not host origin drives ex vivo intestinal epithelial responses. Gut Microbes. 2022;14 doi: 10.1080/19490976.2022.2089003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Barker N. Adult intestinal stem cells: critical drivers of epithelial homeostasis and regeneration. Nat. Rev. Mol. Cell Biol. 2014;15:19–33. doi: 10.1038/nrm3721. [DOI] [PubMed] [Google Scholar]
- Beumer J., Clevers H. Cell fate specification and differentiation in the adult mammalian intestine. Nat. Rev. Mol. Cell Biol. 2021;22:39–53. doi: 10.1038/s41580-020-0278-0. [DOI] [PubMed] [Google Scholar]
- Beyaz S., Mana M.D., Roper J., Kedrin D., Saadatpour A., Hong S.J., Bauer-Rowe K.E., Xifaras M.E., Akkad A., Arias E., et al. High-fat diet enhances stemness and tumorigenicity of intestinal progenitors. Nature. 2016;531:53–58. doi: 10.1038/nature17173. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Borghi C., Agnoletti D., Cicero A.F.G., Lurbe E., Virdis A. Uric Acid and Hypertension: a Review of Evidence and Future Perspectives for the Management of Cardiovascular Risk. Hypertension. 2022;79:1927–1936. doi: 10.1161/hypertensionaha.122.17956. [DOI] [PubMed] [Google Scholar]
- Broz P. Pyroptosis: molecular mechanisms and roles in disease. Cell Res. 2025;35:334–344. doi: 10.1038/s41422-025-01107-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Broz P., Pelegrín P., Shao F. The gasdermins, a protein family executing cell death and inflammation. Nat. Rev. Immunol. 2020;20:143–157. doi: 10.1038/s41577-019-0228-2. [DOI] [PubMed] [Google Scholar]
- Buckinx R., Timmermans J.P. Targeting the gastrointestinal tract with viral vectors: state of the art and possible applications in research and therapy. Histochem. Cell Biol. 2016;146:709–720. doi: 10.1007/s00418-016-1496-6. [DOI] [PubMed] [Google Scholar]
- Buckinx R., Van Remoortel S., Gijsbers R., Waddington S.N., Timmermans J.P. Proof-of-concept: neonatal intravenous injection of adeno-associated virus vectors results in successful transduction of myenteric and submucosal neurons in the mouse small and large intestine. Neuro Gastroenterol. Motil. 2016;28:299–305. doi: 10.1111/nmo.12724. [DOI] [PubMed] [Google Scholar]
- Dalbeth N., Choi H.K., Joosten L.A.B., Khanna P.P., Matsuo H., Perez-Ruiz F., Stamp L.K. Gout. Nat. Rev. Dis. Primers. 2019;5:69. doi: 10.1038/s41572-019-0115-y. [DOI] [PubMed] [Google Scholar]
- Detmer S.A., Chan D.C. Functions and dysfunctions of mitochondrial dynamics. Nat. Rev. Mol. Cell Biol. 2007;8:870–879. doi: 10.1038/nrm2275. [DOI] [PubMed] [Google Scholar]
- Du L., Zong Y., Li H., Wang Q., Xie L., Yang B., Pang Y., Zhang C., Zhong Z., Gao J. Hyperuricemia and its related diseases: mechanisms and advances in therapy. Signal Transduct. Target. Ther. 2024;9:212. doi: 10.1038/s41392-024-01916-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Eberhardt J., Santos-Martins D., Tillack A.F., Forli S. AutoDock Vina 1.2.0: New Docking Methods, Expanded Force Field, and Python Bindings. J. Chem. Inf. Model. 2021;61:3891–3898. doi: 10.1021/acs.jcim.1c00203. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Elias E.E., Lyons B., Muruve D.A. Gasdermins and pyroptosis in the kidney. Nat. Rev. Nephrol. 2023;19:337–350. doi: 10.1038/s41581-022-00662-0. [DOI] [PubMed] [Google Scholar]
- Evavold C.L., Hafner-Bratkovič I., Devant P., D'Andrea J.M., Ngwa E.M., Boršić E., Doench J.G., LaFleur M.W., Sharpe A.H., Thiagarajah J.R., Kagan J.C. Control of gasdermin D oligomerization and pyroptosis by the Ragulator-Rag-mTORC1 pathway. Cell. 2021;184:4495–4511.e19. doi: 10.1016/j.cell.2021.06.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Filippello A., Di Mauro S., Scamporrino A., Malaguarnera R., Torrisi S.A., Leggio G.M., Di Pino A., Scicali R., Purrello F., Piro S. High Glucose Exposure Impairs L-Cell Differentiation in Intestinal Organoids: Molecular Mechanisms and Clinical Implications. Int. J. Mol. Sci. 2021;22:6660. doi: 10.3390/ijms22136660. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Garrett W.S., Gordon J.I., Glimcher L.H. Homeostasis and inflammation in the intestine. Cell. 2010;140:859–870. doi: 10.1016/j.cell.2010.01.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gehart H., Clevers H. Tales from the crypt: new insights into intestinal stem cells. Nat. Rev. Gastroenterol. Hepatol. 2019;16:19–34. doi: 10.1038/s41575-018-0081-y. [DOI] [PubMed] [Google Scholar]
- Holmes E.W., Kelley W.N., Wyngaarden J.B. Editorial: The kidney and uric acid excretion in man. Kidney Int. 1972;2:115–118. doi: 10.1038/ki.1972.81. [DOI] [PubMed] [Google Scholar]
- Hsu N.Y., Nayar S., Gettler K., Talware S., Giri M., Alter I., Argmann C., Sabic K., Thin T.H., Ko H.B.M., et al. NOX1 is essential for TNFα-induced intestinal epithelial ROS secretion and inhibits M cell signatures. Gut. 2023;72:654–662. doi: 10.1136/gutjnl-2021-326305. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hwang H., Im J.E., Yang Y., Kim H., Kwon K.H., Kim Y.H., Kim J.Y., Yoo J.S. Bioinformatic Prediction of Gene Ontology Terms of Uncharacterized Proteins from Chromosome 11. J. Proteome Res. 2020;19:4907–4912. doi: 10.1021/acs.jproteome.0c00482. [DOI] [PubMed] [Google Scholar]
- Iatsenko I., Boquete J.P., Lemaitre B. Microbiota-Derived Lactate Activates Production of Reactive Oxygen Species by the Intestinal NADPH Oxidase Nox and Shortens Drosophila Lifespan. Immunity. 2018;49:929–942.e5. doi: 10.1016/j.immuni.2018.09.017. [DOI] [PubMed] [Google Scholar]
- Joosten L.A.B., Crişan T.O., Bjornstad P., Johnson R.J. Asymptomatic hyperuricaemia: a silent activator of the innate immune system. Nat. Rev. Rheumatol. 2020;16:75–86. doi: 10.1038/s41584-019-0334-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Keating G.M., Croom K.F. Fenofibrate: a review of its use in primary dyslipidaemia, the metabolic syndrome and type 2 diabetes mellitus. Drugs. 2007;67:121–153. doi: 10.2165/00003495-200767010-00013. [DOI] [PubMed] [Google Scholar]
- Khan S.R., Pearle M.S., Robertson W.G., Gambaro G., Canales B.K., Doizi S., Traxer O., Tiselius H.G. Kidney stones. Nat. Rev. Dis. Primers. 2016;2 doi: 10.1038/nrdp.2016.8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lawlor K.E., Murphy J.M., Vince J.E. Gasdermin and MLKL necrotic cell death effectors: Signaling and diseases. Immunity. 2024;57:429–445. doi: 10.1016/j.immuni.2024.02.011. [DOI] [PubMed] [Google Scholar]
- Li D., Li Y., Chen X., Ouyang J., Lin D., Wu Q., Fu X., Quan H., Wang X., Wu S., et al. The pathogenic mechanism of monosodium urate crystal-induced kidney injury in a rat model. Front. Endocrinol. 2024;15 doi: 10.3389/fendo.2024.1416996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li Q., Shi N., Cai C., Zhang M., He J., Tan Y., Fu W. The Role of Mitochondria in Pyroptosis. Front. Cell Dev. Biol. 2021;8 doi: 10.3389/fcell.2020.630771. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu X., Xia S., Zhang Z., Wu H., Lieberman J. Channelling inflammation: gasdermins in physiology and disease. Nat. Rev. Drug Discov. 2021;20:384–405. doi: 10.1038/s41573-021-00154-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lomenick B., Hao R., Jonai N., Chin R.M., Aghajan M., Warburton S., Wang J., Wu R.P., Gomez F., Loo J.A., et al. Target identification using drug affinity responsive target stability (DARTS) Proc. Natl. Acad. Sci. USA. 2009;106:21984–21989. doi: 10.1073/pnas.0910040106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ludikhuize M.C., Meerlo M., Gallego M.P., Xanthakis D., Burgaya Julià M., Nguyen N.T.B., Brombacher E.C., Liv N., Maurice M.M., Paik J.H., et al. Mitochondria Define Intestinal Stem Cell Differentiation Downstream of a FOXO/Notch Axis. Cell Metab. 2020;32:889–900.e7. doi: 10.1016/j.cmet.2020.10.005. [DOI] [PubMed] [Google Scholar]
- Marchi S., Vitto V.A.M., Danese A., Wieckowski M.R., Giorgi C., Pinton P. Mitochondrial calcium uniporter complex modulation in cancerogenesis. Cell Cycle. 2019;18:1068–1083. doi: 10.1080/15384101.2019.1612698. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Medema J.P., Vermeulen L. Microenvironmental regulation of stem cells in intestinal homeostasis and cancer. Nature. 2011;474:318–326. doi: 10.1038/nature10212. [DOI] [PubMed] [Google Scholar]
- Minton K. Pyroptosis heats tumour immunity. Nat. Rev. Immunol. 2020;20:274–275. doi: 10.1038/s41577-020-0297-2. [DOI] [PubMed] [Google Scholar]
- Nishizawa H., Maeda N., Shimomura I. Impact of hyperuricemia on chronic kidney disease and atherosclerotic cardiovascular disease. Hypertens. Res. 2022;45:635–640. doi: 10.1038/s41440-021-00840-w. [DOI] [PubMed] [Google Scholar]
- Ramesh P., Kirov A.B., Huels D.J., Medema J.P. Isolation, Propagation, and Clonogenicity of Intestinal Stem Cells. Methods Mol. Biol. 2018;2002:61–73. doi: 10.1007/7651_2018_179. [DOI] [PubMed] [Google Scholar]
- Ramos-León J., Valencia C., Gutiérrez-Mariscal M., Rivera-Miranda D.A., García-Meléndrez C., Covarrubias L. The loss of antioxidant activities impairs intestinal epithelium homeostasis by altering lipid metabolism. Exp. Cell Res. 2024;437 doi: 10.1016/j.yexcr.2024.113965. [DOI] [PubMed] [Google Scholar]
- Reginato A.M., Mount D.B., Yang I., Choi H.K. The genetics of hyperuricaemia and gout. Nat. Rev. Rheumatol. 2012;8:610–621. doi: 10.1038/nrrheum.2012.144. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rodríguez-Colman M.J., Schewe M., Meerlo M., Stigter E., Gerrits J., Pras-Raves M., Sacchetti A., Hornsveld M., Oost K.C., Snippert H.J., et al. Interplay between metabolic identities in the intestinal crypt supports stem cell function. Nature. 2017;543:424–427. doi: 10.1038/nature21673. [DOI] [PubMed] [Google Scholar]
- Sato T., Clevers H. Growing self-organizing mini-guts from a single intestinal stem cell: mechanism and applications. Science. 2013;340:1190–1194. doi: 10.1126/science.1234852. [DOI] [PubMed] [Google Scholar]
- Shamburek R.D., Farrar J.T. Disorders of the digestive system in the elderly. N. Engl. J. Med. 1990;322:438–443. doi: 10.1056/nejm199002153220705. [DOI] [PubMed] [Google Scholar]
- Shay J.E.S., Yilmaz Ö.H. Dietary and metabolic effects on intestinal stem cells in health and disease. Nat. Rev. Gastroenterol. Hepatol. 2025;22:23–38. doi: 10.1038/s41575-024-00980-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- So A., Thorens B. Uric acid transport and disease. J. Clin. Investig. 2010;120:1791–1799. doi: 10.1172/jci42344. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Spiller R.C. Intestinal absorptive function. Gut. 1994;35:S5–S9. doi: 10.1136/gut.35.1_suppl.s5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Steele T.H. Control of uric acid excretion. N. Engl. J. Med. 1971;284:1193–1196. doi: 10.1056/nejm197105272842106. [DOI] [PubMed] [Google Scholar]
- Tetteh P.W., Basak O., Farin H.F., Wiebrands K., Kretzschmar K., Begthel H., van den Born M., Korving J., de Sauvage F., van Es J.H., et al. Replacement of Lost Lgr5-Positive Stem Cells through Plasticity of Their Enterocyte-Lineage Daughters. Cell Stem Cell. 2016;18:203–213. doi: 10.1016/j.stem.2016.01.001. [DOI] [PubMed] [Google Scholar]
- Tian H., Biehs B., Warming S., Leong K.G., Rangell L., Klein O.D., de Sauvage F.J. A reserve stem cell population in small intestine renders Lgr5-positive cells dispensable. Nature. 2011;478:255–259. doi: 10.1038/nature10408. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang Y., Lu J., Carisey A.F., Chadchan S.B., Lee H.W., Malireddi R.K.S., Sharma B.R., Pandian N., Tweedell R.E., Palacios G., et al. Innate immune and metabolic signals induce mitochondria-dependent membrane lysis via mitoxyperiosis. Cell. 2025;188:7155–7174.e25. doi: 10.1016/j.cell.2025.11.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Willems P.G.M., Rossignol R., Dieteren C.J., Murphy M.P., Koopman W.H. Redox Homeostasis and Mitochondrial Dynamics. Cell Metab. 2015;22:207–218. doi: 10.1016/j.cmet.2015.06.006. [DOI] [PubMed] [Google Scholar]
- Wu N., Sun H., Zhao X., Zhang Y., Tan J., Qi Y., Wang Q., Ng M., Liu Z., He L., et al. MAP3K2-regulated intestinal stromal cells define a distinct stem cell niche. Nature. 2021;592:606–610. doi: 10.1038/s41586-021-03283-y. [DOI] [PubMed] [Google Scholar]
- Xie J., Si J., Chen Y., Ding H., Cao Y., Xiang J., Shao S., Shen Y. Direct Modulation of Host Cells and Gut Microbiota by Orally Delivered Antioxidant Nanocages for Colitis Treatment. ACS Nano. 2025;19:22477–22491. doi: 10.1021/acsnano.5c08006. [DOI] [PubMed] [Google Scholar]
- Zhao P., Yin S., Qiu Y., Sun C., Yu H. Ferroptosis and pyroptosis are connected through autophagy: a new perspective of overcoming drug resistance. Mol. Cancer. 2025;24:23. doi: 10.1186/s12943-024-02217-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhu G., Xie Y., Wang J., Wang M., Qian Y., Sun Q., Dai Y., Li C. Multifunctional Copper-Phenolic Nanopills Achieve Comprehensive Polyamines Depletion to Provoke Enhanced Pyroptosis and Cuproptosis for Cancer Immunotherapy. Adv. Mater. 2024;36 doi: 10.1002/adma.202409066. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
-
•
The RNA-seq data generated in this study have been deposited in the Genome Sequence Archive (GSA) under accession number CRA043081 and are publicly available.
-
•
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.







