Glucosamine Promotes Autophagy and Attenuates Hepatic Steatosis Via O‐GlcNAcylation–Mediated Mechanisms

ABSTRACT

Autophagy is a key cellular process regulating lipid turnover and maintaining hepatic homeostasis, and its impairment is closely associated with the pathogenesis of nonalcoholic fatty liver disease (NAFLD). In this study, we examined the effects of glucosamine (GlcN), a hexosamine biosynthetic pathway intermediate, on autophagy and lipid accumulation using both human hepatocellular carcinoma (HepG2) cells and a high‐fat diet (HFD)‐induced NAFLD mouse model. GlcN treatment led to a dose‐ and time‐dependent increase in the expression of autophagy‐related markers LC3 and p62 at both mRNA and protein levels. Pharmacological inhibition of O‐GlcNAcase (OGA) further enhanced autophagic activity, whereas inhibition of O‐GlcNAc transferase (OGT) abrogated GlcN‐induced autophagic responses, implicating O‐GlcNAcylation as a key mediator of GlcN‐driven autophagy induction. Functionally, GlcN significantly reduced palmitic acid (PA)‐induced lipid accumulation in HepG2 cells and alleviated hepatic steatosis in HFD‐fed mice, likely through enhancement of autophagic flux. These findings demonstrate that GlcN promotes lipid clearance in hepatocytes via O‐GlcNAc‐dependent autophagy and highlight its potential as a therapeutic agent for NAFLD and related metabolic disorders.

Glucosamine (GlcN) alleviates hepatic lipid accumulation by activating autophagy in hepatocytes. GlcN treatment enhances autophagic flux, as evidenced by increased autophagosome formation and elevated LC3‐II and p62 expression, leading to accelerated lipid droplet clearance. This autophagy‐mediated lipid degradation contributes to the attenuation of hepatic steatosis in nonalcoholic fatty liver disease (NAFLD).

1. Introduction

Non‐alcoholic fatty liver disease (NAFLD) is defined as the accumulation of fat in more than 5% of hepatocytes in the absence of significant alcohol consumption, viral hepatitis, or other specific liver diseases [1]. It is strongly associated with obesity, insulin resistance, and the metabolic syndrome, reflecting its close link to modern lifestyle and dietary habits [2]. The pathogenesis of NAFLD is complex and multifactorial, involving impaired lipid metabolism, mitochondrial dysfunction, lipotoxicity, and chronic hepatic inflammation [3]. NAFLD encompasses a disease spectrum ranging from simple steatosis to nonalcoholic steatohepatitis (NASH), the latter characterized by hepatocyte injury, lobular inflammation, and progressive fibrosis [4]. NASH substantially increases the risk of cirrhosis, liver failure, and hepatocellular carcinoma, making it a major contributor to liver‐related morbidity and mortality. NAFLD is estimated to affect approximately 25%–30% of adults worldwide and is projected to become the leading indication for liver transplantation in the near future [3, 5]. Despite its growing clinical and socioeconomic burden, no pharmacological therapies have yet been approved. Current management strategies rely mainly on lifestyle modification, weight reduction, and optimization of metabolic comorbidities.

Autophagy is a highly conserved catabolic process that maintains cellular homeostasis by degrading and recycling damaged organelles, misfolded proteins, and excess nutrients via lysosome‐dependent pathways [6, 7, 8]. Under basal conditions, autophagy functions as a quality control mechanism, but it is also dynamically regulated in response to various stressors, including nutrient deprivation, oxidative stress, and endoplasmic reticulum stress [6]. The autophagic process involves the formation of double‐membraned autophagosomes that sequester cytoplasmic components, which are then delivered to lysosomes for degradation and subsequent recycling of macromolecules [7, 8].

In hepatocytes, autophagy is a critical catabolic process that maintains cellular and metabolic homeostasis by degrading and recycling intracellular components such as damaged organelles, misfolded proteins, and macromolecules [7, 9, 10]. This tightly regulated mechanism allows the liver to adapt to metabolic stressors, including nutrient deprivation and lipid excess, thereby preserving hepatic function [9]. Dysregulation of autophagy has been increasingly recognized as a contributing factor in the pathogenesis of metabolic liver diseases, particularly NAFLD [7, 11]. In both experimental models and human liver tissues, reduced autophagic flux has been associated with excessive lipid accumulation, mitochondrial dysfunction, oxidative stress, and heightened inflammatory responses [7, 10]. These alterations not only exacerbate hepatic steatosis but also drive disease progression toward NASH. While impaired autophagy has been implicated in the progression of NAFLD, both pharmacological and genetic strategies aimed at enhancing autophagic activity have demonstrated protective effects in various experimental models [10, 12]. These findings underscore the therapeutic potential of targeting autophagy to counteract hepatic steatosis and its progression. Activation of autophagy facilitates the clearance of intracellular lipid droplets through lipophagy, thereby reducing hepatic steatosis and restoring metabolic homeostasis [10, 13, 14]. Moreover, enhanced autophagic function has been linked to improved insulin sensitivity, decreased oxidative stress, and suppression of pro‐inflammatory signaling pathways within the liver [6]. These pleiotropic effects collectively contribute to the amelioration of steatotic pathology and inhibition of disease progression toward NASH. Therefore, therapeutic strategies aimed at restoring or augmenting autophagic flux may offer a promising avenue for the treatment of NAFLD and related metabolic disorders.

Glucosamine (GlcN) is a naturally occurring amino sugar and a key substrate of the hexosamine biosynthetic pathway (HBP). It is taken up by cells via glucose transporters and bypasses the rate‐limiting step catalyzed by glutamine:fructose‐6‐phosphate amidotransferase (GFAT) [15, 16, 17]. Once inside the cell, GlcN is rapidly phosphorylated and metabolized into UDP‐N‐acetylglucosamine (UDP‐GlcNAc), the essential donor substrate for O‐linked β‐N‐acetylglucosamine (O‐GlcNAc) modification of proteins [15, 16, 17]. This dynamic and reversible post‐translational modification regulates a wide array of cellular processes, including transcription, signal transduction, and stress responses [15, 18]. Recent evidence suggests that O‐GlcNAcylation plays a crucial role in the regulation of autophagy, a catabolic process essential for maintaining hepatic metabolic homeostasis [19, 20]. This is particularly relevant in the pathogenesis of NAFLD, where impaired autophagic flux and dysfunctional nutrient sensing contribute to lipid accumulation, inflammation, and disease progression. Therefore, elucidating the role of GlcN in modulating hepatic autophagy via O‐GlcNAcylation may yield important mechanistic insights and uncover novel therapeutic strategies for NAFLD.

In the present study, we investigated the regulatory effects of GlcN on autophagy and lipid metabolism using HepG2 cells and a murine model of high‐fat diet (HFD)‐induced NAFLD. We further explored the involvement of O‐GlcNAcylation in mediating these effects. Our findings reveal a novel role for GlcN as a modulator of hepatic autophagy and lipid handling and suggest its therapeutic potential in alleviating hepatic steatosis through O‐GlcNAc–dependent mechanisms.

2. Materials and Methods

2.1. Cell Culture

Human hepatocellular carcinoma (HepG2) cells were obtained from the Korean Cell Line Bank (Seoul, Korea). HepG2 cells were maintained in HAM's F‐12 medium (GE Healthcare, Chicago, IL, USA) supplemented with 10% fetal bovine serum (FBS; HyClone, UT, USA) and 1% penicillin‐streptomycin (HyClone). Cells were cultured at 37°C in a humidified atmosphere containing 5% CO₂. For GlcN treatment, HepG2 cells were incubated with the indicated concentrations of GlcN for the specified times. To modulate O‐GlcNAcylation, cells were treated with Thiamet‐G (1 µM), PUGNAc (1 mM), or OSMI‐1 (15 µM) for the indicated durations. For autophagic flux analysis, cells were treated with the indicated concentrations of GlcN for 24 h in the presence or absence of bafilomycin A1 (10 nM).

2.2. Experimental Animal and Drug Administration

All animal experiments were approved by the Institutional Animal Care and Use Committee of Inha University (Approval Number: 190920‐658) and conducted in accordance with institutional guidelines. Male C57BL/6 J mice (7 weeks old; DBL, Chungbuk, Korea) were housed under controlled conditions with a 12‐h light/dark cycle, ambient temperature (22 ± 2°C), and ad libitum access to food and water. Mice were acclimated for 1 week prior to experimentation. Mice were fed either a standard chow diet (DBL, Chungbuk, Korea) containing 9% fat, 67% carbohydrate, and 23% protein (% kcal; 3.4 kcal/g), or a high‐fat diet (HFD; DooYeol Biotech, Seoul, Korea) consisting of 60.3% fat, 21.3% carbohydrate, and 18.4% protein (% kcal; 5.1 kcal/g) for 12 weeks. GlcN was administered via drinking water (10% w/v, pH 7.4) and made available ad libitum. Water consumption was monitored at the cage level throughout the experiment. Based on an average daily water intake of approximately 2–3 mL per mouse, the estimated GlcN intake was approximately 200–300 mg/day per mouse, corresponding to approximately 6–8 g/kg/day. Because water consumption was measured at the cage level, the calculated GlcN intake should be considered an approximation rather than an exact individual dose.

2.3. Cell Morphology and Transmission Electron Microscope (TEM)

For morphological analysis, HepG2 cells were seeded in 24‐well plates and subjected to the indicated treatments. Following incubation, cell morphology was observed and imaged using a phase‐contrast microscope (DMIL, Leica, Wetzlar, Germany) equipped with TUCSEN image analysis software (v3.0, Scion Corp). For ultrastructural analysis by TEM, HepG2 cells were seeded in 6‐well plates and treated as described. After treatment, cells were washed with 0.1 M phosphate buffer and harvested. The cells were fixed in 2.5% glutaraldehyde at 4°C for 2 h, followed by post‐fixation with 1% osmium tetroxide for 30 min. After rinsing with phosphate buffer, samples were dehydrated through a graded ethanol series and embedded in epoxy resin. Ultrathin sections were prepared using an ultramicrotome (RMC MTx, Boeckeler Instruments Inc., Tucson, AZ, USA) and examined with a transmission electron microscope (H‐7100, Hitachi, Tokyo, Japan).

2.4. Quantitative Real‐Time Reverse Transcription PCR (qRT‐PCR)

Total RNA was isolated from cells using the TRIzol™ reagent (Invitrogen, Waltham, MA, USA) according to the manufacturer's protocol. Complementary DNA (cDNA) was synthesized using the GoScript™ Reverse Transcriptase kit (Promega, Madison, WI, USA). Quantitative real‐time PCR was performed with SYBR Green Master Mix (TOYOBO, Osaka, Japan) using specific primers (GAPDH, Forward 5′‐AGGTCGGTGTGAACGGATTTG‐3′, Reverse 5′‐TGTAGACCATGTAGTTGAGGTCA‐3′, ATG5, Forward 5′‐GCTTCGAGATGTGTGGTTT G G‐3′, Reverse 5′‐TGAAGAAAAGTTTTCAGATGTGAGG‐3′, LC3, Forward 5′‐GTCCTGGACAAGACCAAGTTCC‐3′, Reverse 5′‐CCATTCACCAGGAGGAAGAAGG‐3′, p62, Forward 5′‐GCTCTTCGGAAGTCAGCAAACC‐3′, Reverse 5′‐GCAGTTTCCCGACT CCATCTGT‐3′) on a real‐time PCR system (Bio‐Rad, Hercules, CA, USA). Gene expression levels were normalized to the internal control GAPDH.

2.5. Immunofluorescence Staining

2.5.1. Cell Culture Experiments

HepG2 cells were seeded on cover glasses and treated with the indicated compounds. After treatment, cells were washed with cold phosphate‐buffered saline (PBS) and fixed with 4% paraformaldehyde (PFA, Samchun, Korea) for 15 min at room temperature. Cells were rinsed with PBS and permeabilized/blocking was performed for 5 min using 0.1% Triton X‐100 in PBS containing 5% normal goat serum (Vector Laboratories, Burlingame, CA, USA). Cells were then incubated with primary antibodies against LC3β (1:100; Cell Signaling Technology, Danvers, MA, USA) and SQSTM1/p62 (1:500; Abcam) for 2 h at RT. Following washes, cells were incubated with Alexa Fluor 488‐ or 594‐conjugated secondary antibodies (1:1000; Invitrogen, Carlsbad, CA, USA) for 1 h at room temperature. Nuclear counterstaining was performed with DAPI (1:1000; Sigma‐Aldrich), and the samples were mounted on slides using Fluoromount‐G mounting medium (SouthernBiotech, Birmingham, AL, USA). Fluorescent images were acquired using a fluorescence microscope (Olympus, Tokyo, Japan) and analyzed with ImageJ software (NIH). For LC3/BODIPY co‐localization analysis, neutral lipid droplets were stained with BODIPY (1 μg/mL) for 15 min, and the co‐localization of lipid droplets with LC3‐positive puncta was analyzed by fluorescence microscopy.

2.5.2. Animal Experiments

Mouse livers were harvested following PBS perfusion. Dissected livers were fixed in 4% PFA for 24 h at room temperature, then cryoprotected sequentially in 10% and 30% sucrose solutions for 24 h each. Tissues were embedded in O.C.T. compound (Sakura Finetek, Japan) and sectioned at 6 μm thickness using a cryostat (CM3050; Leica, Wetzlar, Germany). Sections were mounted onto coated slides (Matsunami Glass Ind. Ltd., Osaka, Japan). Antigen retrieval was performed by heating sections in 10 mM citrate buffer (pH 6.0) for 5 min. After cooling, sections were blocked with 10% normal goat serum in PBST (PBS containing 0.1% Triton X‐100) for 1 h at room temperature. Slides were incubated with primary antibodies against LC3 or SQSTM1/p62 overnight at 4°C, followed by incubation with appropriate fluorophore‐conjugated secondary antibodies for 1 h at RT. Nuclei were stained with DAPI. Immunostained tissues were visualized using a Zeiss LSM 510 META confocal microscope (Zeiss, Oberkochen, Germany) and images were analyzed with ZEN 2009 Light Edition software (Zeiss).

2.6. Western Blotting

Total protein was extracted from cells and tissues using RIPA buffer (Tech & Innovation, Chuncheon, Korea) supplemented with protease, phosphatase, and O‐GlcNAcase inhibitors, including 1 mM PMSF, 1 mM DTT, 1 mg/mL aprotinin, 1 mg/mL leupeptin, 1 mM sodium orthovanadate, 1 mM sodium fluoride, and 1 mM streptozotocin. Protein concentrations were determined using the Bradford assay (Bio‐Rad). Equal amounts of protein were separated by SDS‐PAGE (Bio‐Rad) and transferred onto Hybond™‐ECL™ nitrocellulose membranes (Hybond ECL; Cytiva, Marlborough, MA, USA). Membranes were blocked with 5% skim milk (BD Biosciences, Franklin Lakes, NJ, USA) or bovine serum albumin (BSA) in PBST (PBS containing 0.05% Tween 20) for 1 h at room temperature. After a washing with PBST, the blots were incubated overnight at 4°C with specific antibodies: anti‐p62 (1:1,000, Abcam, Cambridge, UK), anti‐LC3 (1:1,000, Sigma‐Aldrich, MO, USA), and anti‐β‐actin (1:1,000, Santa Cruz, CA, USA). After washing with PBST, membranes were incubated with horseradish peroxidase (HRP)‐conjugated secondary antibodies (Abcam) diluted in PBST for 1 h at room temperature. Protein bands were visualized using an enhanced chemiluminescence detection system (Bio‐Rad) and, when required, quantified by densitometry using appropriate imaging software.

2.7. Palmitic Acid (PA) Preparation and Treatment

PA was first dissolved in ethanol to prepare a 500 mM stock solution and stored at –20°C. Prior to use, the stock solution was diluted to 50 mM in 0.01 M NaOH and incubated at 70°C for 30 min to facilitate solubilization. The resulting solution was then conjugated with 10% fatty acid–free BSA to form a PA–BSA complex for cellular treatment. For PA treatment, HepG2 cells were preconditioned for 24 h in glucose‐free DMEM (Gibco, Waltham, MA, USA) supplemented with 5 mM glucose, 2% FBS, and 1% penicillin‐streptomycin (Gibco) before exposure to the PA–BSA complex.

2.8. Oil Red O (ORO) Staining

2.8.1. Cell Culture Experiments

ORO staining was performed to visualize intracellular neutral lipids and triglycerides as previously described [21]. HepG2 cells were washed with PBS and fixed with 4% PFA for 20 min at room temperature. After fixation, cells were rinsed with 60% isopropanol and stained with 0.6% ORO solution (prepared in 60% isopropanol) for 1 h on a rocker. Following staining, cells were washed sequentially with 60% isopropanol and PBS. For quantification, the retained dye was eluted with 100% isopropanol, and absorbance was measured at 520 nm using a microplate reader. The results were normalized to cell viability, as assessed by the MTT assay.

2.8.2. Animal Experiments

For lipid detection in tissue, frozen liver sections were rinsed with distilled water and incubated in 100% propylene glycol for 10 min. Slides were then stained with 0.7% ORO solution in propylene glycol for 15 min at 60°C. After staining, tissues were washed with 85% propylene glycol followed by distilled water. Stained sections were visualized using a light microscope (DMIL, Leica, Wetzlar, Germany), and images were analyzed using ImageJ software (NIH, Bethesda, MD, USA).

2.9. Hematoxylin and Eosin (H&E) Staining

For histological analysis, mouse livers were perfused with PBS and fixed in 10% PFA for 7 days at room temperature. Fixed tissues were embedded in paraffin, sectioned at a thickness of 5 μm, and mounted on coated glass slides. For staining, tissue sections were deparaffinized in 100% xylene (Duksan, Ansan, Korea) for 5 min and rehydrated through a graded ethanol series (100%, 95%, 80%, and 70%; Duksan). After rehydration, sections were post‐fixed in 4% PFA and stained with Harris hematoxylin solution (American MasterTech Scientific, CA, USA), followed by counterstaining with eosin solution (Sigma‐Aldrich, St. Louis, MO, USA). Stained tissues were dehydrated through ascending ethanol concentrations and cleared in xylene. Finally, slides were mounted with a permanent mounting medium and examined using an LS83 light microscope (Olympus, Tokyo, Japan).

2.10. Blood Glucose Measurement

Blood glucose levels were measured using a glucometer (OneTouch Ultra; LifeScan, Milpitas, CA, USA). For GTT, overnight‐fasted mice received an intraperitoneal injection of d‐glucose (1 g/kg body weight). For ITT, mice were fasted for 4 h before intraperitoneal injection of human insulin (0.75 IU/kg body weight). Blood glucose was measured from tail vein blood at 0, 10, 20, 40, 60, 80, 100, and 120 min following injection.

2.11. Statistical Analysis

All data are presented as means ± standard error of the mean (SEM). Statistical analyses were performed using ordinary one‐way analysis of variance (ANOVA), followed by the two‐stage linear step‐up procedure of Benjamini, Krieger, and Yekutieli for multiple comparisons. Differences were considered statistically significant at p < 0.05. All statistical analyses and graphical representations were conducted using GraphPad Prism version 8.0 (GraphPad Software, San Diego, CA, USA). Experimental measurements were conducted in a blinded and randomized manner. Detailed statistical information, including exact p‐values and the number of replicates, is provided in the Results section and corresponding figure legends.

3. Results

3.1. GlcN Induces Autophagosome Accumulation in HepG2 Cells

To evaluate the effect of GlcN on hepatocyte autophagy, HepG2 cells were treated with GlcN at 8 or 16 mM for 24 h. Transmission electron microscopy (TEM) revealed a pronounced accumulation of double‐membrane vesicles characteristic of autophagosomes in GlcN‐treated cells, with greater abundance observed at 16 mM (Figure 1A). To further assess autophagy‐related gene regulation, LC3 and p62 mRNA levels were measured by qRT‐PCR. Treatment with 16 mM GlcN significantly upregulated both transcripts, whereas 8 mM induced no appreciable change (Figure 1B), indicating a dose‐dependent effect of GlcN on autophagy gene expression. In contrast, ATG5 mRNA, essential for autophagosome elongation, remained unchanged, suggesting selective modulation of downstream autophagy components. Western blot analysis corroborated these findings at the protein level. GlcN treatment led to a concentration‐dependent increase in the LC3‐II/LC3‐I ratio, with notable elevation from 4 mM onward, and a marked upregulation of p62 protein at 16 mM GlcN (Figure 1C), indicating enhanced autophagosome formation or accumulation. To validate these observations, immunofluorescence staining for LC3 and p62 was performed. GlcN treatment resulted in a dose‐dependent increase in LC3‐ and p62‐positive puncta per cell, with frequent co‐localization, further supporting the accumulation of autophagosomes (Figure 1D). To further evaluate autophagic flux, HepG2 cells were treated with bafilomycin A1. GlcN further increased LC3‐II and p62 accumulation in the presence of bafilomycin A1, indicating enhanced autophagic flux (Supplementary Figure 1). Collectively, these data demonstrate that GlcN promotes autophagosome accumulation in HepG2 cells in a dose‐dependent manner. These findings, together with the bafilomycin A1 experiments, support the conclusion that GlcN enhances autophagic flux.

Figure 1.

GlcN induces dose‐dependent autophagy in HepG2 cells. (A) Representative transmission electron microscopy images of HepG2 cells treated with GlcN for 24 h. Autophagosomes are indicated by asterisks (*). Enlarged regions are outlined with black squares. (B) Quantitative real‐time PCR analysis of autophagy‐related gene expression following 24 h treatment with GlcN at the indicated concentrations. mRNA levels were normalized to GAPDH. (C) Western blot analysis of LC3 and p62 protein expression in HepG2 cells treated with the indicated concentrations of GlcN for 24 h. Quantification was expressed as the LC3‐II/LC3‐I and p62/β‐actin ratios. (D) Representative immunofluorescence images of HepG2 cells stained for LC3 (green), p62 (red), and DAPI (blue) following treatment with the indicated concentrations of GlcN for 24 h. Quantification of LC3⁺ and p62⁺ puncta per cell is shown, along with fluorescence intensity normalized to DAPI. Scale bar = 5 μm. Data are expressed as mean ± SEM. Statistical significance was determined using one‐way ANOVA followed by the Benjamini, Krieger, and Yekutieli two‐stage linear step‐up procedure for multiple comparisons (*p < 0.05, **p < 0.01, ***p < 0.001 vs. 0 mM).

3.2. GlcN Induces Time‐Dependent Autophagy Activation and Progression in HepG2 Cells

To investigate the temporal dynamics of GlcN‐induced autophagy, HepG2 cells were treated with 8 mM GlcN and analyzed at various time points. TEM analysis revealed that autophagic vacuoles were not apparent immediately after GlcN exposure. Autophagosome formation became detectable at 6 h, and by 24 h, autophagosomes containing partially degraded cellular organelles were observed, indicating progression through the autophagic degradation phase (Figure 2A). Consistent with these ultrastructural findings, temporal analysis of autophagy‐related gene expression showed that ATG5 mRNA remained unchanged throughout the time course, suggesting that GlcN does not affect early autophagosome elongation machinery. In contrast, p62 mRNA increased rapidly, peaking at 6 h and remaining elevated up to 24 h, while LC3 mRNA began to rise at 12 h and continued to increase thereafter (Figure 2B). Western blot analysis corroborated the transcriptional data. The LC3‐II/LC3‐I ratio, indicative of autophagosome formation, increased from 6 h and remained elevated over time (Figure 2C). Notably, p62 protein levels rose at 12 h but decreased substantially by 24 h, consistent with autophagosome degradation via autolysosomal fusion and ongoing autophagic flux. Immunofluorescence staining further supported these observations: LC3‐ and p62‐positive puncta increased markedly, peaking at 12 h, and by 24 h, p62 staining was reduced along with a decline in LC3‐positive puncta, reflecting completion of the autophagy cycle (Figure 2D).

Figure 2.

GlcN induces autophagy in a time‐dependent manner in HepG2 cells. (A) Transmission electron microscopy images of HepG2 cells treated with 8 mM GlcN for 0, 6, and 24 h. Autophagosomes are indicated by asterisks (*), and autolysosomes (digested autophagosomes) are marked with pound symbols (^#). Enlarged regions are outlined with black squares. (B) Time‐course analysis of autophagy‐related gene expression by qRT‐PCR in HepG2 cells treated with 8 mM GlcN for the indicated times. mRNA levels were normalized to GAPDH. (C) Western blot analysis of LC3 and p62 protein levels in HepG2 cells treated with 8 mM GlcN for the indicated times. Quantification was expressed as the LC3‐II/LC3‐I and p62/β‐actin ratios. (D) Representative immunofluorescence images of LC3 (green), p62 (red), and DAPI (blue) staining in HepG2 cells treated with 8 mM GlcN for the indicated times. Quantification of LC3⁺ and p62⁺ puncta per cell is shown, along with fluorescence intensity normalized to DAPI. Scale bar = 5 μm. Data are expressed as mean ± SEM. Statistical significance was determined by one‐way ANOVA with Benjamini, Krieger, and Yekutieli two‐stage linear step‐up procedure for multiple comparisons (*p < 0.05, **p < 0.01, ***p < 0.001 vs. 0 h, ^# p < 0.05 vs. 12 h).

3.3. GlcN‐Induced Autophagy Is Mediated Through Increased O‐GlcNac Cycling

To investigate whether GlcN‐induced autophagy is potentially dependent on dynamic O‐GlcNAc cycling, HepG2 cells were treated with inhibitors of OGT and OGA, the enzymes responsible for adding and removing O‐GlcNAc modifications. Treatment with the OGA inhibitors Thiamet‐G and PUGNAc, which elevate global O‐GlcNAcylation, resulted in increased p62 protein levels and higher LC3‐II/I ratios compared with controls, suggesting enhanced autophagosome accumulation (Figure 3A). Although both inhibitors modestly increased LC3 mRNA levels, only PUGNAc induced a statistically significant change, while p62 mRNA remained unchanged, indicating that the observed p62 protein increase was not transcriptionally driven (Figure 3B). To further explore the potential dependency of GlcN‐induced autophagy on O‐GlcNAcylation, cells were co‐treated with GlcN and the OGT inhibitor OSMI‐1, which reduces O‐GlcNAc levels. OSMI‐1 did not prevent GlcN‐induced upregulation of LC3 and p62 transcripts, suggesting that transcriptional responses to GlcN may occur independently of O‐GlcNAcylation (Figure 3C). However, OSMI‐1 largely abolished GlcN‐induced increases in LC3‐II/I ratio and p62 protein levels, indicating that protein‐level changes and autophagosome accumulation may require intact O‐GlcNAc signaling (Figure 3D). Immunofluorescence analysis further supported these observations. GlcN treatment markedly increased LC3‐ and p62‐positive puncta, whereas co‐treatment with OSMI‐1 significantly reduced these signals. Thiamet‐G alone induced LC3 and p62 accumulation similar to GlcN, reinforcing the possibility that elevated O‐GlcNAcylation contributes to autophagy induction (Figure 3E). Collectively, these results suggest that GlcN‐induced autophagosome accumulation is dependent on increased O‐GlcNAcylation.

Figure 3.

O‐GlcNAcylation mediates GlcN‐induced regulation of autophagic flux in HepG2 cells. HepG2 cells were treated for 24 h with Thiamet‐G (1 µM) and PUGNAc (1 mM), or OSMI‐1 (15 µM), with or without GlcN (8 mM). (A) Western blot analysis of LC3 and p62 protein expression. Quantification was expressed as the LC3‐II/LC3‐I and p62/β‐actin ratios. (B, C) Quantitative real‐time PCR analysis of autophagy‐related gene expression. mRNA levels were normalized to GAPDH. (D) Protein levels of LC3 and p62 were assessed by Western blot. Quantification was expressed as the LC3‐II/LC3‐I and p62/β‐actin ratios. (E) Representative immunofluorescence images of LC3 (green), p62 (red), and DAPI (blue) staining in HepG2 cells following GlcN treatment. Quantification of LC3⁺ and p62⁺ puncta per cell is shown, along with fluorescence intensity normalized to DAPI. Scale bar = 5 μm. Data are expressed as mean ± SEM. Statistical analysis was performed using one‐way ANOVA followed by the Benjamini, Krieger, and Yekutieli two‐stage linear step‐up procedure for multiple comparisons (*p < 0.05, **p < 0.01, ***p < 0.001 vs. Con, ^# p < 0.05, ^## p < 0.01, ^### p < 0.001 vs. GlcN).

3.4. GlcN Attenuates Palmitic Acid (PA)‐Induced Lipid Accumulation Via Autophagy Activation in HepG2 Cells

To elucidate the effects of PA on autophagic activity in hepatocytes, we initially evaluated changes in key autophagy markers in HepG2 cells following PA exposure. PA treatment did not significantly alter mRNA expression levels of p62 and LC3; however, protein levels of p62 and the LC3‐II/I ratio were significantly decreased, indicating suppressed autophagic activity (Figure 4A, B). Next, we investigated whether GlcN could mitigate PA‐induced lipid accumulation by modulating autophagy. GlcN treatment increased p62 mRNA levels significantly and modestly elevated LC3 transcripts, while Thiamet‐G did not affect transcription of these genes (Figure 4C). Notably, both GlcN and Thiamet‐G restored the PA‐reduced p62 protein levels and LC3‐II/I ratio, consistent with enhanced autophagic flux (Figure 4D). To determine if GlcN‐mediated autophagy contributed to lipid clearance, we performed ORO staining to quantify intracellular neutral lipid accumulation. PA treatment markedly increased lipid deposition in HepG2 cells, which was significantly alleviated by GlcN co‐treatment (Figure 4E). Under basal conditions (without PA), GlcN caused a slight, non‐significant increase in lipid levels. Importantly, inhibition of autophagosome‐lysosome fusion by bafilomycin abolished the lipid‐lowering effect of GlcN, confirming that autophagic degradation is required for this process (Figure 4E). LC3/BODIPY co‐localization analysis showed that GlcN treatment increased the co‐localization of LC3‐positive puncta with lipid droplets, supporting the involvement of lipophagy in lipid clearance (Supplementary Figure 2). To determine the role of O‐GlcNAc cycling in this process, HepG2 cells were treated with Thiamet‐G (OGA inhibitor) or OSMI‐1 (OGT inhibitor). Thiamet‐G mimicked GlcN's effect by significantly reducing PA‐induced lipid accumulation, whereas OSMI‐1 exacerbated lipid deposition and counteracted GlcN's protective effects (Figure 4F). Although OSMI‐1 slightly increased lipid levels under basal conditions, the change was not statistically significant. Taken together, these data strongly suggest that GlcN attenuates PA‐induced lipid accumulation in hepatocytes by enhancing autophagy in an O‐GlcNAcylation‐dependent manner.

Figure 4.

GlcN attenuates palmitic acid‐induced lipid accumulation via autophagy induction in HepG2 cells. (A, B) HepG2 cells were pre‐treated with palmitic acid (PA, 50 µM) for 24 h to induce lipid accumulation. (A) mRNA expression of LC3 and p62 was determined by qRT‐PCR and normalized to GAPDH. (B) Protein levels of LC3 and p62 were assessed by Western blot. Quantification was expressed as the LC3‐II/LC3‐I and p62/β‐actin ratios. (C, D) HepG2 cells were pre‐treated with 50 µM PA for 24 h, followed by treatment with 8 mM GlcN and 1 µM Thiamet‐G for an additional 24 h. (C) mRNA expression of LC3 and p62 was determined by qRT‐PCR and normalized to GAPDH. (D) Protein levels of LC3 and p62 were assessed by western blot. Quantification was expressed as the LC3‐II/LC3‐I and p62/β‐actin ratios. (E, F) HepG2 cells were pre‐treated with 50 µM PA for 24 h, followed by treatment with 8 mM GlcN, 10 nM bafilomycin A1, 1 µM Thiamet‐G, 1 mM PUGNAc, and 15 µM OSMI‐1 for an additional 24 h. (E, F) Bright‐field microscopy images of ORO‐stained HepG2 cells following treatment. Lipid accumulation was quantified based on ORO staining intensity and normalized to cell viability. Data are expressed as mean ± SEM. Statistical analysis was performed using one‐way ANOVA followed by the Benjamini, Krieger, and Yekutieli two‐stage linear step‐up procedure for multiple comparisons (*p < 0.05, ***p < 0.001 vs. Con, ^## p < 0.01, ^### p < 0.001 vs. PA, ^&&& p < 0.001 vs. PA+GlcN).

3.5. GlcN Attenuates HFD–Induced Hepatic Steatosis Through Autophagy Activation in Mice

We first confirmed our previous in vitro findings that GlcN exerts opposing effects on lipid accumulation depending on glucose availability [21]. Specifically, GlcN promoted lipid storage in HepG2 cells under normal glucose conditions (5 mM), whereas it suppressed lipid accumulation under high glucose conditions (25 mM), reflecting a state of energy excess (Supplementary Figure 3). These results suggest that GlcN may alleviate steatosis associated with caloric excess by enhancing autophagy. To investigate this possibility, we utilized a murine model of NAFLD induced by 12 weeks of high‐fat diet (HFD) feeding. HFD‐fed mice showed significant increases in body weight (62%) and liver weight (56%) compared with chow‐fed controls, confirming successful induction of obesity and hepatic steatosis (Figure 5A, B). Oral GlcN supplementation markedly attenuated these effects, reducing body weight by 17% and liver weight by 38% relative to HFD‐fed mice. Gross examination revealed enlarged, pale yellow livers in the HFD group, indicative of steatosis, whereas GlcN‐treated livers were smaller and displayed a healthy brownish appearance similar to chow‐fed controls (Figure 5C). Histological analysis supported these findings: H&E staining showed extensive macrovesicular steatosis and hepatocyte ballooning in the HFD group, hallmark features of NAFLD pathology [22], whereas livers from GlcN‐treated mice retained more intact hepatic architecture with a notable reduction in steatosis (Figure 5D). Consistently, Oil Red O staining revealed abundant neutral lipid deposition in the HFD group, which was substantially diminished by GlcN treatment (Figure 5E). To further evaluate the metabolic effects of GlcN, GTT, and ITT were performed. GlcN‐treated mice exhibited lower blood glucose levels during both GTT and ITT compared with the HFD group, indicating improved glucose homeostasis (Supplementary Figure 4). To investigate whether autophagy contributes to these protective effects, we assessed hepatic autophagy markers. GlcN treatment increased LC3 mRNA expression under both chow and HFD conditions, while p62 transcript levels remained unchanged (Figure 5F). Although Western blot analysis did not show statistically significant changes in LC3‐II/I ratio or p62 protein levels, GlcN‐treated mice exhibited a trend toward elevated autophagy markers (Figure 5G). Immunofluorescence analysis further demonstrated that HFD feeding slightly reduced LC3‐positive puncta, whereas GlcN supplementation restored autophagosome formation to levels comparable with control livers (Figure 5H). Taken together, these results demonstrate that GlcN effectively attenuates HFD–induced hepatic steatosis, at least in part, through the activation of autophagy pathways.

Figure 5.

GlcN attenuates HFD–induced hepatic steatosis via autophagy induction in mice. Mice were fed an HFD for 12 weeks, with or without 10% GlcN supplementation in the drinking water. (A, B) Body weight and liver weight were measured at the end of the 12‐week feeding period. (C) Representative gross images of harvested livers from each group. (D) Representative H&E–stained liver sections showing histological features of steatosis and hepatocyte morphology. (E) Representative images of ORO‐stained liver sections showing hepatic lipid accumulation. (F) Relative mRNA expression of LC3 and p62 was measured by qRT‐PCR and normalized to GAPDH. (G) Western blot analysis of LC3 and p62 protein levels. Quantification was expressed as the LC3‐II/LC3‐I and p62/β‐actin ratios. (H) Representative immunofluorescence images of liver sections stained for LC3 (green) and DAPI (blue). Quantification of LC3⁺ puncta per cell is shown in the adjacent graph. Scale bar = 5 μm. Data are expressed as mean ± SEM. Statistical analysis was performed using one‐way ANOVA followed by the Benjamini, Krieger, and Yekutieli two‐stage linear step‐up procedure for multiple comparisons (**p < 0.01, ***p < 0.001 vs. WT, ^# p < 0.05, ^## p < 0.01, ^### p < 0.001 vs. HFD).

4. Discussion

This study demonstrates that GlcN activates autophagy in hepatocytes and thereby mitigates hepatic lipid accumulation, highlighting autophagy as a key mechanism underlying GlcN‐mediated protection against NAFLD. While the autophagy‐inducing properties of GlcN have been described in other tissues and cell types [23, 24, 25], its specific role in hepatic autophagy and NAFLD pathogenesis has remained unclear.

In human HepG2 hepatocytes, GlcN induced autophagy in a dose‐ and time‐dependent manner, as evidenced by increased expression of autophagy markers such as LC3 and p62 and enhanced autophagosome formation. Notably, the subsequent decline in p62 protein levels and autophagosome numbers at 24 h indicated not only autophagosome initiation but also their effective degradation through lysosomal fusion, consistent with restoration of autophagic flux. These in vitro findings were substantiated in vivo using a high‐fat diet–induced NAFLD mouse model, where GlcN treatment promoted hepatic autophagosome formation and significantly attenuated steatotic changes. Collectively, these results suggest that GlcN alleviates hepatic lipid accumulation primarily by enhancing autophagy and restoring autophagic flux.

Compared to classical autophagy inducers such as rapamycin and lithium, which rapidly activate autophagy within minutes to a few hours by directly targeting key regulatory enzymes—such as mTOR kinase or inositol monophosphatase [26, 27] — GlcN appears to induce autophagy with a distinctly delayed kinetic profile. In our hepatocyte experiments, significant upregulation of LC3 and p62 and peak autophagosome formation were not observed until 12–24 h after GlcN treatment, in sharp contrast to the rapid autophagy initiation triggered by rapamycin within minutes to hours. This temporal delay suggests that GlcN acts through a fundamentally different mechanism. Rather than acutely targeting autophagy‐suppressive kinases, GlcN appears to regulate autophagy at the transcriptional level, requiring activation of upstream transcription factors, subsequent gene expression, protein synthesis, and assembly of autophagic machinery. Consistent with this notion, previous studies have shown that GlcN enhances O‐GlcNAcylation via the hexosamine biosynthetic pathway, which in turn modulates transcription factors such as FoxO, known to promote autophagy gene expression [28, 29, 30]. Collectively, these findings indicate that GlcN elicits a transcriptionally driven and temporally delayed autophagic response, distinguishing it from the immediate, enzyme‐targeted actions of classical autophagy inducers. GlcN may therefore represent a unique class of metabolic autophagy modulators that act through nutrient‐sensing and gene regulatory pathways.

Notably, our previous studies revealed a diet‐dependent duality in the metabolic effects of GlcN on hepatic lipid accumulation. Under normal dietary conditions, GlcN paradoxically increased lipid storage in hepatocytes, whereas under HFD conditions, it significantly reduced hepatic lipid accumulation [21]. This divergent response underscores the context‐dependent nature of GlcN's metabolic actions and reflects the complexity of its regulatory mechanisms. One plausible explanation for this duality lies in the distinct metabolic environments between normonutrition and HFD‐induced metabolic stress. Under normal dietary conditions, where glucose and lipid levels are balanced, GlcN‐induced O‐GlcNAcylation may preferentially activate lipogenic or anabolic pathways, thereby enhancing lipid synthesis or storage. In contrast, under HFD conditions—characterized by lipid overload and insulin resistance—GlcN appears to promote autophagy‐mediated lipid degradation, as demonstrated in the current study. This switch may be driven by differential regulation of nutrient‐sensitive signaling pathways such as the HBP, FoxO transcription factors, and mTOR signaling, all of which are known to integrate metabolic cues and influence lipid homeostasis. For example, under lipotoxic conditions, GlcN‐mediated O‐GlcNAcylation may enhance the transcriptional activity of autophagy‐related genes via FoxO, facilitating lipophagy and reducing steatosis. Conversely, in nutrient‐replete states, the same modification may reinforce anabolic signaling, promoting lipid accumulation. Additionally, the O‐GlcNAcylation status of key transcription factors may be differentially regulated depending on glucose availability, further contributing to the metabolic specificity of GlcN's effects. Understanding this dichotomous behavior is essential for therapeutic translation, as it highlights the importance of metabolic context in determining GlcN's efficacy.

Although the present study did not directly examine the molecular mechanisms connecting the HBP to autophagy, several candidate signaling pathways warrant further investigation. Among them, the FoxO family of transcription factors—well‐established regulators of autophagy‐related gene expression [31, 32] —has been shown to undergo O‐GlcNAcylation, a post‐translational modification enhanced by GlcN and HBP activity [28, 29, 33]. This modification has been reported to alter FoxO transcriptional activity, suggesting a potential mechanism by which GlcN may promote autophagy via FoxO‐mediated transcriptional activation. In addition, the mechanistic mTOR pathway, a central nutrient‐sensing hub that negatively regulates autophagy, may also be influenced by HBP activity [34]. Specifically, O‐GlcNAcylation of Raptor, an essential component of the mTORC1 complex, has been shown to modulate mTORC1 signaling and autophagy suppression [35, 36, 37]. These observations raise the possibility that GlcN‐induced changes in O‐GlcNAcylation status could indirectly relieve mTOR‐mediated inhibition of autophagy. These observations support a plausible model in which GlcN enhances autophagy via O‐GlcNAc‐dependent modulation of transcriptional and nutrient‐sensing pathways, including FoxO and mTOR. Future studies employing genetic and pharmacological approaches will be necessary to define the specific signaling axes involved. In addition, the specific O‐GlcNAc‐modified proteins responsible for GlcN‐induced autophagy have not yet been identified. Future studies employing immunoprecipitation and proteomic analyses will be necessary to define the downstream targets linking O‐GlcNAcylation to autophagy regulation in hepatocytes. Although multiple complementary approaches were used to assess autophagic activity, the downstream molecular targets through which O‐GlcNAcylation promotes GlcN‐induced autophagy and lipophagy remain to be identified.

In summary, our findings provide the first evidence that GlcN modulates hepatic lipid metabolism by promoting autophagy, positioning it as a promising candidate for the integrated treatment of NAFLD and related metabolic disorders. Nonetheless, several important issues remain to be addressed. First, the precise molecular mechanisms connecting GlcN to autophagy, particularly through nutrient‐sensing pathways, require further clarification. Second, the use of HepG2 cells, while experimentally convenient, limits translational relevance due to their transformed nature. Third, in vivo mechanistic studies are needed to validate GlcN's role in regulating hepatic autophagy under physiological and pathological conditions. Although GlcN improved glucose tolerance and insulin sensitivity in HFD‐fed mice, previous studies have suggested that sustained elevation of O‐GlcNAcylation may promote pancreatic β‐cell dysfunction and contribute to diabetic complications under certain conditions [38, 39, 40]. Therefore, the long‐term metabolic effects and safety of glucosamine‐induced O‐GlcNAcylation require further investigation. Future research should focus on dissecting upstream signaling using primary hepatocytes and genetically engineered models, as well as evaluating the long‐term efficacy and safety of GlcN under diverse nutritional states. Addressing these questions will be critical for advancing GlcN toward clinical application in metabolic liver disease.

Author Contributions

Jiwon Park: conceptualization, methodology, software, data curation, formal analysis, validation, investigation, writing – original draft. Dong Yeol Kim: methodology, software, data curation, investigation, validation, formal analysis, project administration, writing – original draft. Quynh T. N. Nguyen: formal analysis, investigation, methodology. Inn‐Oc Han: conceptualization, methodology, software, data curation, formal analysis, supervision, resources, project administration, funding acquisition, writing – original draft, writing – review and editing.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Figure S1: GlcN enhances autophagic flux in HepG2 cells. Western blot analysis of LC3 and p62 protein levels in HepG2 cells treated with increasing concentrations of GlcN in the presence of bafilomycin A1 (10 nM) for 24 h. Data are expressed as mean ± SEM. Statistical analysis was performed using one‐way ANOVA followed by the Benjamini, Krieger, and Yekutieli two‐stage linear step‐up procedure for multiple comparisons (*p < 0.05, **p < 0.01, ***p < 0.001 vs. Baf A1 only).

Figure S2: GlcN promotes the association of autophagosomes with lipid droplets in HepG2 cells. HepG2 cells were treated with PA in the absence or presence of GlcN. Cells were stained for LC3 (red) and neutral lipid droplets using BODIPY (green), and nuclei were counterstained with DAPI (blue). Quantification of LC3/BODIPY co‐localization is shown in the adjacent graph. Scale bar = 5 μm. Data are presented as mean ± SEM. Statistical significance was determined using one‐way ANOVA followed by the Benjamini, Krieger, and Yekutieli two‐stage linear step‐up procedure for multiple comparisons (***p < 0.001 vs. CTL, ^### p < 0.001 vs. PA).

Figure S3: GlcN differentially regulates lipid accumulation under low‐ and high‐glucose conditions in HepG2 cells. HepG2 cells were cultured for 24 h in either low‐glucose (5 mM) or high‐glucose (25 mM) media and treated with increasing concentrations of GlcN (0, 2, 4, and 8 mM). Representative light microscopy images show ORO staining of intracellular lipids 24 h after GlcN treatment. Quantification of lipid accumulation was performed by measuring ORO intensity and normalizing to cell viability to account for differences in cell number. Data are presented as mean ± SEM. Statistical significance was assessed using one‐way ANOVA followed by the Benjamini, Krieger, and Yekutieli two‐stage linear step‐up procedure for multiple comparisons (^### p < 0.001 vs. 0 mM GlcN in 25 mM glucose medium).

Figure S4: Effects of GlcN on glucose tolerance and insulin responsiveness in HFD‐fed mice. Mice were fed a control diet or HFD for 12 weeks, with or without GlcN supplementation. (A) ITT was performed to assess systemic insulin responsiveness. Blood glucose levels were measured at the indicated time points following insulin administration. (B) GTT was performed to evaluate glucose homeostasis. Blood glucose levels were measured at the indicated time points following glucose administration. Data are expressed as mean ± SEM. Statistical analysis was performed using one‐way ANOVA followed by the Benjamini, Krieger, and Yekutieli two‐stage linear step‐up procedure for multiple comparisons (*p < 0.05, **p < 0.01, ***p < 0.001 vs. WT, ^# p < 0.05, ^## p < 0.01, ^### p < 0.001 vs. HFD+GlcN).

Park J., Kim D. Y., Nguyen Q. T. N., and Han I.‐O., “Glucosamine Promotes Autophagy and Attenuates Hepatic Steatosis Via O‐GlcNAcylation–Mediated Mechanisms,” Journal of Biochemical and Molecular Toxicology 40 (2026): e71042, 10.1002/jbt.71042.

Data Availability Statement

The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.