Skip to main content
Springer logoLink to Springer
. 2025 Nov 29;40(4):1301–1317. doi: 10.1007/s10557-025-07816-9

RELM-β Augmented Hypoxia-Induced Pulmonary Hypertension Through Interacting with GIPC1, OR1N1 and CLIC4

Chunlong Lin 1,✉, Shoushuo Fu 1, Huang Li 1, Yan Zhang 1, Xiaohui Li 1, Lun Li 1, Qilong Ge 1, Rui Li 1
PMCID: PMC13388652  PMID: 41317264

Abstract

Purpose

Pulmonary hypertension (PH) is a clinicopathological syndrome characterized by structural and functional alterations in the pulmonary vasculature arising from heterogeneous etiologies (including hypoxia) and diverse pathogenic mechanisms. These changes elevate pulmonary vascular resistance and increase pulmonary arterial pressure, ultimately progressing to right heart failure and potential fatality. Resistin-like molecule (RELM)-β activates multiple signaling pathways. This study aimed to explore the role of RELM-β in the development of chronic hypoxia-induced PH and its potential mechanisms.

Methods

Exogenous human RELM-β was injected into a mouse model of hypoxia for 3 weeks, followed by histological and hemodynamic analyses. The relationship between RELM-β and membrane proteins or receptors (OR1N1, GIPC1 and CLIC4) was determined by affinity purification-mass spectrometry (AP-MS) and co-immunoprecipitation. At the same time, in vitro cell culture experiments were carried out.

Results

Cell membrane proteins or receptors (OR1N1, GIPC1, and CLIC4) were identified as proteins interacting with RELM-β and potentially involving in the development of PH. Compared with the RELM-β overexpression group, siRNA-mediated silencing of OR1N1, GIPC1, or CLIC4 resulted in significant reduction of cell viability in both human pulmonary artery smooth muscle cells (PASMCs) and human pulmonary arterial endothelial cells (PAECs). Moreover, augmenting effect of exogenous RELM-ß on the hypoxia-induced PH was remarkably reduced in the mice with genetic deficiency of GIPC1 (GIPC1 CKO) or CLIC4 (CLIC4 CKO) compared to the wild type mice.

Conclusions

Findings of the current study suggested that RELM-β may play an important role in the development of hypoxia-induced PH through interacting with membrane proteins or receptors, including GIPC1, OR1N1, and CLIC4.

Graphical Abstract

graphic file with name 10557_2025_7816_Figa_HTML.jpg

Keywords: PH, RELM-β, Membrane protein receptor, Vascular remodeling, Pulmonary arterial hypertension

Introduction

Pulmonary hypertension (PH) is a common and serious complication of chronic lung disease. Hypoxia contributes to the morbidity and mortality of patients with various types of lung/heart diseases including PH [1, 2]. The prevailing pathogenetic feature of hypoxia-induced PH include hypoxic vasoconstriction, parenchymal lung and vascular bed destruction, vascular remodeling and inflammation through excessive aberrant PAECs and PASMCs proliferation [3–5]. The pathological hyperproliferation of pulmonary arterial smooth muscle cells (PASMCs) and pulmonary arterial endothelial cells (PAECs) constitutes a central mechanism driving the development and progression of PH. Due to the lack of efficient diagnosis and treatment for PH, currently, improving the quality of life in PH patients is still a mainstream of the treatment. In this regard, all PH-targeting medicines, including phosphodiesterase type 5 inhibitors, soluble guanylate cyclase stimulators, prostacyclin analogs, prostacyclin receptor agonists, and endothelin receptors antagonists, are acting on pulmonary vasoconstriction rather than vascular tissue remodeling, and thus, none of these medicines can cure or reverse PH progression [6]. It is therefore important to find drugs or molecules targeting vascular remodeling to attenuate progression of PH.

The family of resistin-like molecule (RELM) includes RELM-α, RELM-β, resistin and RELM-γ. Of them, RELM-β and resistin are expressed in humans [7], while RELM-α is considered as hypoxia-induced mitogenic factor (HIMF) in rodents. Human RELM-β is the strongest homologous to rodent HIMF. In rat, HIMF was induced by hypoxia only in the lung, which had angiogenic and vasoconstrictive properties, and induced the proliferation of microvascular smooth muscle cells and strongly constricted the pulmonary vasculature [8]. It was also demonstrated that RELM-β was up-regulated in the lung tissue of patients with PH and stimulated proliferation of the cultured primary human pulmonary endothelial cells as well as smooth muscle cells [9], suggesting RELM-β play a potentially important role in the pathogenesis of PH.

Multiple signaling pathways have been reported to be involved in mediating the effect of RELM-β on vascular remodeling in the pathogenesis of PH. In this regard, in vitro experiments demonstrated that HIMF enhanced angiogenesis by promoting proliferation and migration of mouse endothelial cells via activation of the PI-3 K/Akt pathways [10]. In addition, RELM-β initiated intracellular Ca2+ release via the PLC-IP3 pathway to constrict the pulmonary circulation and induce mitogenesis of pulmonary vascular smooth muscle cells [11].

Focal adhesion kinase (FAK) plays a key role in the proliferation of pulmonary artery smooth muscle cells [12], which may be related to promoting the JNK and CD2 signaling pathways, and to inhibiting cell apoptosis through Caspase-3 inhibition [13]. We have previously demonstrated that FAK mediated the expression of survivin and played a key role in RELM-β-induced proliferation of pulmonary artery smooth muscle cells [14]. HIF-1α has been demonstrated to be a crucial regulatory factor in the proliferation of endothelial cells in pulmonary arterial hypertension [15, 16]. More importantly, Johns and colleagues found that HIF-1α was also involved in RELM-β-mediated hypoxic pulmonary hypertension [17]. However, role of RELM-ß in the development of hypoxia-induced PH and its mechanisms remains to be defined.

GAIP Interacting Protein C-terminus (GIPC) PDZ domain containing family, member 1 (GIPC1) is a scaffolding protein that regulates cell surface receptor expression and trafficking. GIPC1 has been demonstrated to regulate cell membrane receptors and participates in FAK modulation [18]. Olfactory Receptor Family 1 Subfamily N Member 1 (OR1N1), belongs to the G protein-coupled receptor (GPCR) family, and no prior study has been specifically addressed its biological roles. However, relevant studies have shown that Olfactory Receptor 2 in vascular macrophages drives atherosclerosis via NLRP3-dependent IL-1 production [19]. Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Previous studies have established CLIC4 as a key molecule implicated in endothelial barrier dysfunction in pulmonary hypertension [20].

The current study was designed to explore the proteins, including GIPC1, OR1N1, and CLIC4, that interact with RELM-β in promoting excessive vascular remodeling and to investigate the underlying downstream signaling pathways that potentially involve in the hypoxia-induced vascular remodeling.

Materials and Methods

Hypoxia‑Induced PH Model

All animal procedures performed in this study were approved by Ethics Committee of Hunan Normal University. Six-week-old Male C57/B6 mice, weighing 20–25 g, was purchased from Shanghai Laboratory Animal Center (SLAC). Sma-CreERT2, GIPC1f/f C57/B6 mice and Cdh5-CreERT2, and CLIC4f/f C57/B6 mice were successfully created in the investigators’ lab. The animals were maintained in specific pathogen-free conditions, and a standard laboratory diet was available ad libitum. The animals were randomly assigned to the groups of Control (21% O2), hypoxia + PBS, and hypoxia + RELM-β. Hypoxia mice were exposed to normobaric hypoxia (10% O2 and 5% CO2 environment) in a ventilated hypoxia chamber for three weeks as described in the previous report [21].

Based on previous literature with adjustments for our experimental protocol [22], recombinant human RELM-β (rhRELM-β, Peprotech, # 450 − 22) was administered at a dose of 100 ng/g (in 20 µL of PBS) via tail vein injection once every three days for three weeks, starting from the initiation of the hypoxia exposure. The dosing regimen was designed to account for the model duration and variations in individual mouse body weights. An equal volume of PBS was administered as a vehicle control via the same route and on the same schedule.

According to established literature [21, 23], mice were anesthetized with an i.p. injection of pentobarbital sodium (40 mg/kg) followed by the procedures of right ventricular systolic pressure (RVSP) measurement. Anesthesia was confirmed by loss of pedal reflex. Humane endpoints included > 20% weight loss or labored breathing. RVSP was measured via right heart catheterization under anesthesia. and collection of heart tissues. The index of right ventricular hypertrophy (RVHI) was assessed based on the left/right ventricular weight ratio (RS/LV + S).

Histopathology of the Lung Tissues

Following 3-week hypoxic exposure, mice were euthanized by cervical dislocation with subsequent harvesting of lung tissues. Lung tissues were subjected to histopathological analysis. Briefly, the lung tissues were fixed with 4% paraformaldehyde (PFA), embedded in paraffin, and stained with hematoxylin-eosin (HE). Images of the HE staining at 200× magnification were obtained and percent media thickness (% MT) of pulmonary arterioles (the diameter of the vessels was up to 100 micrometers) were measured following the previously published method [22, 24].

Cell Culture

MRC-5 line (registration number: CCL-171) was purchased from iCell Bioscience (ATCC, Manassas, VA, USA) and cultured in 10% FBS-MEM. Immortalized human pulmonary artery endothelial cells (PAEC) (registration number: iCell-0015a) and PASMC (registration number: iCell-009a) were purchased from iCell Bioscience (Shanghai, China) and cultured in PriMed-iCell-002 medium (iCell Bioscience). All cells were incubated in 37 °C cell culture incubator with 5% CO2.

TUNEL and EdU Assay

Apoptosis of the cells in the lung tissue was assessed by TUNEL staining following the manufacturer’s instruction (In-situ Cell Death Detection kit, Roche). Briefly, lung tissues were fixed with 4% paraformaldehyde solution at room temperature followed by permeabilization with 0.1% Triton X-100 in PBS for 5 min at 4 °C. After washing with PBS, the lung tissues were incubated with TUNEL reagent (containing 10% terminal deoxynucleotidyl transferase and 2% fluorescent isothiocyanate-dUTP) for 1 h at 37 °C. Cellular nuclei were then stained with DAPI for 30 min at room temperature. The lung tissues were sequestered with anti-fluorescence quencher and the number of TUNEL-positive cells and apoptotic bodies were determined under fluorescence microscope using a detection wavelength in the range of 515–565 nm (green).

The Cell-Light EdU Apollo488 In Vitro Kit (C10310-3, Ribobio) was used to assess the proliferation of cells following the manufacturer’s instruction. Briefly, after deparaffinization and rehydration, the slides were treated with 3% H2O2 for 20 min followed by metamorphosing in boiling citric acid (10 mM, pH 6.0) for 15 min. After blocking with 5% BSA for 30 min at room temperature, the tissues were treated with 1× Apollo488 overnight at 4 °C. Next day, after washing with PBS, nuclei were stained with 1× Hoechst33342 before analyzing the proliferation.

Immunofluorescence Staining

Lung tissues were fixed with 4% PFA, permeabilized with 0.1% Triton X-100 in PBS for 10 min and blocked with 1% BSA at room temperature for 1 h. Tissues were then incubated with primary antibody overnight at 4 °C. Next day, after washing, corresponding secondary antibodies were applied at room temperature for 2 h followed by staining with DAPI. After sealing with an anti-fluorescence quencher, images of the immunostaining were observed and photographed under a fluorescence microscope (Olympus IX51).

Construction and Transfection of the Plasmids

The C-terminus of the open reading frame sequence of the RELM-β gene was fused with HA tag and cloned between the EcoRI and BamHI restriction sites of the pCDH-CMV-MCS-EF1-GFP + Puro vector. The C-terminus of the open reading frame sequence of the OR1N1 gene was fused with Flag tag and cloned between the EcoRI and BamHI restriction sites of the pCDH-CMV-MCS-EF1-GFP + Puro vector. The C-terminus of the open reading frame sequence of the CLIC4 gene was fused with Flag tag and cloned between the EcoRI and XhoI restriction sites of the pCDH-CMV-MCS-EF1-GFP + Puro vector. The C-terminus of the open reading frame sequence of the GIPC1 gene was fused with Myc tag and cloned between the EcoRI and BamHI restriction sites of the pCDH-CMV-MCS-EF1-GFP + Puro vector. Plasmids containing target cDNA sequences were constructed by The Yazai Biotechnology Co Ltd (Shanghai, China). Plasmids (500 ng/well or 1 µg/well) were transfected into the cells using Lipofectamine™3000 Transfection Reagent (Beyotime Biotechnology, Shanghai, China), and empty plasmid (500 ng/well) was used as a negative control.

Transfection of siRNA

Transfection of small interfering RNAs (siRNAs) was performed using the reverse-transfection method following the protocol of the Lipofectamine™ 3000 Reagent. Briefly, for one well of a 6-well plate, 75 pmol of siRNA was mixed with 7.5 µL of the Lipofectamine®3000 Reagent in 250 µL of Opti-MEM™ Medium following the manufacturer’s instruction. The mixture was then suspended with 2 mL of medium applied to the cells (2 mL/well). Seventy-two hours later, the medium was replaced. The sequences of the siRNAs used in this study were shown in Table 1.

Table 1.

The sequences of small interfering RNA (siRNA)

SiRNA Sense sequence (5′−3′)
GIPC1 GAGAGTTACATGGGTATCAGGGACA
OR1N1 CCTGTGTATGTATCTTGTCACCTTG
FAK GCTCTTGGTTCAAGCTGGATTATTT
CLIC4 CCCAGAGGCTCTTCATGATTCTTTG
RELM-β CCGTTATGGATAAGAAGATCAAGGA
HIF-1a CACCTATGACCTGCTTGGTGCTGAT
NF-κB CAGATACAGACGATCGTCACCGGAT

Immunoblotting

Total proteins were extracted with RIPA lysis buffer containing PIC, and protein concentration was measured using the bicinchoninic acid (BCA) assay (Beyotime, Biotechnology, Shanghai, China). The proteins were separated by 8% SDS-PAGE and transferred to PVDF membranes (Millipore, MA, USA), and incubated with the primary antibodies at 4 °C overnight followed by incubation with corresponding secondary antibodies for 1 h at room temperature. Protein bands were detected by Chemiluminescence (ECL) reagents. The intensity of the bands was quantified using ImageJ software (National Institutes of Health, Maryland, USA).

Affinity Purification- Mass Spectrometry

The specific proteins interacting with RELM-β (RETNLB) were identified through affinity purification - mass spectrometry (AP-MS) analysis of immunoprecipitated HA-RELM-β. The interactions among these specific proteins were obtained by searching the STRING (v12.0) database. Additionally, the proteins interacting with RELM-β (RETNLB), that is, GIPC1, OR1N1, and CLIC4 were retrieved from the BIOGRID database (v4.4). This interaction information was then input into Cytoscape (v3.9.1) to create an integrated protein-protein interaction network. The resulting node proteins were further analyzed using PantherDB (v19.0). Enrichment analysis for GO molecular function and Reactome pathway categories was performed against a human expression reference using Fisher’s Exact Test followed by False Discovery Rate (FDR) correction. An FDR value of < 0.05 was considered statistically significant.

Co-immunoprecipitation (co-IP)

After 48 h transfection, total proteins were extracted from MRC-5 cells with RIPA lysis buffer containing protease inhibitor cocktail (PIC). Protein concentration was measured using the bicinchoninic acid (BCA) assay (Beyotime Biotechnology, Shanghai, China). Total 1 mg cell lysate proteins were incubated with 1 µg of antibody at 4 °C for 1 h, with gentle rotation. After centrifugation, supernatants were incubated with protein beads (Life Technologies) at 4 °C overnight. The immunoprecipitated samples were separated by SDS-PAGE for immunoblotting.

Reverse Transcription and Quantitative Polymerase Chain Reaction (RT-qPCR) Assay

Total RNA was extracted from the cells by Trizol reagent (Sigma-Aldrich, St Louis, Missouri) and reverse transcript into cDNA with PrimeScript™ RT Master Mix (Takara, Dalian, China) following the manufacturer’s instruction. The cDNA was used as template for gene quantification by qPCR using SYBR® Premix Ex Taq™ (Takara, Dalian, China) following the manufacturer’s protocol. EF-1a and RPLP0 were used as internal control, and relative transcription level was calculated and expressed as 2-∆∆ct. The primer sequences used in this study were listed in Table 2, which were synthesized by Genecreate Biological Engineering Co., Ltd. (Wuhan, China).

Table 2.

RT-qPCR primer sequence

Target gene Forward (5’−3’) Reverse (5’−3’)
H-ACTIN GTCCACCGCAAATGCTTCTA TGCTGTCACCTTCACCGTTC
H-FAK TACACCATGCCCTCAACCAG TCAAACTGACGCATTGTTAAGG
H-GIPC1 ACTGCCGAGGTGATGTTCTG GTGATGGTGAGCCCGAGTG
H-OR1N1 TCACGCAAATGTATTTCTTTCTGAT TGTCACAGAAAAAGTGAGCAATTTC
H-RELM-β CAGAGATCTAAGCTGCTTTCCATCT CACGAGAGCTTCTTGCTTATAGGAG
H- CLIC4 GCTAATGAAGCACTGGAGAGG TTGACAATATGCAGTTTGGGC

Cell Viability Assay by Cell Counting kit-8 (CCK8)

The cytotoxicity was determined using the CCK-8 assay (Beyotime, Biotechnology, Shanghai, China). Briefly, cells were seeded into 96-well plates with 10,000 cells/well and cultured for 24 h. Next day, the medium was removed and 100µL aliquots containing the reagent were added. At 24-hour time points, 10µL CCK-8 solution was added to each well and incubated for additional 1 h. The absorption intensity of each well was measured at 450 nm. Cell survival rate (%) = [(Cd experimental group - blank group)/(control group - blank group)] ×100%.

Statistical Analysis

Statistical analysis was performed with GraphPad Prism 9 statistical software (GraphPad, San Diego, CA, USA). For comparisons involving three or more groups, one-way ANOVA or two-way ANOVA was used as appropriate to compare the mean responses between the experimental and control groups. Each value corresponded to the mean ± SD of three independent experiments. Significance was defined as * p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, and ns = no significant difference. Data represent mean ± SD of ≥ 3 independent experiments.

Results

RELM-β Augmented Chronic Hypoxia-Induced Pulmonary Hypertension in Mice by Modulating Tissue Remodeling and Cell Proliferation

To verify the role of RELM-β in hypoxia-induced pulmonary hypertension, we established a mouse model of hypoxia-induced pulmonary hypertension and administered recombinant human RELM-β (rhRELM-β) protein via tail vein injection. The specific experimental protocol was shown in Fig. 1A. Recombinant human RELM-β (100 ng/g) was injected at the beginning of hypoxia treatment, and then once every 3 days. Twenty-one days after the experiment, before the mice were sacrificed, we evaluated the pulmonary circulatory hemodynamics of the mice [25]. Furthermore, we assessed the morphology of pulmonary arteries in lung tissues as well as the proliferation of pulmonary artery smooth muscle cells and endothelial cells.

Fig. 1.

Fig. 1

RELM-β augmented chronic hypoxia-induced PH.Panel A: Demographic illustration of hypoxia-induced PH animal model preparation. Panel B: Representative images of HE-stained lung tissues from three groups. Magnification: 200×. Panels C-D: Comparison of RVHI and RVSP among the three groups. Horizontal axes: group of animal model; vertical axes: RVHI (%) or RSVP (mmHg). Data presented were means ± SD, n = 3 for each group, **p < 0.01, ***p < 0.001 and ****p < 0.0001. Panel E: Morphometric analysis of mouse pulmonary arterioles from the mouse models. Data presented were means ± SD, n = 3 for each group, **p < 0.01, ***p < 0.001 and ****p < 0.0001. Panel F: Comparison of TUNEL staining in the lung tissues from the animal models. Panel G: Comparison of EdU staining in the lung tissues from the animal models. RELM-ß: resistin-like molecule-ß; RVHI: index of right ventricular hypertrophy; RVSP: right ventricular systolic pressure; TUNEL: terminal deoxynucleotidyl transferase dUPT nick end labeling; a-SMA: a-smooth muscle actin

It was found that medial wall thickness of small and medium sized pulmonary arteries was remarkably but not significantly increased in the mice exposed to hypoxia (p = 0.062 in small and p = 0.078 in medium sized arteries, respectively), which was further significantly augmented by the exogenous human RELM-ß in the mice exposed to hypoxia (p < 0.05, Fig. 1B and E). Moreover, the index of right ventricular hypertrophy (RVHI) and right ventricular systolic pressure (RVSP) were significantly increased in the mice exposed to chronic hypoxia (p < 0.01), which were also further significantly increased in the mice treated with hypoxia plus RELM-ß (p < 0.001, Fig. 1C and D, respectively).

Since pulmonary vascular remodeling in response to chronic hypoxia is principally associated with the excessive proliferation of smooth muscle cells and endothelial cells, role of RELM-β in modulating cell survival and proliferation was assessed by immunostaining of the lung tissues. TUNEL assay plus immunostaining of a-smooth muscle actin (a-SMA, a biomarker for smooth muscle cells) or CD31 (a biomarker for endothelial cells) indicated that few cells underwent apoptosis (green, Fig. 1F) in the control mice as well as in model of hypoxia-induced PH with or without RELM-ß treatment, which was not remarkably different among the three groups (Fig. 1F). In contrast, EdU incorporation assay showed that EdU incorporation (green, Fig. 1G) was slightly increased in the mice exposed to chronic hypoxia in comparison with the control mice, which was dramatically increased in the mice exposed to chronic hypoxia plus RELM-ß injections (green, Fig. 1G).

OR1N1, CLIC4 and GIPC1 Were Identified as Bona Fide RELM-β-Interacting Proteins

Because the proteins or molecules that bind to RELM-ß were unclear, affinity purification mass spectrometry (AP-MS) was performed to identify the potential RELM-β-interacting proteins in MRC-5 cells. As shown in the Fig. 2A and B, it was found that Olfactory Receptor Family 1 Subfamily N Member 1 (OR1N1) was the only G protein-coupled receptor (GPCR) that specifically bound to RELM-β protein. In addition, further analysis of the AP-MS data indicated that scaffolding protein OR1N1, GAIP Interacting Protein C-terminus (GIPC) PDZ domain containing family member 1 (GIPC1), and Chloride intracellular channel 4 (CLIC4) were significantly enriched candidate proteins associated with RELM-β (highlighted in red frames in Fig. 2B). To examine potential interactions between RELM-1ß and the identified candidate proteins, a protein-protein interaction network involving RELM-β (RETNLB), GIPC1, OR1N1, and CLIC4 was constructed by using Cytoscape as well as integrating our mass spectrometry (MS) data with a database (Fig. 2C). In addition, since studies have shown that TP53 plays a crucial role in the development of pulmonary arterial hypertension, potential involvement of these candidate proteins in the TP53 pathway was also explored (Fig. 2D and E). Furthermore, interaction of these candidate proteins with RELM-ß was further validated by co-immunoprecipitation assay (Fig. 2F) and quantification of GIPC1, OR1N1 and CLIC4 mRNAs in the lung tissues of hypoxia-induced PH mice models (Fig. 2G). As shown in the Fig. 2G, mRNA expressions of GIPC1, OR1N1, and CLIC4 were significantly up-regulated in the PH mice model compared to control mice (p < 0.0001), which was further significantly augmented by the injection of RELM-ß into the hypoxia-induced PH mice models (p < 0.0001).

Fig. 2.

Fig. 2

CLIC4, OR1N1 and GIPC1 were bona fide RELM-β-interacting proteins Panels A & B: Verification of the RELM-β receptors and interacting proteins by affinity purification-mass spectroscopy (AP-MS). Panel C: The protein-protein interaction network involving RELM-β (RETNLB), GIPC1, OR1N1, and CLIC4. Panel D & E: Identification of the top 15 enriched proteins, which potentially interact with RELM-β (RETNLB), GIPC1, OR1N1, and CLIC4, in the GO molecular function categories and reactome pathway categories. Panel F: Co-immunoprecipitation assay. MRC5 cells were treated with 5µM of RELM-β−3×HA vector (lane 1), OR1N1-3×FLAG vector (lane 2), RELM-β−3×HA vector + OR1N1-3×FLAG vector (lane 3), GIPC1-6×Myc (lane 4) or RELM-β−3×HA vector + GIPC1-6×MYC (lane 5) for 24 h. Cell lysates were subjected to immunoprecipitation (IP) with anti-HA and immunoblotting (IB) with anti-Flag, anti-Myc, or anti-ß-actin antibodies. MRC5 cells also were treated with 5µM of RELM-β−3×HA vector (lane 1), CLIC4-3×FLAG vector (lane 2) or RELM-β−3×HA vector + CLIC4-3×FLAG vector (lane 3) for 24 h. Cell lysates were subjected to immunoprecipitation (IP) with anti-HA and immunoblotting (IB) with anti-Flag or anti-ß-actin antibodies. Panels G: Expression of GIPC1, OR1N1, and CLIC4 mRNA in the lung of animal models. Horizontal axes: animals treated with hypoxia ± RLEM-ß; vertical axes: relative mRNA levels of GIPC1 (panel E), OR1N1 (panel F), and CLIC4 (panel G) expressed as fold change. All data are presented as means ± SD. n = 3 for each group, ***p < 0.001 and ****p < 0.0001. RELM-ß: resistin-like molecule-ß; OR1N1: Olfactory receptor family 1 subfamily N member 1; GIPC1: GAIP interacting protein C-terminus (GIPC) PDZ domain containing family member 1; CLIC4: Chloride intracellular channel 4

GIPC1/OR1N1 Mediated RELM-β-induced FAK Expression and Regulation of PASMC Proliferation

Previous studies in the Investigator’s laboratory had demonstrated that FAK/survivin mediated RELM-β-induced pulmonary artery smooth muscle cell (PASMC) proliferation [14]. The GIPC1 protein, functioning as a PDZ domain scaffold, plays a critical role in the regulation of receptor trafficking and stabilization [18], including the expression of FAK [18]. Therefore, we hypothesized that RELM-β may mediate FAK expression via GIPC1/OR1N1 and by which mechanism, it may regulate the proliferation of PASMCs. To test this, first, we determined GIPC1/OR1N1 expression by RT-qPCR in the PASMCs overexpressing RELM-β and found that mRNA expression of GIPC1 and OR1N1 were significantly up-regulated in the PASMCs with overexpress of RELM-β, which was significantly suppressed by the target specific siRNAs (p < 0.0001, Fig. 3A and B). Moreover, FAK mRNA expression was significantly up-regulated in the PASMCs that overexpressing RELM-β compared with that of control cells, which was partially but significantly blocked in the cells simultaneously transfected with specific siRNAs targeting GIPC1 or OR1N1 (p < 0.0001, Fig. 3C).

Fig. 3.

Fig. 3

Role of GIPC1, OR1N1, and FAK in mediating RELM-β effect on PASMC proliferation and apoptosis. Panels A-C: Quantification of GIPC1, OR1N1, and FAK mRNAs in the PASMCs overexpressing RELM-β. Horizontal axes: co-transfection of plasmid of overexpressing RELM-ß and siRNAs targeting GIPC1, OR1N1, or FAK; vertical axes: relative mRNA level expressed as fold change. Panel D: Proliferation of PASMCs assessed by CCK-8 assay. Horizontal axes: co-transfection of plasmid of overexpressing RELM-ß and siRNAs targeting GIPC1, OR1N1, or FAK; vertical axes: cell number expressed by absolute OD value. Panel E: Apoptosis of the cells assessed by flow cytometry. Insert: Comparison of the apoptotic cells. Horizontal axis: co-transfection of plasmid of overexpressing RELM-ß and siRNAs targeting GIPC1, OR1N1, or FAK; vertical axis: number of apoptotic cells expressed as percentage (%). Data were presented as the mean ± SD of three independent experiments. Panel F: Cell cycle analysis by flow cytometry. Insert: Comparison of the cells at S-phase. Horizontal axis: co-transfection of plasmid of overexpressing RELM-ß and siRNAs targeting GIPC1, OR1N1, or FAK; vertical axis: proportion of the cells in S-phase expressed as percentage (%). Data were presented as the mean ± SD of three independent experiments. * p < 0.05, **p < 0.01, ***p < 0.001 and ****p < 0.0001. PASMC: pulmonary artery smooth muscle cell; OR1N1: Olfactory receptor family 1 subfamily N member 1; GIPC1: GAIP interacting protein C-terminus (GIPC) PDZ domain containing family member 1; FAK: focal adhesion kinase

Second, cell survival and apoptosis were assessed using CCK-8 assays and flow cytometry. It was found that absolute OD value of CCK-8 assay was significantly increased in the PASMCs transfected with RELM-β in comparison with non-transfected control cells or cells transfected with negative control plasmid (p < 0.0001, Fig. 3D), which was significantly blocked in the cells co-transfected with siRNAs targeting GIPC1, OR1N1, or FAK (p < 0.0001, Fig. 3D). In contrast, apoptosis assay by flow cytometry indicated that overexpression of RELM-β resulted in significant reduction in the percentage of apoptotic cells in the PASMCs (p < 0.0001, Fig. 3E), which was partially but significantly blocked by co-transfection of siRNAs targeting GIPC1, OR1N1, or FAK (p < 0.0001, Fig. 3E). Consistently, proportion of the cells in S phase was significantly higher in the cells overexpressing RELM-β compared to the control cells (p < 0.0001, Fig. 3F), which was also partially but significantly blocked in the cells co-transfected with siRNAs targeting GIPC1, OR1N1, or FAK, but not non-specific siRNA (p < 0.0001, Fig. 3F).

GIPC1/OR1N1 Mediated Hypoxia-Induced FAK Expression and its Regulation on Cell Proliferation

To determine whether GIPC1/OR1N1 mediate hypoxia-induced FAK expression and its regulation on cell proliferation, PASMCs cells were cultured under normoxic and hypoxic conditions. As expected, expression of RELM-β and FAK mRNA was significantly increased in the cells cultured under hypoxic condition compared to that of the cells maintained under normoxic condition (p < 0.0001, Fig. 4A and B, respectively). Furthermore, up-regulated expression of RELM-ß mRNA was not affected by the specific siRNAs targeting GIPC1, OR1N1, or FAK (Fig. 4A), while up-regulated expression of FAK mRNA was partially but significantly blocked by specific siRNAs targeting GIPC1or OR1N1 (p < 0.0001, Fig. 4B).

Fig. 4.

Fig. 4

Role of GIPC1, OR1N1, and FAK in regulating hypoxia effect on PASMC proliferation and apoptosis. Panels A & B: Quantification of RELM-ß mRNA (panel A) or FAK mRNA (panel B) in the PASMCs exposed to hypoxia. Horizontal axis: treatment of the cells following transfection of siRNAs targeting GIPC1, OR1N1, or FAK; vertical axes: relative mRNA expressed as fold change. Data were presented as the mean ± SD of three independent experiments. Panel C: Apoptosis of the cells assessed by flow cytometry. Insert: Comparison of the apoptotic cells. Horizontal axis: treatment of the cells following transfection of siRNAs targeting GIPC1, OR1N1, or FAK; vertical axis: number of apoptotic cells expressed as percentage (%). Data were presented as the mean ± SD of three independent experiments. Panel D: Cell cycle analysis by flow cytometry. Insert: Comparison of the cells at S-phase. Horizontal axis: treatment of the cells following transfection of siRNAs targeting GIPC1, OR1N1, or FAK; vertical axis: proportion of the cells in S-phase expressed as percentage (%). Data were presented as the mean ± SD of three independent experiments. * p < 0.05, **p < 0.01, ***p < 0.001 and ****p < 0.0001. PASMC: pulmonary artery smooth muscle cell; OR1N1: Olfactory receptor family 1 subfamily N member 1; GIPC1: GAIP interacting protein C-terminus (GIPC) PDZ domain containing family member 1; FAK: focal adhesion kinase

Under hypoxic condition, absolute OD value of CCK-8 assay was significantly increased in the PASMCs as determined by CCK8 assay (p < 0.0001, Fig. 4C), which was partially but significantly blocked by specific siRNAs targeting GIPC1, OR1N1, or FAK (p < 0.0001, Fig. 4C). Consistent with the findings in the cells overexpressing RELM-ß, apoptosis and cell cycle analysis by flow cytometry indicated that exposure to hypoxia resulted in significant reduction in the percentage of apoptotic cells in the PASMCs (p < 0.0001, Fig. 4D), which was partially but significantly blocked by co-transfection of siRNAs targeting GIPC1, OR1N1, or FAK (p < 0.0001, Fig. 4D). Proportion of the cells in S phase was significantly higher in the cells cultured under hypoxic condition compared to the control cells under normal oxygen concentration (p < 0.0001, Fig. 4E), which was also partially but significantly blocked in the cells co-transfected with siRNAs targeting GIPC1, OR1N1, or FAK, but not non-specific siRNA (p < 0.0001, Fig. 4E).

CLIC4 Mediated RELM-β Regulation on the Proliferation of PAECs Through NF-kB/HIF-1α Signaling

Studies have shown that CLIC4 stimulated proliferation and reduced apoptosis of pulmonary artery endothelial cells (PAECs) through NF-κB signaling, and by which mechanism, it was involved in vascular remodeling [20–22, 26, 27]. Therefore, potential interaction of CLIC4 and RELM-ß and their effect on PAEC survival and apoptosis were investigated in the current study. To accomplish this, first, the PAECs were co-transfected with either overexpressing RELM-β plasmid and siRNA specifically targeting CLIC4, or overexpressing CLIC4 plasmid and RELM-β specific siRNA. The cells were then exposed to hypoxia followed by assessing cell survival and apoptosis. It was found that expression of CLIC4 mRNA was significantly up-regulated in the cells overexpressing RELM-β, which was completely suppressed by siRNA targeting CLIC4 (p < 0.0001, Fig. 5A). In contrast, expression of RELM-ß mRNA was not altered in the cells overexpressing CLIC4 although it was significantly suppressed by the RELM-ß specific siRNA (Fig. 5B).

Fig. 5.

Fig. 5

Role of CLIC4 in mediating RELM-β effect on PAEC proliferation and apoptosisPanel A: Quantification of CLIC4 mRNA in the PAECs overexpressing RELM-β. Horizontal axes: co-transfection of plasmid of overexpressing RELM-ß and CLIC4 siRNA; vertical axes: relative mRNA expressed as fold change. Panel B: Quantification of RELM-ß mRNA in the PAECs overexpressing CLIC4. Horizontal axes: co-transfection of plasmid of overexpressing CLIC4 and RELM-ß siRNA; vertical axes: relative mRNA expressed as fold change. Panel C: Proliferation of PAECs overexpressing RELM-β assessed by CCK-8 assay. Horizontal axes: co-transfection of plasmid of overexpressing RELM-ß and CLIC4 siRNA; vertical axes: cell number expressed by absolute OD value. Panel D: Proliferation of PAECs overexpressing CLIC4 assessed by CCK-8 assay. Horizontal axes: co-transfection of plasmid of overexpressing CLIC4 and RELM-ß siRNA; vertical axes: cell number expressed by absolute OD value. Panel E: Proliferation of PAECs overexpressing RELM-ß assessed by CCK-8 assay. Horizontal axes: co-transfection of plasmid of overexpressing RELM-ß and siRNAs targeting HIF-a or NF-kB; vertical axes: cell number expressed by absolute OD value. Panel F: Proliferation of PAECs in reponse to hypoxia assessed by CCK-8 assay. Horizontal axes: treatment of the cells with hypoxia following transfection of siRNAs targeting RELM-ß or CLIC4; vertical axes: cell number expressed by absolute OD value. Panel G: Apoptosis of the cells assessed by flow cytometry. Insert: Comparison of the apoptotic cells. Horizontal axis: treatment of the cells with hypoxia following transfection of siRNAs targeting RELM-ß or CLIC4; vertical axis: number of apoptotic cells expressed as percentage (%). Data were presented as the mean ± SD of three independent experiments. Panel H: Cell cycle analysis by flow cytometry. Insert: Comparison of the cells at S-phase. Horizontal axis: treatment of the cells with hypoxia following transfection of siRNAs targeting RELM-ß or CLIC4; vertical axis: proportion of the cells in S-phase expressed as percentage (%). Data were presented as the mean ± SD of three independent experiments. **p < 0.01, ****p < 0.0001, ns = no significant difference. PAEC: pulmonary artery endothelial cell; RELM-ß: resistin-like molecule-ß; CLIC4: chloride intracellular channel 4; HIF-a: hypoxia induced factor a

OD value of the CCK-8 assay was significantly higher in the cells overexpressing RELM-β (p < 0.0001, Fig. 5C) or CLIC4 (p < 0.0001, Fig. 5D), which was partially but significantly blocked in the cells co-transfected with CLIC4 specific siRNA β (p < 0.0001, Fig. 5C) or RELM-ß specific siRNA (p < 0.0001, Fig. 5D). In addition, co-transfection of siRNAs targeting HIF-1a or NF-kB into the cells overexpressing either RELM-ß or CLIC4 resulted in partial but significant blockade on the increased OD value of the CCK-8 assay in the cells (p < 0.0001, Fig. 5E). Furthermore, OD value of the CCK-8 assay was also significantly increased in the PAECs when they were exposed to hypoxia (p < 0.0001, Fig. 5F), and suppression of RELM-ß or CLIC4 by RNA interference in these cells resulted in partial but significant blockade on the OD values (p < 0.0001, Fig. 5F).

Consistent with the results of CCK-8 assay, apoptosis and cell cycle analysis by flow cytometry demonstrated that hypoxia significantly inhibited apoptosis (p < 0.0001, Fig. 5G) but increased proportion of the cells in S phase (p < 0.0001, Fig. 5H), which were also partially but significantly reversed in the cells lacking RELM-ß or CLIC4 (p < 0.0001, Fig. 5G and H, respectively).

RELM-β-Augmented PH in Response to Hypoxia was Alleviated in the Mice with Genetic Deficiency of GIPC1 (GIPC1 CKO)

To further investigate the role of GIPC1 in regulating RELM-ß-mediated pulmonary arterial hypertension, we created Sma-CreERT2; GIPC1f/f (GIPC1 CKO) mice. WT and GIPC1 CKO mice were exposed to hypoxia ± RELM-ß following the experimental design as shown in Fig. 1A. Histopathological examination of the lung tissues demonstrated that hypoxia-induced pulmonary small artery remodeling was significantly reduced in the GIPC1 CKO mice in comparison with the wild type (WT) mice, which was also observed even in the mice exposed to hypoxia plus RELM-ß (Fig. 6A). Measurement of RVHI, RVSP and MT% indicated that GIPC1 knockout resulted in significant reduction of RVHI in the mice exposed to hypoxia plus RELM-ß treatment (p < 0.05, Fig. 6B), of RVSP in the mice exposed to hypoxia alone (p < 0.01, Fig. 6C) or plus RELM-ß treatment (p < 0.001, Fig. 6C), and of % MT in the smaller arterioles (< 50 μm) from the mice exposed to hypoxia alone (p < 0.05, Fig. 6D) or plus RELM-ß treatment (p < 0.0001, Fig. 6D), but not in the arterioles ≥ 50 μm (Fig. 6E).

Fig. 6.

Fig. 6

Alleviation of RELM-β augmented hypoxia-induced PH in the GIPC1 CKO mice.Panel A: Representative histopathological images of the lung tissues from wild type (WT) and GIPC1 deficient mice (GIPC1 CKO). Magnification 200×. Panels B-E: Comparison of RVHI (panel B), RVSP (panel C), and % MT (panel D: arterioles < 50 μm; panel E: arterioles > 50 μm). Horizontal axes: WT or GIPC1 CKO mice; vertical axes: RVHI (%), RSVP (mmHg), or media thickness (%). Data presented were means ± SD, n = 3 for each group, *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001. Panel F: Representative images of EdU and a-SMA immunofluorescent staining in the frozen sections of lung. a-SMA: a-smooth muscle actin

EdU incorporation assay demonstrated that proliferation of the PASMCs was significantly reduced in the GIPC1 CKO mice when they were exposed to hypoxia alone or hypoxia plus RELM-β, compared to WT mice (Fig. 6F).

RELM-β-Augmented PH in Response to Hypoxia was Alleviated in the Mice with Genetic Deficiency of CLIC4 (CLIC4 CKO)

Previous studies also found that CLIC4 expression was significantly higher in PH tissues, which was localized predominantly to endothelial cells in vascular lesions [20–22, 26, 27]. Therefore, the role of CLIC4 in regulating RELM-β-mediated PH in the mice exposed to hypoxia was further investigated by creating the Cdh5-CreERT2; CLIC4f/f (CLIC4 CKO) mice. WT and CLIC4 CKO mice were exposed to hypoxia ± RELM-ß following the experimental design as shown Fig. 1A. Like the findings in the GIPC1 CKO mice, pulmonary small artery remodeling and new angiogenesis were significantly reduced in the mice exposed to hypoxia with or without RELM-ß treatment (Fig. 7A). However, compared to WT mice, there was no significant reduction in RVHI or RVSP in the CLIC4 CKO mice (Fig. 7B and C, respectively) although %MT was significantly different in the group of mice exposed to hypoxia plus RELM-ß (p < 0.01 or 0.05, Fig. 7D and E, respectively). PAEC proliferation seemed also reduced in the CLIC4 CKO mice compared to that of WT mice as demonstrated by the EdU incorporation assay (Fig. 7F).

Fig. 7.

Fig. 7

Alleviation of RELM-β augmented hypoxia-induced PH in the CLIC4 CKO micePanel A: Representative histopathological images of the lung tissues from wild type (WT) and CLIC4 deficient mice (CLIC4 CKO). Magnification 200×. Panels B-E: Comparison of RVHI (panel B), RVSP (panel C), and % MT (panel D: arterioles < 50 μm; panel E: arterioles > 50 μm). Horizontal axes: WT or CLIC4 CKO mice; vertical axes: RVHI (%), RSVP (mmHg), or media thickness (%). Data presented were means ± SD, n = 3 for each group, *p < 0.05, **p < 0.01. Panel F: Representative images of EdU and CD31 immunofluorescent staining in the frozen sections of lung

Discussion

Chronic hypoxia, occurring in conditions such as chronic obstructive pulmonary disease (COPD), interstitial lung disease, and sleep apnea, is a critical driver of pulmonary hypertension (PH) [1, 28, 29]. Hypoxia (e.g. high altitude or chronic lung disease) induces structural remodeling of the pulmonary vasculature, characterized by pulmonary arterial smooth muscle cell (PASMC) hyperplasia and migration [30], as well as vascular endothelial cell injury [31]. Nevertheless, the molecular mechanisms underlying hypoxia-induced pulmonary vascular remodeling and its contribution to PH pathogenesis remain incompletely defined. Human RELM-β has significant sequence homology to rodent RELM-α, which is considered as hypoxia-induced mitogenic factor (HIMF) in rodents [32–35]. HIMF knockout resulted in attenuation of PH-related pulmonary vascular remodeling caused by chronic hypoxia in vivo, and in contrast, overexpression of HIMF in the lungs initiated vascular remodeling [22]. In this study, we established a murine model of hypoxia-induced PH through 3-week continuous hypoxia exposure. To investigate the role of RELM-β in modulating hypoxia-induced PH, we administered exogenous human RELM-β protein during hypoxic conditioning. Our results demonstrate that RELM-β exacerbates hypoxia-induced PH, as evidenced by significant increases in right ventricular hypertrophy index (RVHI), right ventricular systolic pressure (RVSP), and medial wall thickness (%MT). In vitro, RELM-β enhanced cell survival and suppressed apoptosis in both PASMCs and PAECs.

Subsequently, we explored potential targets of RELM-β and identified the associated proteins GIPC1, OR1N1, and CLIC4 using affinity purification mass spectrometry (AP-MS). The GIPC1 protein has been reported to play a critical role in the regulation of surface receptors trafficking and stabilizing, as well as the expression of FAK [18, 36]. We have previously demonstrated that FAK was involved in mediating RELM-β stimulation on proliferation of PASMCs [14]. While limited studies reported on OR1N1, olfactory receptor olfactory receptor 2 (Olfr2) has been demonstrated to play a role in exacerbating atherosclerosis [19]. Accordingly, we hypothesized that RELM-β upregulate FAK expression through interacting with GIPC1/OR1N1, and by which mechanisms, promoting pulmonary arterial smooth muscle cell proliferation and contributing to pulmonary arteriole remodeling. To confirm this hypothesis, pulmonary arterial smooth muscle cells were co-transfected with a RELM-β overexpression plasmid and specific siRNAs targeting GIPC1, OR1N1, or FAK, by which, we demonstrated that RELM-β modulated PASMC proliferation via interacting with GIPC1/OR1N1.

It has recently been reported that CLIC4 stimulated proliferation and reduced apoptosis of pulmonary artery endothelial cells (PAECs) through NF-κB signaling, and by which mechanism, it was involved in vascular remodeling [20]. Furthermore, CLIC4 protein expression was increased in the pulmonary vascular endothelium from the patients with PH, and overexpression of CLIC4 could enhanced survival and angiogenic capacity of PAECs [27]. CLIC4 also induced HIF-1α activation and angiogenic responses in cultured PAECs via NF-kB signaling pathway [37]. However, whether RELM-ß interacts with CLIC4 and their roles in modulating pulmonary artery endothelial cells survival and apoptosis remains to be defined. In the current study, we demonstrated that regulatory effect of RELM-ß or hypoxia on PAEC survival and apoptosis was significantly blocked by CLIC4 specific siRNA, suggesting that interaction of CLIC4 and RELM-ß potentially play a role in regulating PAEC survival and apoptosis. In addition, role of HIF-1α and NF-kB in regulating the effect of RELM-β on PAECs proliferation was also explored in this study. Suppression of HIF-1α or NF-kB by siRNA also resulted in partial but significant blockade of RELM-β effect on PAEC survival, suggesting the HIF-1α/NF-kB signaling pathway may be involved in mediating RELM-ß1 effect on PAEC proliferation.

Next, role of GIPC1 and CLIC4 in mediating the regulatory effect of RELM-ß was further investigated by creating mice with genetic deficiency of GIPC1 or CLIC4 and exposing these mice to hypoxia ± RLEM-ß injection. It was found that the augmenting effect of exogenous RELM-ß on the hypoxia-induced PH was dramatically reduced in the mice with genetic deficiency of GIPC1 (GIPC1 CKO) or CLIC4 (CLIC4 CKO) compared to the wild type mice, further suggesting that GIPC1 and CLIC4 play an important role in mediating the effect of RELM-ß in modulating hypoxia-induced PH.

There are limitations of the current study. First, while the current study demonstrated that RELM-ß modulated hypoxia-induced animal model of pulmonary hypertension, it might not be the case in other type of PH such as idiopathic PH. Second, the specific binding mechanisms between RELM-β and the proteins (GIPC1, OR1N1, and CLIC4) as well as downstream signaling pathways remain to be elucidated. Third, although high statistical significance (p < 0.0001) and consistent trends across assays support reproducibility, the sample size of the animal model was limited (n = 3) in this study.

Conclusion

Taken together, pulmonary vascular remodeling is a characteristic feature of hypoxia-induced PH. Using an animal model of hypoxia-induced PH as well as in vitro culture of human PASMCs and PAECs, the current study investigated the regulatory effect of RELM-ß on the development of PH in response to hypoxia, and identified cell membrane proteins or receptors, including OR1N1, GIPC1, and CLIC4, modulate survival and apoptosis of PASMCs and PAECs through direct interacting with RLEM-ß protein. These findings suggested RELM-ß play an important role in the development of hypoxia-induced PH through interacting with membrane proteins or receptors including GIPC1, OR1N1, and CLIC4.

Abbreviations

AP-MS

Affinity purification-mass spectroscopy

BCA

Bicinchoninic acid

CKO

Conditional knockout

CLIC4

Chloride intracellular channel 4

ECL

Chemiluminescence

FAK

Focal adhesion kinase

FDR

False discovery rate

GIPC1

GIPC PDZ Domain containing family member 1

HE

Hematoxylin-eosin

HIMF

Hypoxia-induced mitogenic factor

MT

Media thickness

OR1N1

Olfactory receptor family 1 subfamily N member 1

PAEC

Pulmonary artery endothelial cell

PH

Pulmonary hypertension

PASMC

Pulmonary artery smooth muscle cell

PFA

Paraformaldehyde

RELM

Resistin-like molecule

RVHI

Right ventricular hypertrophy

RVSP

Right ventricular systolic pressure

Author Contributions

Chunlong Lin contributed to the study conception and design. All authors collected the data and performed the data analysis. All authors contributed to the interpretation of the data and the completion of figures and tables. All authors contributed to the drafting of the article and final approval of the submitted version.

Funding

This work was supported by grants obtained from the National Natural Science Foundation of China [Grant No. 82070046].

Data Availability

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Code Availability

Not applicable.

Declarations

Ethics Approval

Ethical approval for the animal experiment was obtained from the Hunan Normal University Biomedical Research Ethics Committee under license number (2020-086).

Consent for Publication

Not applicable.

Consent to Participate

Not applicable.

Artificial Intelligence

The authors did not use generative AI or AI-assisted technologies in the development of this manuscript”.

Competing Interests

All authors declare that they have no conflicts of interest.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Krompa A, Marino P. Diagnosis and management of pulmonary hypertension related to chronic respiratory disease. Breathe. 2022;18:220205. 10.1183/20734735.0205-2022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Ichimura K, Gross A, Mathew RO, et al. Cardiorenal syndrome in right heart failure due to pulmonary arterial hypertension-the right ventricle as a therapeutic target to improve renal function. Cardiovasc Drugs Ther. 2025;39:373–84. 10.1007/s10557-024-07588-8. [DOI] [PubMed] [Google Scholar]
  • 3.Hassoun PM. Pulmonary arterial hypertension. N Engl J Med. 2021;385:2361–76. 10.1056/NEJMra2000348. [DOI] [PubMed] [Google Scholar]
  • 4.Nathan SD, Barbera JA, Gaine SP, et al. Pulmonary hypertension in chronic lung disease and hypoxia. Eur Respir J. 2019. 10.1183/13993003.01914-2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Lan R, Zhang MJ, Liu K, et al. Cytochrome p450-derived epoxyeicosatrienoic acid, the regulation of cardiovascular-related diseases, and the implication for pulmonary hypertension. Cardiovasc Drugs Ther. 2024. 10.1007/s10557-024-07655-0. [DOI] [PubMed] [Google Scholar]
  • 6.Lan NSH, Massam BD, Kulkarni SS, Lang CC. Pulmonary arterial hypertension: pathophysiology and treatment. Diseases. 2018. 10.3390/diseases6020038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Han L, Song N, Hu X, et al. Inhibition of relm-β prevents hypoxia-induced overproliferation of human pulmonary artery smooth muscle cells by reversing plc-mediated kcnk3 decline. Life Sci. 2020;246:117419. 10.1016/j.lfs.2020.117419. [DOI] [PubMed] [Google Scholar]
  • 8.Teng X, Li D, Champion HC, Johns RA. Fizz1/relmalpha, a novel hypoxia-induced mitogenic factor in lung with vasoconstrictive and angiogenic properties. Circ Res. 2003;92:1065–7. 10.1161/01.Res.0000073999.07698.33. [DOI] [PubMed] [Google Scholar]
  • 9.Angelini DJ, Su Q, Yamaji-Kegan K, et al. Resistin-like molecule-beta in scleroderma-associated pulmonary hypertension. Am J Respir Cell Mol Biol. 2009;41:553–61. 10.1165/rcmb.2008-0271OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Tong Q, Zheng L, Li B, et al. Hypoxia-induced mitogenic factor enhances angiogenesis by promoting proliferation and migration of endothelial cells. Exp Cell Res. 2006;312:3559–69. 10.1016/j.yexcr.2006.07.024. [DOI] [PubMed] [Google Scholar]
  • 11.Fan C, Su Q, Li Y, et al. Hypoxia-induced mitogenic factor/fizz1 induces intracellular calcium release through the plc-ip(3) pathway. Am J Physiol Lung Cell Mol Physiol. 2009;297:L263–270. 10.1152/ajplung.90416.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Zhao X, Guan JL. Focal adhesion kinase and its signaling pathways in cell migration and angiogenesis. Adv Drug Deliv Rev. 2011;63:610–5. 10.1016/j.addr.2010.11.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Sonoda Y, Matsumoto Y, Funakoshi M, Yamamoto D, Hanks SK, Kasahara T. Anti-apoptotic role of focal adhesion kinase (fak). Induction of inhibitor-of-apoptosis proteins and apoptosis suppression by the overexpression of fak in a human leukemic cell line, hl-60. J Biol Chem. 2000;275:16309–15. 10.1074/jbc.275.21.16309. [DOI] [PubMed] [Google Scholar]
  • 14.Lin C, Li X, Luo Q, et al. Relm-β promotes human pulmonary artery smooth muscle cell proliferation via fak-stimulated surviving. Exp Cell Res. 2017;351:43–50. 10.1016/j.yexcr.2016.12.021. [DOI] [PubMed] [Google Scholar]
  • 15.Liu R, Xu C, Zhang W, et al. Fundc1-mediated mitophagy and hif1α activation drives pulmonary hypertension during hypoxia. Cell Death Dis. 2022;13:634. 10.1038/s41419-022-05091-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Arai MA, Sakuraba K, Makita Y, Hara Y, Ishibashi M. Evaluation of naturally occurring hif-1 inhibitors for pulmonary arterial hypertension. Chembiochem. 2021;22:2799–804. 10.1002/cbic.202100223. [DOI] [PubMed] [Google Scholar]
  • 17.Johns RA, Takimoto E, Meuchel LW, et al. Hypoxia-inducible factor 1α is a critical downstream mediator for hypoxia-induced mitogenic factor (fizz1/relmα)-induced pulmonary hypertension. Arterioscler Thromb Vasc Biol. 2016;36:134–44. 10.1161/atvbaha.115.306710. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Grun D, Adhikary G, Eckert RL. Nrp-1 interacts with gipc1 and α6/β4-integrins to increase yap1/∆np63α-dependent epidermal cancer stem cell survival. Oncogene. 2018;37:4711–22. 10.1038/s41388-018-0290-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Orecchioni M, Kobiyama K, Winkels H, et al. Olfactory receptor 2 in vascular macrophages drives atherosclerosis by NLRP3-dependent IL-1 production. Science. 2022;375:214–21. 10.1126/science.abg3067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Alzaydi MM, Abdul-Salam VB, Whitwell HJ, et al. Intracellular chloride channels regulate endothelial metabolic reprogramming in pulmonary arterial hypertension. Am J Respir Cell Mol Biol. 2023;68:103–15. 10.1165/rcmb.2022-0111OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Qin L, Jiang B, Zsebo K, Duckers HJ, Simons M, Chen PY. Multiple intravenous bolus dosing and invasive hemodynamic assessment in a hypoxia-induced mouse pulmonary artery hypertension model. J Vis Exp. 2022. 10.3791/63839. [DOI] [PubMed] [Google Scholar]
  • 22.Angelini DJ, Su Q, Yamaji-Kegan K, et al. Hypoxia-induced mitogenic factor (himf/fizz1/relmalpha) induces the vascular and hemodynamic changes of pulmonary hypertension. Am J Physiol Lung Cell Mol Physiol. 2009;296:L582–593. 10.1152/ajplung.90526.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Wang B, Xu Y, Huang Y, et al. Mir-210-5p promotes pulmonary hypertension by blocking ATP2A2. Cardiovasc Drugs Ther. 2025;39:711–9. 10.1007/s10557-024-07568-y. [DOI] [PubMed] [Google Scholar]
  • 24.Ye P, Jiang XM, Qian WC, Zhang J. Inhibition of PCSK9 improves the development of pulmonary arterial hypertension via down-regulating NOTCH3 expression. Cardiovasc Drugs Ther. 2024;38:1223–34. 10.1007/s10557-023-07458-9. [DOI] [PubMed] [Google Scholar]
  • 25.Souza NSC, Barenco-Marins T, Ferraz AP, et al. Low thyroid hormones level attenuates mitochondrial dysfunction and right ventricular failure in pulmonary hypertensive rats. Cardiovasc Drugs Ther. 2024. 10.1007/s10557-024-07618-5. [DOI] [PubMed] [Google Scholar]
  • 26.Kong S, Yu J, Li HF, et al. A ring n(ch(3))(2)-based derivative of resveratrol inhibits pulmonary vascular remodeling in hypoxia pulmonary hypertension. Eur J Pharmacol. 2023;959:176077. 10.1016/j.ejphar.2023.176077. [DOI] [PubMed] [Google Scholar]
  • 27.Wojciak-Stothard B, Abdul-Salam VB, Lao KH, et al. Aberrant chloride intracellular channel 4 expression contributes to endothelial dysfunction in pulmonary arterial hypertension. Circulation. 2014;129:1770–80. 10.1161/circulationaha.113.006797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Matsuoka S, Washko GR, Yamashiro T, et al. Pulmonary hypertension and computed tomography measurement of small pulmonary vessels in severe emphysema. Am J Respir Crit Care Med. 2010;181:218–25. 10.1164/rccm.200908-1189OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Barenco-Marins TS, Seara FAC, Ponte CG, Nascimento JHM. Pulmonary circulation under pressure: pathophysiological and therapeutic implications of Bk channel. Cardiovasc Drugs Ther. 2025;39:415–33. 10.1007/s10557-023-07503-7. [DOI] [PubMed] [Google Scholar]
  • 30.Lade JM, Andrade MR, Undem C, et al. Hypoxia enhances interactions between na(+)/h(+) exchanger isoform 1 and actin filaments via ezrin in pulmonary vascular smooth muscle. Front Physiol. 2023;14:1108304. 10.3389/fphys.2023.1108304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Xiang Y, Zheng F, Zhang Q, et al. Tanreqing injection regulates cell function of hypoxia-induced human pulmonary artery smooth muscle cells (hpasmcs) through trpc1/cx3cl1 signaling pathway. Oxid Med Cell Longev. 2022;2022:3235102. 10.1155/2022/3235102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Liu T, Baek HA, Yu H, et al. Fizz2/relm-β induction and role in pulmonary fibrosis. J Immunol. 2011;187:450–61. 10.4049/jimmunol.1000964. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Xing Y, Zheng X, Qi J, et al. 15-lipoxygenase/15-hydroxyeicosanoid and activator protein 1 contribute to hypoxia-induced pulmonary artery smooth muscle cells phenotype alteration. Prostaglandins Leukot Essent Fatty Acids. 2018;135:22–9. 10.1016/j.plefa.2018.03.002. [DOI] [PubMed] [Google Scholar]
  • 34.Sangam S, Sun X, Schwantes-An TH, et al. Sox17 deficiency mediates pulmonary hypertension: at the crossroads of sex, metabolism, and genetics. Am J Respir Crit Care Med. 2023;207:1055–69. 10.1164/rccm.202203-0450OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Li X, Liu C, Qi W, et al. Endothelial dec1-pparγ axis impairs proliferation and apoptosis homeostasis under hypoxia in pulmonary arterial hypertension. Front Cell Dev Biol. 2021;9:757168. 10.3389/fcell.2021.757168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Lee NY, Ray B, How T, Blobe GC. Endoglin promotes transforming growth factor beta-mediated Smad 1/5/8 signaling and inhibits endothelial cell migration through its association with Gipc. J Biol Chem. 2008;283:32527–33. 10.1074/jbc.M803059200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Abdul-Salam VB, Russomanno G, Chien-Nien C, et al. Clic4/arf6 pathway. Circ Res. 2019;124:52–65. 10.1161/circresaha.118.313705. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Not applicable.


Articles from Cardiovascular Drugs and Therapy are provided here courtesy of Springer

RESOURCES