Skip to main content
PLOS One logoLink to PLOS One
. 2026 Jul 22;21(7):e0353524. doi: 10.1371/journal.pone.0353524

Participation of Endothelin in the postnatal development of the rat kidney: Molecular mechanisms involved

Lucas Humberto Oronel 1, María del Carmen Ortiz 1, Analía Czerniczyniec 2,¤a, Rocío Marinoni 1,¤b, María Ángeles Magnanelli 1, Silvia Lores Arnaiz 2,3, María Florencia Albertoni Borghese 1,4, Mónica P Majowicz 1,*
Editor: Christopher Torrens5
PMCID: PMC13390839  PMID: 42485295

Abstract

Some adult diseases such as hypertension and kidney disease may have their origins in early life, due to exposure to different adverse stressors. Previously we demonstrated that the administration of a dual endothelin receptor antagonist (ERA) to Sprague-Dawley (SD) rats from day 1–21 of life decreased glomerular number, predisposing adult male rats to salt sensitivity. This new study explores some early molecular mechanisms underlying the alterations observed in the kidneys of ERA-treated rats during the postnatal period, evaluating sex differences. Newborn male and female SD rats were treated with a dual ERA from day 1–6 and then sacrificed on day 7 of life to obtain the kidneys for the preparation of homogenates and mitochondrial fractions to assess: renal cell proliferation and apoptosis, nitric oxide synthases (Nos), neuronal isoform (Nos1) and endothelial isoform (Nos3) mRNA expression, NADPH- diaphorase (NADPH-d) activity, oxidative stress markers and antioxidant enzymes. ERA-treated male rats showed increased thiobarbituric acid-reacting substances (TBARS) and decreased nitric oxide (NO) to superoxide anion (O2-) ratio, with lower NADPH-d activity in the structures that give rise to glomeruli. Sex differences were observed in Nos1 and Nos3 mRNA expression, H2O2 production, and catalase activity, being females more protected than males. The alterations observed in the kidneys of ERA-treated rats during the early postnatal period could be due to a renal imbalance between NO and ROS, with increased oxidative stress, and a misbalance between proliferation and apoptosis. Our current findings show some molecular mechanisms underlying Endothelin inhibition in the early postnatal period, with potential utility for designing reprogramming strategies.

Introduction

The kidney is vulnerable to early-life stressors. Thus, renal programming is key in the developmental programming of renal diseases. We have previously demonstrated that the inhibition of the endothelin (ET) system with a dual ET receptor antagonist (ERA) during the early postnatal period decreases the number of glomeruli, the juxtamedullary filtration surface area, and the glomerular filtration rate, while increasing proteinuria, being these effects more pronounced in male than in female rats [1]. Moreover, only ERA-treated male rats increased their blood pressure during adulthood after a high sodium diet, with an impaired ability to excrete sodium and water [2]. Considering the link between reduced glomerular number, hypertension and kidney disease programming [3,4], it is relevant to investigate the early molecular mechanisms that underlie those abnormalities in this experimental model.

Nephron development requires a complex interaction between growth factors, pro- and anti-apoptotic molecules, oxygen, and nutrients, all highly sensitive to perinatal disturbances, which can affect both its structure and function [5]. During development, apoptosis is essential for structural remodeling and to eliminate superfluous cells in a controlled manner [6], and its alterations can manifest as developmental abnormalities. Different studies have involved apoptosis as a determinant of nephron number [7]. Yoo et al. showed that the administration of an endothelin type A receptor (ETA) antagonist to neonatal rats decreases cellular proliferation and increases apoptosis in the kidney [8]. However, later studies in adult rats revealed that ETA triggers apoptosis in the kidney, while endothelin type B receptor (ETB) protects against it [9].

During kidney development, nitric oxide (NO) plays an important role in renal function regulation and apoptosis modulation [10,11]. Many reports support the role of oxidative stress in renal perinatal programming [12], proposing it as a link between perinatal adverse stressors and disease programming [13]. Moreover, oxidative stress is one of the main stimuli for the apoptotic intrinsic pathway [14].

Renal cells have a large mitochondrial density, enabling the kidney to sustain its increased metabolism [15]. Since mitochondria are also major sources of reactive oxygen species (ROS), when mitochondrial function is impaired, the kidney is particularly susceptible to oxidative stress [15]. Thus, a fine balance between NO and ROS is required to achieve normal nephrogenesis [16].

Additionally, although the severity of a negative developmental impact is often sex-dependent [17], the specific mechanisms causing these differences between males and females remain unclear [18]. Thus, we here hypothesized that the alterations observed in the kidneys of ERA-treated rats during the early postnatal period are due to an imbalance between NO and ROS, increasing renal oxidative stress. This leads to a misbalance between proliferation and apoptosis, decreasing cell proliferation and/or increasing apoptosis, especially in the structures that originate the glomeruli.

Materials and methods

Ethics statement

Protocols were complied with The ARRIVE guidelines 2.0 and were designed according to the Guide for Care and Use of Laboratory Animals from the National Institutes of Health, USA and the 9236/23 regulation of the Argentine National Drug Food and Medical Technology Administration (ANMAT), and approved by the Institutional Committee for Use and Care of Laboratory Animals (Comité Institucional para el uso y cuidado de Animales de Laboratorio; CICUAL) from Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires (FFyB-UBA), Argentina (REDEC-2024–3207-E-UBA-DCT_FFYB). Efforts were made to use the minimum number of animals and minimize suffering.

Animals and treatments

Male and female parent Sprague-Dawley (SD) rats (RRID: RGD_70508) were purchased from Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires. Rats were housed in rooms with controlled temperature (22–24°C) and a 12-h dark-light cycle. Food and water were supplied ad libitum. After a week of acclimatization, adult female SD rats (70 days old weighing 230–250 g) were mated by exposure to a fertile SD male for 1 week. After birth, litter size was fixed at 10 ± 1. Newborn rats were treated daily from postnatal day (PD) 1–6 with vehicle or Bosentan (Actelion, 20 mg/kg/day; PubChem CID: 44387533), a dual ERA, administered orally with a micropipette. Four groups of animals were formed: control males (Cm), control females (Cf), ERA-treated males (ERAm), and ERA-treated females (ERAf).

On PD 7, the pups were sacrificed by decapitation, and the kidneys excised, weighed and processed or maintained at −80°C until future processing.

Drugs and chemicals

The following drugs were purchased from Sigma Chemical Co.; St. Louis, Missouri, USA: sodium dodecyl sulfate (SDS), phosphotungstic acid hydrate (Cat No. 455970. PubChem Substance ID: 24869099), 1,1,3,3-tetramethoxypropane (MDA standard; Cat No. 108383), L-arginine, β-NADPH, dithiothreitol, SOD (Superoxide dismutase from bovine erythrocytes – lyophilized powder, ≥ 3000 units/mg protein (Cat No. S7571), Catalase, oxyhemoglobin (HbO2), Nx-nitro-L-arginine (L-NNA), N-nitro-L-arginine-methyl-ester (L-NAME), hydrogen peroxide (H2O2), epinephrine, mannitol, sucrose, NADH, succinate, rotenone, nitrobluetetrazolium, triton X-100, free-fatty acid bovine serum albumin (FFA-BSA), malate, glutamate, peroxidase from horseradish (HRP), reduced glutathione, glutathione reductase, tert-butyl hydroperoxide.

Origin of drugs and chemicals not named here are described in situ. Other general reagents or drugs used for preparation of buffers were of analytical grade.

Tissue processing to prepare renal homogenates and mitochondrial fractions

Homogenate preparation: The kidneys were homogenized at 1076 g in MSTE buffer (230 mM mannitol, 70 mM sucrose, 10 mM Tris-HCl, 1 mM sodium EDTA, pH 7.4). Large tissue debris and nuclear fragments were removed by a low-speed spin (1000 g, 10 min, 4°C).

Preparation of mitochondria-rich fraction and submitochondrial membranes: The mitochondrial pellet was obtained by subjecting the supernatant to a second centrifugation step at 7650 g for 30 min, and then washed twice in MSTE buffer. Submitochondrial membranes were obtained by freezing and thawing the mitochondrial preparation twice and then homogenized by passage through a 27G needle. This preparation consisted of a fraction of outer and inner membranes, without restrictions to substrate access [19].

Protein and phosphatase inhibitors (Calbiochem, Merck; Darmstadt, Germany) were added to all the samples.

Protein concentration was measured using a BCATM Protein Assay Kit (Pierce, Rockford, IL, USA). Absorbance was read using an Infinite F50 microplate reader (Tecan Trader AG, Switzerland) at 560 nm.

Cellular proliferation evaluation

Cellular proliferation was evaluated by immunohistochemistry using a primary rabbit polyclonal antibody specific for Proliferating Cell Nuclear Antigen (PCNA) (Rabbit polyclonal anti-PCNA antibody (ab18197); AbCaM), Cambridge, UK.), followed by a polyclonal secondary biotinylated goat anti-rabbit (Goat anti-Rabbit IgG (H + L) Secondary Antibody, Biotin. Catalog # 65–6140; Invitrogen / Thermo Fischer; Waltham, Massachusetts, USA). Positive cells were detected with an avidin-biotin-based peroxidase detection kit using 3,3’-diaminobenzidine as the chromogen (Vectastain ABC kit, (Cat No. PK6100), Vector Laboratories, Burlingame, CA, USA). Tissue sections were counterstained with hematoxylin (Cod. 9491.08; Biopack, Argentina). Negative controls were performed by omitting the primary antibody, and endogenous peroxidase activity was quenched with hydrogen peroxide to prevent unspecific staining.

The number of PCNA-positive nuclei present in the immature structures that originate the glomeruli was counted in ten cortical and ten juxtamedullary fields from four animals per group (total magnification 400x) and representative images were taken using an Olympus 8J15816 light microscope coupled to a digital camera (Qcolor 3, Olympus America, Inc., Richmond Hill, Ontario, Canada). All determinations were performed blindly and under standardized conditions by the same researcher.

Apoptosis evaluation

Apoptosis was evaluated using the Terminal deoxynucleotidyl transferase (TdT) dUTP Nick-End Labeling (TUNEL) assay. The in Situ Cell Death Detection Kit, AP (Roche Diagnostics GmbH, Mannheim, Germany, Ref 11 684 809 910), a non-radioactive technique designed to end-label the fragmented DNA of apoptotic cells, was used. Renal tissue sections of 4 μm were deparaffinized in xylene and rehydrated in graded ethanol and phosphate buffer saline (PBS). Then, the sections were incubated in proteinase K solution (20 μg/mL in PBS), (Merck, Darmstadt, Germany) for permeabilization. Tissue slides were treated with the fluorescein d-UTP-labeled nucleotide mix and the terminal TdT enzyme (TUNEL reaction mixture) in the reaction buffer for 60 min at 37 °C to allow the end-labeling reaction. The incorporated fluorescein was detected by anti-fluorescein antibody provided in the kit, conjugated with alkaline phosphatase (converter AP). The sections were stained with BCIP/NBT color development substrate (Promega, Madison, WI, USA), counterstained with hematoxylin and mounted in PBS/glycerol for light microscopy. The number of TUNEL-positive nuclei was counted in ten cortical and ten juxtamedullary fields from four animals of each group (total magnification 400x) and representative images were captured using a Nikon Model Eclipse E200 light microscope (Nikon Instrument Group, Melville, NY, USA). All determinations were performed blindly and under standardized conditions by the same researcher.

Evaluation of TBARS production

Thiobarbituric acid-reacting substances (TBARS) are commonly used markers for lipid peroxidation and malondialdehyde (MDA) production. The amount of TBARS production was determined by a fluorescence assay in renal homogenates.

Homogenates were treated with 1 mL of 0.1 N sodium dodecyl sulfate, 0.1 N HCl, 0.15 mL of 10% phosphotungstic acid and 0.5 mL of 0.7% 2-thiobarbituric acid (Merck, Darmstadt, Germany). After 1 h of boiling, the samples were cooled, and 2.5 mL of butanol was added. Fluorescence of the butanol layer was measured at 515 nm for excitation and 555 nm for emission. The values were expressed as nmoles of MDA per mg of protein, using a MDA standard prepared from 1,1,3,3-tetramethoxypropane [19].

Evaluation of nitric oxide production

NO production was measured in submitochondrial membranes by using a spectrophotometric method, following the oxidation of oxyhemoglobin (HbO2) to methemoglobin (metHb) at 37 °C. This assay was performed using a Beckman Coulter Series DU 7400 diode array spectrophotometer in which the active wavelength was set at 577 nm and the reference wavelength at the isosbestic point at 591 nm (e = 11.2 mM/cm). The reaction medium contained: 50 mM phosphate buffer pH 5.8, 1 mM CaCl2, 50 μM L-arginine, 100 μM β-NADPH, 10 μM dithiothreitol, 4 μM Cu–Zn superoxide dismutase (SOD), 0.1 μM catalase, 0.5–1.0 mg submitochondrial protein/mL, and 25 μM HbO2 (expressed per heme group). HbO2 reacts efficiently with NO if the reaction between NO and O2 is prevented. SOD is added to abrogate any other reaction with O2-, including a direct oxidation of HbO2 to metHb or reduction of metHb to hemoglobin. Since in the presence of SOD, H2O2 could be produced and consequently oxidize both HbO2 and metHb, catalase was added.Controls adding 0.5 mM Nx-nitro-L-arginine (L-NNA) and 0.5 mM N-nitro-L-arginine-methyl-ester (L-NAME) as NOS inhibitors were performed in all cases to give specificity to the assay; addition of L-NNA and L-NAME inhibited the rate of hemoglobin oxidation by about 73% and 50% respectively [19,20].

Evaluation of superoxide anion (O2-) production

The rate of O2- production was evaluated in submitochondrial membranes, measuring the O2--dependent oxidation of epinephrine to adrenochrome at 37°C (ε480 nm = 4.0 mM-1 cm-1) [21]. The reaction medium contained: 1 mM epinephrine, 0.23 M mannitol, 0.07 M sucrose, 0.1 μM catalase, 20 mM Tris-HCl pH 7.4, and submitochondrial particles (0.15 mg protein/mL). A 60 mM epinephrine bitartrate solution, pH 2.0, kept in ice, was diluted in the reaction medium immediately before use. SOD was used at 0.1–0.3 µM final concentration to give assay specificity [22].

Submitochondrial membranes were supplemented with substrates and inhibitors to obtain maximal O2- production. NADH (50 μM) and succinate (7 mM) were used as substrates and rotenone (1 µM) as a specific inhibitor to evaluate O2- production at the NADH dehydrogenase and at the ubiquinone-cytochrome b region, respectively.

Determination of Nos1 and Nos3 mRNA expression

To determine nitric oxide synthases (NOS) Nos1 (neuronal isoform) and Nos3 (endothelial isoform) mRNA expression, total RNA was isolated from renal homogenates using the SV total RNA Isolation System (Promega, Madison, WI, USA). Total RNA was reverse-transcribed to cDNA using a high-capacity reverse transcription kit (A&B – Applied Biosystems, CA, USA). For real-time detection of Nos1 and Nos3 transcripts and the reference gene (Gapdh), MezclaReal (Real-Time PCR commercial mixture from Biodynamics, Argentina) and specific primers (For Nos1 and Nos3: IDT -Integrated DNA Technologies and for Gapdh: GBT Oligos) were used (Table 1). The normalized gene expression method (2–∆∆CT) for the relative quantification of gene expression was used. The difference in the cycle threshold (CT) for Nos1/Nos3 and Gapdh for control rats was subtracted from the difference in the CT for Nos1/Nos3 and Gapdh for each of the experimental groups [23]. The following formula was applied: ∆∆CT = (CTNOS – CTGAPDH) experimental – (CTNOS – CTGAPDH) control rats).

Table 1. Sequences of the Real-Time PCR primers used.

Target gene Forward primer (5´-3´) Reverse primer (5´-3´)
Gapdh GAAGGGCTCATGACCACAGT GGATGCAGGGATGATGTTCT
Nos1 CTGCAAAGCCCTAAGTCCAG AGTGTTCCTCTCCTCCAGCA
Nos3 GCAAGACCGATTACACGACA GCTCTCAGGAGGTCTTGCAC

The real-time PCR started at 94°C for 2 min and was followed by 35 thermal cycles at 94°C for 15 s, 58°C for 35 s and 72°C for 30 s.

Determination of NADPH-diaphorase activity in cortical renal structures

To determine NADPH-diaphorase (NADPH-d) activity, renal tissue was processed using the NADPH-d histochemical method according to Rothe et al. [24]. This method can detect cells containing any of the NOS isoforms [25], and can be used to monitor NOS activity at a cellular level. The kidneys were fixed with 4% paraformaldehyde in 0.1 M phosphate buffer pH 7.4, cryoprotected with sucrose, frozen, sectioned at 12 µm, and mounted on gelatin-coated glass slides. Sections were simultaneously incubated at 37°C for 1 h in a reaction mixture containing 0.1% β-NADPH and 0.02% nitrobluetetrazolium diluted in 0.1 M phosphate buffer with 0.3% Triton X-100 and then mounted in PBS/glycerol (1:3). Observation, optical density (OD) measurement, and photography were made with a Nikon Alphaphot-2 YS2 coupled to a SONY camera Model No. SSC-DC50A (magnification 400x). NADPH-d-stained cells were measured by Image J. Each set of OD measurements (control and experimental groups) was performed blindly and under standardized conditions. After automatic normalization of grayscale, the same interactive delineation and contrast enhancement of all images was performed. This process was done in different renal structures of the same section and different sections of the same kidney [26].

Determination of the hydrogen peroxide (H2O2) production rate

The hydrogen peroxide (H2O2) production rate was determined in freshly isolated mitochondria (0.2 μg protein/μL) by the Amplex Red-horseradish peroxidase (HRP) fluorescent assay (λEXCITATION = 563 nm/λEMISSION = 587 nm) using a Varioskan® LUX microplate reader at 30 °C. Buffer solution (125 mM sucrose, 65 mM KCl, 10 mM HEPES, 2 mM KH2PO4, 1 M MgCl2, 0.01% PFA-BSA; pH 7.2), 2 mM malate, and 5 mM glutamate were supplemented with 25 μM Amplex™ Red (Invitrogen /Thermo Fischer; Waltham, Massachusetts, USA; Cat No. A36006) and 0.5 U mL-1 HRP, and samples were added.

A H2O2 standard solution was used for calibration (ε240 nm = 43.6 M-1 cm-1), and results were expressed as nmol H2O2/min.mg protein [27].

Determination of catalase activity

Catalase activity was determined in submitochondrial membranes by spectrophotometry, following absorbance decrease of H2O2 at 240 nm, in a medium containing 50 mM phosphate buffer and 10 mM H202 (pH 7.2), and expressed as pmoles enzyme/min mg protein [28].

Determination of glutathione peroxidase activity

Glutathione peroxidase (GPx) activity was measured in submitochondrial membranes following NADPH oxidation at 340 nm (ε340 nm = 6.22 mM-1 cm-1) in the presence of 0.17 mM reduced glutathione, 0.2 U/mL glutathione reductase and 0.5 mM tert-butyl hydroperoxide and expressed as µmol/min mg protein [28].

Statistical analysis

Data were analyzed using two-way ANOVA, with treatment and sex as factors. The main effect of each factor and the interaction between the factors were tested. Bonferroni´s post-test was used for multiple comparisons. Data are presented as the mean ± standard error of the mean. GraphPad Prism version 8.0 project for Windows, GraphPad Software (San Diego, CA, USA) was used. The null hypothesis was rejected when p < 0.05.

Non-continuous variables such as the number of PCNA-positive nuclei and the number of TUNEL-positive nuclei were analyzed using the non-parametric Scheirer-Ray-Hare test. The main effect of each factor and the interaction between both factors were tested. The non-parametric post-hoc test Mann–Whitney U (Wilcoxon rank-sum) for multiple comparisons was used. These data were analyzed using R 3.0.2 for Windows and expressed as the median and the minimum-maximum range. A significant difference was considered when p < 0.05.

Results

To investigate the molecular basis of the previously reported glomeruli defect in postnatally ERA-treated rats (1), we measured body and renal weights, markers of cell proliferation and apoptosis, nitric oxide signaling, oxidative stress and antioxidant defenses in control and ERA-treated 7-day-old rats.

Animal body and renal weights

No significant differences were observed in body weight between experimental groups on PD 7. Similarly, no significant differences were observed in kidney weight or kidney weight/100 g b.w. between experimental groups. Results are shown in Table 2.

Table 2. Growth parameters in control and ERA-treated 7-day-old rats.

Cm

(n = 16)
ERAm

(n = 19)
Cf

(n = 19)
ERAf

(n = 19)
Body weight (g) 17.50 ± 0.53 17.39 ± 0.41 18.00 ± 0.48 17.95 ± 0.55
Renal weight (g) 0.098 ± 0.005 0.094 ± 0. 003 0.103 ± 0.004 0.101 ± 0.004
Renal weight (g)/100 g b.w. 0.552 ± 0.014 0.542 ± 0.009

0.567 ± 0. 010 0.564 ± 0. 010

Values are mean ± SEM. Data were analyzed using two-way ANOVA followed by the Bonferroni post-test. ERA treatment and sex had no significant effect on any of the parameters tested. Cm: control males; ERAm: ERA-treated males; Cf: control females; ERAf: ERA-treated females.

Cellular proliferation and apoptosis

ERA treatment did not modify renal cellular proliferation (evaluated by PCNA expression) in the cortical area or in the juxtamedullary area. On the other hand, cellular death (assessed by TUNEL assay) showed a significant interaction between sex and ERA treatment in the juxtamedullary area (p < 0.001). Both male and female ERA-treated rats showed a higher number of apoptotic nuclei than their respective controls. However, while ERAm increased the number of apoptotic nuclei 8-fold, ERAf increased it only 4-fold versus their respective control. These results are shown in Table 3 and representative images in Figs 1A, 1B, and 2.

Table 3. Cellular proliferation and apoptosis evaluated by PCNA and TUNEL in the renal cortex of 7-day old rats.

Cm

ERAm

Cf

ERAf

PCNA (CA) 368.5

(317-639)
392.5

(229-610)
523.5

(380-930)
482

(174-943)
PCNA (JA) 663

(623-773)
679.5

(546-697)
871

(805-877)
617.5

(407-914)
TUNEL (CA) 8.5

(5-16)
13.5

(8-17)
11.5

(9-15)
17.5

(8-22)
TUNEL (JA) 11.5

(7-26)
95*

(25-113)
7.0

(6-11)
33.5#

(14-82)

PCNA: Proliferating Cell Nuclear Antigen; TUNEL: Terminal deoxynucleotidyl transferase (TdT) dUTP Nick-End Labeling assay. The number of positive nuclei per 10 fields was counted for each experimental unit. Results are expressed as the median, representing the central value, along with the minimum and maximum values, indicating the range of the data (PCNA: n = 4/experimental group; TUNEL: n = 4/experimental group). * p < 0.05 vs CM; # p < 0.05 vs CF. Cm: control males; ERAm: ERA-treated males; Cf: control females; ERAf: ERA-treated females. CA: cortical area; JA: juxtamedullary area.

Fig 1. Cellular proliferation assessment by PCNA immunohistochemistry in the renal cortex of 7-day-old rats.

Fig 1

1A: Representative images of PCNA immunohistochemistry in the cortical area; 1B: Representative images of PCNA immunohistochemistry in the juxtamedullary area. Cm: control males; ERAm: ERA-treated males; Cf: control females; ERAf: ERA-treated females. Black arrows show some positive nuclei. Total magnification: 400x.

Fig 2. Cellular death assessment by TUNEL assay in the renal cortex of 7-day-old rats.

Fig 2

Representative images for TUNEL assay in the renal cortex; CA: cortical area; JA: juxtamedullary area. A = control males (CA); B = ERA-treated males (CA); C = control females (CA); D = ERA-treated females (CA). E = control males (JA); F = ERA-treated males (JA); G = control females (JA); H = ERA-treated females (JA). Black arrows show some positive nuclei. Total magnification: 400x.

Renal TBARS production

Two-way ANOVA showed an effect of ERA treatment (p < 0.005). Despite this significant effect in ERA treatment, Bonferroni post-test showed that TBARS levels were significantly higher only in ERAm vs Cm (p < 0.05) (Fig 3).

Fig 3. Renal TBARS production in 7-day-old rats.

Fig 3

Thiobarbituric acid-reacting substances (TBARS) production in renal homogenates of 7-day-old rats. Data are expressed as mean ± SEM (n = 5/experimental group). Data were analyzed using two-way ANOVA followed by the Bonferroni post-test. Treatment with ERA had a significant overall effect (p<0.005). *p < 0.05 vs indicated group. Cm: control males; ERAm: ERA-treated males; Cf: control females; ERAf: ERA-treated females.

NO to O2- ratio in renal mitochondria

ERA treatment had an overall effect decreasing the NO to O2- ratio in renal mitochondria (p < 0.05). (Fig 4).

Fig 4. Nitric oxide (NO) to Superoxide anion (O2-) ratio in renal isolated mitochondria of 7-day-old rats.

Fig 4

Data are expressed as mean ± SEM (n = 5/experimental group). Data were analyzed using two-way ANOVA followed by the Bonferroni post-test. Treatment with ERA had a significant overall effect (p < 0.05). Cm: control males; ERAm: ERA-treated males; Cf: control females; ERAf: ERA-treated females.

The underlying data to generate the ratio NO/O-2 are included in Supplementary fig 1 (S1 Fig). S1 Fig shows that there were no significant changes in mitochondrial NO production between groups. However, sex and treatment had an overall effect on O2- mitochondrial production (p < 0.05), showing the highest levels of O2- production in ERAm.

Nos1 and Nos3 mRNA expression levels in renal homogenates

A significant interaction between sex and ERA treatment was observed (p < 0.05) for both Nos1 and Nos3 mRNA expression levels, indicating that ERA treatment effect on these variables is sex-dependent. Bonferroni post-test analysis revealed that ERAm had reduced Nos1 and Nos3 mRNA expression levels compared to ERAf (Fig 5).

Fig 5. Nos1 and Nos3 mRNA expression levels in renal homogenates of 7-day-old rats.

Fig 5

(A) Nos1 mRNA expression levels (B) Nos3 mRNA expression levels. mRNA levels are expressed as relative values from control rats. Data are expressed as mean ± SEM of at least five independent experiments. Data were analyzed using two-way ANOVA followed by the Bonferroni post-test. There was a statistically significant interaction between the effects of ERA treatment and sex on Nos1 and Nos3 mRNA expression levels (p < 0.05). *p < 0.05 vs. indicated groups. Cm: control males; ERAm: ERA-treated males; Cf: control females; ERAf: ERA-treated females.

NADPH-diaphorase activity in renal cortical structures

Table 4 shows NADPH-d activity (expressed as arbitrary units of OD) in different cortical renal structures. A significant interaction between sex and ERA treatment was detected for NADPH-d activity in immature structures. Bonferroni post-test revealed that ERAm exhibited a reduced NADPH-d activity in immature structures compared to Cm. In addition, ERA treatment exerted a significant overall effect on the macula densa (p < 0.01). No changes in NADPH-d activity were found in glomeruli or proximal tubules between experimental groups.

Table 4. NADPH-diaphorase activity in renal cortical structures of 7-day-old rats.

Cm ERAm Cf ERAf
Glomeruli 0.598 ± 0.023 0.535 ± 0.028 0.562 ± 0.028 0.526 ± 0.025
Immature structures 0.664 ± 0.041 0.557 ± 0.011* 0.595 ± 0.019 0.597 ± 0.013
Proximal tubules 0.633 ± 0.015 0.673 ± 0.024 0.623 ± 0.045 0.589 ± 0.021
Macula densa 0.700 ± 0.026 0.615 ± 0.005 0.746 ± 0.042 0.674 ± 0.009

The values are expressed as optical density (OD arbitrary units) (mean ± SEM; n = 5/experimental group). Data were analyzed using two-way ANOVA followed by the Bonferroni post-test. There was a significant interaction between the administration of ERA and sex on immature structures (p < 0.05). Treatment with ERA had a significant overall effect on the macula densa. *p < 0.05 vs Cm. Cm: control males; ERAm: ERA-treated males; Cf: control females; ERAf: ERA-treated females.

Representative images of the different structures analyzed are shown in Fig 6.

Fig 6. NADPH-diaphorase activity in renal cortical structures of 7-day-old rats.

Fig 6

Representative images of NADPH-diaphorase activity assay in different renal structures. A = control males; B = ERA-treated males; C = control females; D = ERA-treated females. White arrows show macula densa cells. Total magnification: 400x.

Hydrogen peroxide production and antioxidant enzyme activity in renal mitochondria

Two-way ANOVA showed a statistically significant interaction between the effects of ERA treatment and sex on H2O2 production (p < 0.01) (Fig 7A). Bonferroni post-test analysis revealed that ERAm had an increased H2O2 production compared to ERAf (p < 0.05). In addition, ERAf showed a decreased H2O2 production versus Cf (p < 0.05).

Fig 7. Hydrogen peroxide production rate and antioxidant enzyme activity in renal mitochondria of 7-day-old rats.

Fig 7

(A) Hydrogen peroxide (H2O2) production rate in freshly isolated renal mitochondria. (B) Catalase activity in renal mitochondria. (C) Glutathione Peroxidase activity in renal mitochondria. Data are expressed as mean ± SEM of at least five independent experiments. Two-way ANOVA showed a statistically significant interaction between the effects of ERA treatment and sex on Catalase activity (p < 0.0001) and H2O2 production (p < 0.01). *p < 0.05, **p < 0.01, ***p < 0.001 vs indicated group. Cm: control males; ERAm: ERA-trated males; Cf: control females; ERAf: ERA-treated females.

A statistically significant interaction between the effects of ERA treatment and sex was also observed on catalase activity (p < 0.0001). Bonferroni post-test analysis showed that ERA treatment decreased catalase activity in males (p < 0.01) and, conversely, increased it in females (p < 0.01) versus their respective controls. In addition, catalase activity was higher in ERAf than in ERAm (p < 0.05) (Fig 7B).

No significant changes were found in GPx activity between experimental groups (Fig 7C).

Discussion

The “Developmental Origins of Health and Disease” (DOHaD) theory postulates that some adult diseases, such as hypertension and kidney disease, originate in early life. The exposure to adverse stressors during development induces the adaptation of the genetic program, leading to structural, physiological, and metabolic changes in different organs, predisposing to diseases in adult life [29]. Given the kidney´s vulnerability to early-life stressors, renal programming is key in the developmental programming of hypertension and renal diseases [29,30]. In rats, nephrogenesis begins on embryonic day 12, but renal development continues during the early postnatal period [31]. Thus, both the fetus and the neonate are at risk of renal programming [32].

Previously, we demonstrated that the administration of a dual ERA during the first 21 days of life of SD rats decreases glomerular number in the renal juxtamedullary area in both ERAm and ERAf by histomorphometry and only in ERAm by the acid maceration method. The decreased glomerular number could be due to decreased cellular proliferation and/or increased apoptosis [1]. In the current study, we found no changes in renal cellular proliferation, but found an increased number of apoptotic nuclei in 7-day-old ERAm and ERAf, specifically in the juxtamedullary area, consistent with our previous work [1].

These results align with those described by Yoo et al., who showed that ERA administration from PD 1–7 increases apoptotic cells in the developing rat kidney, but, contrary to our results, they found a reduced number of PCNA-positive renal cells [8]. The differences with our results could be due to the type of ERA treatment: while these authors administered an ERA that specifically blocked ETA receptors, we used an ERA that blocks both ETA and ETB receptors. Another difference with our study is that Yoo et al. showed a reduced kidney size after ETA blockade, while the treatment with a dual ERA did not affect body weight, kidney weight or kidney weight/100 g b.w. in 7-day-old male and female rats, despite the increased apoptosis observed in the juxtamedullary area.

A mechanism for increased apoptosis is oxidative stress [14]. During development, cell metabolism increases, producing large amounts of reactive oxygen and nitrogen species (ROS/RNS). To ensure proper development, cells must protect themselves from the potential deleterious effects of these species [33]. However, when the capacity of the antioxidant system is surpassed, ROS can induce tissue damage and impaired organ functionality [33]. In this study, ERAm showed increased renal TBARS levels when compared with Cm, suggesting increased renal lipid peroxidation.

Additionally, the NO pathway was impaired, with a decreased NADPH-d activity in immature structures that originate the glomeruli in ERAm vs Cm, but not in ERAf. Besides, we found an overall significant effect of ERA treatment with lower values of NADPH-d activity in the macula densa of ERA-treated rats vs controls. The effects of ERA treatment on Nos1 and Nos3 mRNA renal expression were sex-dependent, decreasing Nos1 and Nos3 mRNA renal expression levels in males and increasing their expression in females, suggesting that ERAf are more protected than ERAm.

An imbalance between NO and ROS under oxidative stress favors oxidative reactions in organs involved in the control of blood pressure, such as the kidneys, resulting in the development of hypertension [34]. Here, we found that ERA treatment had an overall effect, decreasing NO to O2- ratio in ERA-treated rats vs controls. Interestingly, Tain et al. reported that asymmetric dimethylarginine, a ROS inducer and endogenous NOS inhibitor, inhibited ureteric bud branching morphogenesis, leading to decreases in nephron number [16]. Considering these findings, the impaired NO pathway and the decreased NO to O2- ratio seen in 7-day-old ERA-treated rats could be linked to the lower glomerular endowment that we had found previously in ERA-treated 21-day-old rats [1].

On the other hand, NO and O2- exert opposing effects on both vascular and tubular function at the renal level, and the balance between them modulates renal sodium handling. NO promotes water and sodium excretion, favoring BP reduction, while O2- promotes water and salt retention, leading to a BP increase [35]. Imbalance of the NO to O2- ratio alters renal hemodynamics and renal excretory function, leading to salt retention, contributing to the development of salt-sensitive hypertension [36].

Another important non-radical ROS is H2O2. ERA treatment effect on H2O2 renal mitochondrial production was sex-dependent: ERA treatment increased H2O2 production in males, while decreased it in females. ERA treatment also influenced catalase activity in a sex-dependent manner. ERAm showed decreased catalase activity, while ERAf showed increased catalase activity, suggesting that females treated with a dual ERA during the early postnatal period may be more protected than males. The increased H2O2 production in ERAm may contribute to hydroxyl radical formation and could explain the increase observed in renal TBARS levels [37]. We found no changes in the activity of GPx, another important antioxidant enzyme, between experimental groups.

Previous research articles studying renal oxidative stress and its relationship with hypertension of developmental origins in animal models focus mainly on the NO pathway and oxidative stress markers, such as 8-hydroxydeoxyguanosine, and evaluate the offspring after weaning or during adulthood [12,38,39]. In this work, we investigated not only the renal NO pathway and TBARS levels, but also antioxidant enzymes such as catalase and GPx, and renal ROS, such as H2O2, in renal tissue during the early postnatal period.

Oxidative stress could affect not only prime organs involved in the regulation of blood pressure, but also coordinated regulatory systems such as the renin-angiotensin system and ET system [38]. Further studies are needed to elucidate whether the inhibition of the ET system during the early postnatal period could also impair kidney regulatory systems, and to establish potential links between the altered regulatory systems and renal programming in this experimental model.

Previously, we reported that males treated with a dual ERA during the early postnatal period increased their systolic blood pressure after a high-sodium diet in adulthood, showing impaired capacity to excrete sodium and water with an increased renomedullary expression of aquaporin-2 and α-epithelial sodium channel and a decreased renomedullary ET-1 production [2]. Thus, the early imbalance between NO and O2 favoring O2- over NO observed in ERA-treated rats could be one of the mechanisms driving salt sensitivity.

Finally, several studies have established a link between ROS generation and epigenetic marks: the increase in ROS levels may be one of the downstream mediators that initiates epigenetic changes and renal programming in offspring [40]. Considering these findings, the early-life renal oxidative stress observed in ERA-treated rats may induce epigenetic modifications contributing to salt sensitivity in adulthood. These modifications may lead to altered renal expression of proteins involved in sodium and water handling or to altered expression of proteins that regulate blood pressure. Further research is required to determine whether ERA-treated rats exhibit distinct epigenetic marks compared to controls and to establish a potential link between these marks and early-life renal oxidative stress.

In summary, this study shows that the alterations previously observed in the kidneys of ERA-treated rats during the postnatal period (decreased glomerular number, decreased juxtamedullary filtration surface area and glomerular filtration rate) could be due to an early imbalance between NO and ROS, increasing renal oxidative stress and leading to a misbalance between proliferation and apoptosis increasing apoptosis at the level of the juxtamedullary cortex, especially in the structures that originate the glomeruli. We also showed some sex differences, especially in Nos1 and Nos3 expression, in H2O2 production and in catalase activity, suggesting that females are more protected than males, even at an early stage of development, without the influence of sex hormones.

Understanding the molecular mechanisms underlying endothelin inhibition in the early postnatal period could have potential utility for the design of reprogramming strategies.

Supporting information

S1 Fig. NO and O2- production in renal mitochondria.

Nitric oxide (NO) and Superoxide anion (O2-) production in renal isolated mitochondria of 7-day-old rats. Data are expressed as mean ± SEM (n = 5/experimental group). Data were analyzed using two-way ANOVA followed by the Bonferroni post-test. Sex and ERA treatment had a significant overall effect on O2- production (*p < 0.05); ns = non-significant. Cm: control males; ERAm: ERA-treated males; Cf: control females; ERAf: ERA-treated females.

(TIF)

pone.0353524.s001.tif (176.8KB, tif)

Acknowledgments

The authors thank to Professor Myriam Nuñez and to Mariano Reynoso for their statistical analysis advice.

Data Availability

All data used to obtain the results were included in a database of the CONICET institutional repository under the identifier: http://hdl.handle.net/11336/287990 CONICET is the National Council for Scientific and Technical Research in Argentina.

Funding Statement

This study was supported by grant UBACyT 2018, Mod I, number 20020170100135BA from Universidad de Buenos Aires to Mónica P. Majowicz.

References

  • 1.Albertoni Borghese MF, Ortiz MC, Balonga S, Moreira Szokalo R, Majowicz MP. The Role of Endothelin System in Renal Structure and Function during the Postnatal Development of the Rat Kidney. PLoS One. 2016;11:e0148866. doi: 10.1371/journal.pone.0148866 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Albertoni Borghese MF, Ortiz MDC, Marinoni RC, Oronel LH, Palamidessi M, Yarza CA. Inhibition of endothelin system during the postnatal nephrogenic period in the rat. Its relationship with hypertension and renal disease in adulthood. PLoS One. 2020;15:e0229756. doi: 10.1371/journal.pone.0229756 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Brenner BM, Garcia DL, Anderson S. Glomeruli and blood pressure. Less of one, more the other? Am J Hypertens. 1988;1(4 Pt 1):335–47. doi: 10.1093/ajh/1.4.335 [DOI] [PubMed] [Google Scholar]
  • 4.Fukunaga S, Fujita Y. Low glomerular number at birth can lead to the development of chronic kidney disease. Front Endocrinol (Lausanne). 2023;14:1120801. doi: 10.3389/fendo.2023.1120801 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Morton JS, Cooke CL, Davidge ST. In utero origins of hypertension: mechanisms and targets for therapy. Physiol Rev. 2016;96:549–603. doi: 10.1152/physrev.00015.2015 [DOI] [PubMed] [Google Scholar]
  • 6.Ho J. The regulation of apoptosis in kidney development: implications for nephron number and pattern? Front Pediatr. 2014;2:128. doi: 10.3389/fped.2014.00128 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Alexander BT. Intrauterine growth restriction and reduced glomerular number: role of apoptosis. American Journal of Physiology Regulatory, Integrative and Comparative Physiology. 2003;R933–4. doi: 10.1152/ajpregu.00446.2003 [DOI] [PubMed] [Google Scholar]
  • 8.Yoo KH, Yim HE, Jang GY, Bae IS, Choi BM, Hong YS, et al. Endothelin A receptor blockade influences apoptosis and cellular proliferation in the developing rat kidney. J Korean Med Sci. 2009;24(1):138–45. doi: 10.3346/jkms.2009.24.1.138 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.De Miguel C, Hamrick WC, Hobbs JL, Pollock DM, Carmines PK, Pollock JS. Endothelin receptor-specific control of endoplasmic reticulum stress and apoptosis in the kidney. Sci Rep. 2017;7:43152. doi: 10.1038/srep43152 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Han K-H, Jung J-Y, Chung K-Y, Kim H, Kim J. Nitric oxide synthesis in the adult and developing kidney. Electrolyte Blood Press. 2006;4(1):1–7. doi: 10.5049/EBP.2006.4.1.1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Mazzei L, Manucha W. Growing evidence suggests WT1 effects in the kidney development are modulated by Hsp70/NO interaction. J Nephrol. 2017;30(1):11–8. doi: 10.1007/s40620-016-0302-9 [DOI] [PubMed] [Google Scholar]
  • 12.Hsu CN, Tain YL. Developmental origins of kidney disease: why oxidative stress matters?. Antioxidants (Basel, Switzerland). 2020. doi: 10.3390/antiox10010033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.DeFreitas MJ, Katsoufis CP, Benny M, Young K, Kulandavelu S, Ahn H, et al. Educational Review: The Impact of Perinatal Oxidative Stress on the Developing Kidney. Front Pediatr. 2022;10:853722. doi: 10.3389/fped.2022.853722 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Vakifahmetoglu-Norberg H, Ouchida AT, Norberg E. The role of mitochondria in metabolism and cell death. Biochem Biophys Res Commun. 2017;482(3):426–31. doi: 10.1016/j.bbrc.2016.11.088 [DOI] [PubMed] [Google Scholar]
  • 15.Ho HJ, Shirakawa H. Oxidative Stress and Mitochondrial Dysfunction in Chronic Kidney Disease. Cells. 2022;12. doi: 10.3390/cells12010088 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Tain Y-L, Lee W-C, Hsu C-N, Lee W-C, Huang L-T, Lee C-T, et al. Asymmetric dimethylarginine is associated with developmental programming of adult kidney disease and hypertension in offspring of streptozotocin-treated mothers. PLoS One. 2013;8(2):e55420. doi: 10.1371/journal.pone.0055420 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Sundrani DP, Roy SS, Jadhav AT, Joshi SR. Sex-specific differences and developmental programming for diseases in later life. Reprod Fertil Dev. 2017;29(11):2085–99. doi: 10.1071/RD16265 [DOI] [PubMed] [Google Scholar]
  • 18.Gingery A, Soldner ELB, Heltemes A, Nelson A, Bozadjieva N. Developmental programming of the kidney: does sex matter? J Physiol. 2009;587(Pt 23):5521–2. doi: 10.1113/jphysiol.2009.179721 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ortiz MDC, Lores-Arnaiz S, Albertoni Borghese MF, Balonga S, Lavagna A, Filipuzzi AL, et al. Mitochondrial dysfunction in brain cortex mitochondria of STZ-diabetic rats: effect of l-Arginine. Neurochem Res. 2013;38(12):2570–80. doi: 10.1007/s11064-013-1172-3 [DOI] [PubMed] [Google Scholar]
  • 20.Murphy ME, Noack E. Nitric oxide assay using hemoglobin method. Methods Enzymol. 1994;233:240–50. doi: 10.1016/s0076-6879(94)33027-1 [DOI] [PubMed] [Google Scholar]
  • 21.Boveris A. Determination of the production of superoxide radicals and hydrogen peroxide in mitochondria. Methods Enzymol. 1984;105:429–35. doi: 10.1016/s0076-6879(84)05060-6 [DOI] [PubMed] [Google Scholar]
  • 22.Velez-Pardo C, Jimenez-Del-Rio M, Lores-Arnaiz S, Bustamante J. Protective effects of the synthetic cannabinoids CP55,940 and JWH-015 on rat brain mitochondria upon paraquat exposure. Neurochem Res. 2010;35(9):1323–32. doi: 10.1007/s11064-010-0188-1 [DOI] [PubMed] [Google Scholar]
  • 23.Livak KJ, Schmittgen TD. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods. 2001;25(4):402–8. doi: 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  • 24.Rothe F, Canzler U, Wolf G. Subcellular localization of the neuronal isoform of nitric oxide synthase in the rat brain: a critical evaluation. Neuroscience. 1998;83(1):259–69. doi: 10.1016/s0306-4522(97)00373-4 [DOI] [PubMed] [Google Scholar]
  • 25.Gonzalez-Zulueta M, Dawson VL, Dawson TM. Histochemical analysis of nitric oxide synthase by NADPH diaphorase staining. Curr Protoc Toxicol. 2001;Chapter 10:Unit 10.6. doi: 10.1002/0471140856.tx1006s01 [DOI] [PubMed] [Google Scholar]
  • 26.Ortiz MC, Albertoni Borghese MF, Balonga SE, Lavagna A, Filipuzzi AL, Elesgaray R. Renal response to L-arginine in diabetic rats. A possible link between nitric oxide system and aquaporin-2. PLoS One. 2014;9:e104923. doi: 10.1371/journal.pone.0104923 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Mishin V, Heck DE, Laskin DL, Laskin JD. The amplex red/horseradish peroxidase assay requires superoxide dismutase to measure hydrogen peroxide in the presence of NAD(P)H. Free Radic Res. 2020;54(8–9):620–8. doi: 10.1080/10715762.2020.1821883 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Karadayian AG, Malanga G, Czerniczyniec A, Lombardi P, Bustamante J, Lores-Arnaiz S. Free radical production and antioxidant status in brain cortex non-synaptic mitochondria and synaptosomes at alcohol hangover onset. Free Radic Biol Med. 2017;108:692–703. doi: 10.1016/j.freeradbiomed.2017.04.344 [DOI] [PubMed] [Google Scholar]
  • 29.Tain Y-L, Hsu C-N. Targeting on Asymmetric Dimethylarginine-Related Nitric Oxide-Reactive Oxygen Species Imbalance to Reprogram the Development of Hypertension. Int J Mol Sci. 2016;17(12):2020. doi: 10.3390/ijms17122020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Sampogna RV, Schneider L, Al-Awqati Q. Developmental Programming of Branching Morphogenesis in the Kidney. J Am Soc Nephrol. 2015;26(10):2414–22. doi: 10.1681/ASN.2014090886 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Márquez MG, Cabrera I, Serrano DJ, Sterin-Speziale N. Cell proliferation and morphometric changes in the rat kidney during postnatal development. Anat Embryol (Berl). 2002;205(5–6):431–40. doi: 10.1007/s00429-002-0262-9 [DOI] [PubMed] [Google Scholar]
  • 32.Albertoni Borghese MF, Oronel LH, Ortiz MDC, Majowicz MP. Hypertension and renal disease programming: focus on the early postnatal period. Clin Sci (Lond). 2022;136(17):1303–39. doi: 10.1042/CS20220293 [DOI] [PubMed] [Google Scholar]
  • 33.Hernández-García D, Wood CD, Castro-Obregón S, Covarrubias L. Reactive oxygen species: A radical role in development? Free Radic Biol Med. 2010;49(2):130–43. doi: 10.1016/j.freeradbiomed.2010.03.020 [DOI] [PubMed] [Google Scholar]
  • 34.Sinha N, Dabla PK. Oxidative stress and antioxidants in hypertension-a current review. Curr Hypertens Rev. 2015;11(2):132–42. doi: 10.2174/1573402111666150529130922 [DOI] [PubMed] [Google Scholar]
  • 35.Cowley AW Jr. Renal medullary oxidative stress, pressure-natriuresis, and hypertension. Hypertension. 2008;52(5):777–86. doi: 10.1161/HYPERTENSIONAHA.107.092858 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Majid DSA, Kopkan L. Nitric oxide and superoxide interactions in the kidney and their implication in the development of salt-sensitive hypertension. Clin Exp Pharmacol Physiol. 2007;34(9):946–52. doi: 10.1111/j.1440-1681.2007.04642.x [DOI] [PubMed] [Google Scholar]
  • 37.Kalyanaraman B. Teaching the basics of redox biology to medical and graduate students: Oxidants, antioxidants and disease mechanisms. Redox Biol. 2013;1(1):244–57. doi: 10.1016/j.redox.2013.01.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Tain YL, Hsu CN. Oxidative stress-induced hypertension of developmental origins: preventive aspects of antioxidant therapy. Antioxidants (Basel, Switzerland). 2022. doi: 10.3390/antiox11030511 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Lu P-C, Tain Y-L, Lin Y-J, Hsu C-N. Oxidative Stress in Maternal and Offspring Kidney Disease and Hypertension: A Life-Course Perspective. Antioxidants (Basel, Switzerland). 2025;14. doi: 10.3390/antiox14040387 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Tain YL, Joles JA. Reprogramming: A preventive strategy in hypertension focusing on the kidney. Int J Mol Sci. 2015;17. doi: 10.3390/ijms17010023 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. NO and O2- production in renal mitochondria.

Nitric oxide (NO) and Superoxide anion (O2-) production in renal isolated mitochondria of 7-day-old rats. Data are expressed as mean ± SEM (n = 5/experimental group). Data were analyzed using two-way ANOVA followed by the Bonferroni post-test. Sex and ERA treatment had a significant overall effect on O2- production (*p < 0.05); ns = non-significant. Cm: control males; ERAm: ERA-treated males; Cf: control females; ERAf: ERA-treated females.

(TIF)

pone.0353524.s001.tif (176.8KB, tif)

Data Availability Statement

All data used to obtain the results were included in a database of the CONICET institutional repository under the identifier: http://hdl.handle.net/11336/287990 CONICET is the National Council for Scientific and Technical Research in Argentina.


Articles from PLOS One are provided here courtesy of PLOS

RESOURCES